CN117965508A - Algin lyase mutant Pl7M and application thereof - Google Patents

Abstract

The invention belongs to the technical fields of molecular biology and protein engineering, and particularly relates to an algin lyase mutant Pl7M and application thereof. The mutant Pl7M with improved enzyme specific activity is obtained by taking algin lyase Pl7AaM as a starting template through site-directed saturation mutation and combined mutation. The specific activity of the mutant Pl7M enzyme obtained by the invention is 658.9U/mg, which is 1.53 times of that of the original template Pl7 AaM. In addition, the invention takes the bacillus subtilis as a host to realize the efficient expression of the mutant Pl7M, thereby laying a foundation for the industrialized application of the mutant Pl7M.

Description

Algin lyase mutant Pl7M and application thereof

Technical Field

The invention belongs to the technical fields of molecular biology and protein engineering, and particularly relates to an algin lyase mutant Pl7M and application thereof.

Background

Algin exists mainly in the cell wall and the cell matrix of brown algae, and is a marine acidic polysaccharide, and the algin is mainly formed by randomly polymerizing mannuronic acid and guluronic acid through glycosidic bonds. Algin has the defects of high viscosity, low bioavailability and the like due to high molecular weight. As a degradation product of algin, alginate oligosaccharides have good solubility, bioactivity and bioavailability, and thus have better application value in many fields. The current processing mode of alginate oligosaccharides mainly comprises a chemical method and an enzymatic method. The chemical method decomposes algin through strong acid and alkali, has the advantages of high reaction speed, simple process and the like, but the problems of incomplete product structure, more byproducts, environmental pollution and the like limit the wide application of the algin. Compared with a chemical method, an enzyme method is increasingly paid attention to as a novel technology at present, and has the advantages of mild reaction conditions, good product structure and the like.

Therefore, in order to expand the application range of the algin lyase, the method has important practical significance for further research of the algin lyase.

Disclosure of Invention

Based on the above, the invention provides the algin lyase mutant Pl7M and the application thereof, which effectively improve the enzyme activity and the thermal stability and lay a solid foundation for the next industrialized application.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

An algin lyase mutant Pl7M, wherein the amino acid sequence of the algin lyase mutant Pl7M is shown as SEQ ID NO. 1.

Preferably, the sequence encoding the amino acid is a polynucleotide sequence as shown in SEQ ID NO. 2.

The invention also provides a recombinant expression vector, which comprises the polynucleotide sequence of the algin lyase mutant Pl 7M.

The invention also provides a recombinant engineering bacterium which comprises the recombinant expression vector.

Preferably, the recombinant engineering bacteria take bacillus subtilis engineering strains as hosts.

Preferably, the bacillus subtilis includes bacillus subtilis WB800N.

The invention also provides application of the recombinant engineering bacteria in preparing mutants Pl7M with high enzyme specific activity.

In the previous study, the algin lyase Pl7AaM (patent application No. CN 202211412004.1) was obtained by proteolytic engineering. After the algin lyase Pl7AaM is treated in water bath at 40 ℃ and 45 ℃ for 1 hour, the residual enzyme activities are respectively 95.2% and 42.6%, which are higher than the reported various algin lyase. In the course of further studies, we found that the use cost of the algin lyase Pl7AaM was high, thereby limiting its industrial application. The algin lyase Pl7AaM is taken as a starting template, and the algin lyase mutant Pl7M with improved enzyme specific activity is obtained through junction point saturation mutation and combined mutation. In addition, bacillus subtilis is used as a host, so that efficient preparation of the mutant Pl7M is realized, and a foundation is laid for industrial application of the mutant Pl7M.

The invention is realized mainly by the following technology: (1) Obtaining the three-dimensional structure of the algin lyase Pl7AaM through homologous modeling, and obtaining the key amino acid site of the algin lyase Pl7AaM combined with a substrate for hydrolysis through molecular docking; (2) Effective mutants S58R, Q F and Q246W are obtained through site-directed saturation mutation; (3) The optimal mutant Pl7M is obtained by carrying out combined mutation on the effective mutant, and the enzyme specific activity of the optimal mutant Pl7M is 1.53 times of that of the initial template algin lyase Pl7 AaM; (4) And bacillus subtilis is used as a host, so that efficient preparation of the mutant Pl7M is realized.

Compared with the prior art, the invention has the technical advantages that: the algin lyase mutant Pl7M with remarkably improved enzyme specific activity is obtained through site-directed mutation and combined mutation, and efficient expression of the mutant Pl7M is realized by taking bacillus subtilis as a host, so that a foundation is laid for industrialized application of the mutant Pl 7M.

Drawings

FIG. 1 is a three-dimensional conformation and molecular docking diagram of algin lyase Pl7AaM;

FIG. 2 is a graph showing the results of optimal reaction temperature and thermal stability of algin lyase Pl7AaM and mutant Pl7M;

FIG. 3 is a graph showing pH and pH stability results of the optimal reaction of algin lyase Pl7AaM and mutant Pl7M;

FIG. 4 is a graph showing the substrate specificity results of algin lyase Pl7AaM and mutant Pl7M;

FIG. 5 is a flow chart of the construction of a mutant Pl7M Bacillus subtilis expression vector;

FIG. 6 is a graph showing the results of high-density fermentation of recombinant Bacillus subtilis P35.

Detailed Description

The present invention will be described in further detail with reference to examples, but embodiments of the present invention are not limited thereto. Molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the "guidelines for molecular cloning experiments" (third edition) j. Sambrook, or according to the kit and product instructions; the reagents and biological materials, unless otherwise specified, are commercially available.

The experimental materials and reagents involved in the invention are as follows:

1. Strains and vectors: coli strain Top10 (cat No. T0008) and bacillus subtilis WB800N (cat No. T0105) were purchased from WU vast, biosciences, inc., and the expression vector pPICZ. Alpha.A-pl 7aam was constructed by previous experiments (patent application No. CN 202211412004.1). The expression vector pHY-P _cry-SP_bs2 -aprbpm was constructed by earlier experiments (patent application number: CN202210419863.7, pHY-pcr-SPBs 2-aprbpm).

2. Enzyme and kit: q5 Hi-Fi Taq enzyme MIX was purchased from NEB company; plasmid extraction (# DP 103-03), gel purification kit (# DP 209-02) was purchased from Tiangen Biochemical technology (Beijing) Co., ltd; hi-Fi enzyme PRIMESTAR: ^HS (Premix), restriction enzymes were purchased from Bao Ri doctor materials technology (Beijing) Inc.

3. Culture medium: the E.coli medium was LB liquid medium (1% (w/v) peptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, pH 7.0). LBK was LB liquid medium plus 30. Mu.g/mL kanamycin. Ampicillin was added to LB liquid medium at a concentration of 25. Mu.g/mL. LBT the LB liquid medium was supplemented with tetracycline at a concentration of 50. Mu.g/mL. LB, LBK and LBA solid medium (i.e. LB plate, LBK plate and LBA plate), then additional 2.5% agar was added.

The maltose culture medium comprises the following components: 2.5% of yeast extract, 1.5% of peptone, 4% of maltose, 1% of sodium citrate, 0.3% of calcium chloride, 1% of dipotassium hydrogen phosphate and the balance of water.

The high-density fermentation medium comprises the following components: 7% of maltose, 2.5% of bean pulp, 1.5% of yeast powder, 2% of bran, 1% of dipotassium hydrogen phosphate, 0.3% of trisodium citrate, 0.3% of calcium chloride and the balance of water.

4. Reagent for measuring algin lyase activity: the activity of alginate lyase is measured by DNS method, and the main reagents comprise substrate sodium alginate (concentration is 0.5%, m/v) and color reagent DNS reagent ((6.3%o (w/v) 3, 5-dinitrosalicylic acid; 18.2% (w/v) potassium sodium tartrate tetrahydrate; 5%o (w/v) phenol; 5%o (w/v) anhydrous sodium sulfite)).

Example 1 algin lyase Pl7AaM three-dimensional modeling and homology modeling and molecular docking

The algin lyase Pl7AaM three-dimensional modeling process is as follows: (1) Firstly, matching the homologous templates of the algin lyase Pl7AaM through on-line software SWISS-MODEL (see website: https:// swissmodel. Expasy /); (2) And carrying out homologous modeling based on the homologous template with highest similarity, thereby obtaining the three-dimensional conformation (A in figure 1) of the algin lyase Pl7AaM.

The algin lyase Pl7AaM and substrate binding conformation diagram (as in FIG. 1B) was obtained by molecular docking software Autodock viner. The three-dimensional conformation obtained was analyzed by software Pymol, and it was found that the key amino acid positions of algin lyase Pl7AaM binding to the substrate include serine at position 58 (S58), asparagine at position 60 (N60), threonine at position 81 (T81), glutamine at position 134 (Q134), serine at position 139 (S139) and glutamine at position 246 (Q246). The mutant with improved enzyme specific activity is obtained by carrying out saturation mutation on the 6 amino acid sites.

EXAMPLE 2 construction of E.coli expression vector pET28a-pl7Aam

The escherichia coli has the advantages of simple operation, short experimental period, easy purification of recombinant expression protein and the like, so the patent uses escherichia coli BL21 (DE 3) as a host to carry out site-directed saturation mutation experiments. E.coli expression vector pET28a-pl7Aam is constructed before site-directed saturation mutation experiment.

The E.coli expression vector pET28a-pl7aam was constructed as follows:

(1) PCR amplification was performed with the vector pPICZ. Alpha.A-pl 7aam as template, and with the primers pl7aam-BamHI-fw (CGC GGATCCTTAGATTTTTATCGCTG) and pl7aam-XhoI-rev (GTGCTCGAGG TCGTGAGTAGCATCTAG). The PCR reaction system is shown in Table 1, and the PCR reaction conditions are as follows: the reaction conditions are as follows: pre-denaturation at 94℃for 5min; denaturation at 94℃for 10s, annealing at 50℃for 20s, extension at 72℃for 90s,33 cycles; the effect of PCR amplification was detected by agarose electrophoresis.

TABLE 1 Gene amplification reaction System

(2) Purifying and recovering the amplified PCR product, wherein the purifying process is carried out by referring to a gel purifying kit (# DP209-02); the purified PCR product was digested with restriction enzymes BamHI and XhoI, the reaction system was shown in Table 2, and after the digestion reaction at 37℃for 6 hours, it was purified by referring to the DNA product purification kit (#DP204).

TABLE 2 cleavage reaction System

(3) The E.coli vector pET28a was digested with restriction enzymes BamHI and XhoI, the digestion reaction system was as shown in Table 2 (the PCR product was replaced with vector pET28 a), and after 6 hours of digestion reaction at 37℃the DNA product was purified by referring to the DNA product purification kit (#DP204); the purified PCR product and the vector pET28a were subjected to ligation reaction, the ligation reaction system is shown in Table 3, and the reaction was carried out at 4℃for 16 hours.

TABLE 3 ligation reaction System

(4) The product after the ligation reaction is transferred into E.coli Top10, and the transformation process is as follows: (1) Placing E.coli competent cells Top10 (Tiangen Biochemical technology (Beijing) Co., ltd.) on ice for 30min, sucking out the connection product obtained in the step (3) by using a 20 mu L pipette, and transferring the connection product into a centrifuge tube containing 100 mu L E.coli competent cells; (2) E.coli competent cell Top10 containing the connection product is subjected to heat shock for 90s at 42 ℃, and then is kept stand on ice for 5min; (3) Inoculating heat-shock competent E.coli Top10 into 500 μl LB liquid medium, culturing at 37deg.C and 200rpm for 1 hr, uniformly coating the cultured bacterial liquid on LBK plate, standing in 37 deg.C incubator, and culturing for 18 hr; (4) E.coli transformants obtained by culturing at 37 ℃ are respectively inoculated into LBK liquid culture medium in the form of single colony, cultured at 37 ℃ at 200rpm for 1h, and then bacterial liquid PCR is carried out; (5) PCR amplification experiments were performed by using the cultured bacterial liquid as a template and primers pl7aam-BamHI-fw and pl7aam-XhoI-rev, wherein the PCR reaction system is shown in Table 4, and the reaction conditions are as follows: pre-denaturation at 94℃for 5min; denaturation at 94℃for 10s, annealing at 50℃for 30s, extension at 72℃for 90s,33 cycles; (6) And (3) analyzing the PCR amplification product by agarose electrophoresis, wherein the size of the amplification product is about 800 bp, which shows that the target recombinant transformant is the target recombinant transformant, sending the recombinant transformant with correct bacterial liquid PCR verification to Guangzhou Ai Ji biotechnology limited company for sequencing, and finally obtaining the escherichia coli expression vector pET28a-pl7aam according to the sequencing result.

TABLE 4 bacterial liquid PCR reaction system

EXAMPLE 3 site-directed saturation mutagenesis

Based on the analysis results of example 1, six amino acid positions S58, N60, T81, Q134, S139 and Q246 were selected for saturation mutagenesis. The experimental content is mainly as follows: (1) designing a site-directed saturation mutation primer; (2) constructing a mutant library; (3) screening a library of mutants; (4) determining the effective mutant by sequencing.

And respectively designing primers to construct saturated mutant expression vectors corresponding to each site, wherein the specific sequences of the primers are shown in the following table 5.

TABLE 5 site-directed saturation mutant primers

The mutant library construction procedure is as follows (S58 locus is taken as an example, and others are taken as such): (1) PCR amplification was performed by using the vector pET28a-pl7aam as a template and the upstream and downstream primers S58-fw and S58-rev, the PCR amplification system is shown in Table 1, and the PCR amplification conditions are: pre-denaturation at 98 ℃ for 5min; denaturation at 98℃for 10s, annealing at 54℃for 30s, elongation at 72℃for 30s,33 cycles; (2) Detecting the PCR amplification result by agarose electrophoresis, purifying and recovering the amplified correct PCR product, and referring to the example 2 for a specific experimental process; (3) Adding 1 μL of restriction enzyme DpnI (Code No. 1235S, bao Ri doctor Material technology (Beijing) Co., ltd.) into the purified PCR product, and reacting at 37deg.C for 3h; (4) The PCR product after the DpnI enzymolysis was transferred into E.coli competent cell BL21 (DE 3), and the transformation procedure was the same as in example 2.

The mutant library screening procedure was as follows: (1) The obtained transformant was inoculated into a 24-well plate containing 2ml LBK liquid medium per well, cultured at 37℃for 4 hours, and then added with IPTG (final concentration: 1 mM); (2) Converting the fermentation condition of the 24-pore plate after adding IPTG into 16 ℃,200rpm, after induced culture for 4 hours under the condition, freezing and centrifuging at 6 ℃ and 8000rpm for 10 minutes, and collecting thalli; (3) Ultrasonically crushing the collected thalli, and centrifugally collecting supernatant; (4) Measuring the activity of the algin lyase in the supernatant and analyzing; (5) Bacteria with higher enzyme activity than the control group are sent to the Guangzhou Ai Ji biological limited company for sequencing and separation, so that effective mutants are obtained.

And finally, the enzyme activity of the recombinant engineering bacteria corresponding to the mutants S58R, Q F and Q246W is found to be larger than that of a control group through analysis and measurement. In order to be able to analyze these 3 mutants precisely, first, isolation and purification were performed separately. The separation and purification process is as follows: (1) Collecting recombinant engineering bacteria corresponding to mutants S58R, Q F and Q246W, performing ultrasonic crushing, and centrifuging to collect supernatant; (2) Ultrafiltering and concentrating the supernatant enzyme solution by using a 10 kDa ultrafilter tube; (3) purification was performed using a Ni-IDA protein purification kit.

The specific enzyme activities and kinetic parameters of the purified mutants S58R, Q F and Q246W were measured respectively, and the whole experimental process was compared with the template Pl7AaM, and the experimental results are shown in Table 6. The specific activities of the mutants S58R, Q F and Q246W were 461.3U/mg, 478.2U/mg and 485.9U/mg, respectively, which were 1.07-fold, 1.11-fold and 1.13-fold, respectively, of the starting template Pl7 AaM. In addition, as shown in the table, the Mie constants K _m of the mutants S58R, Q F and Q246W are lower than the original template Pl7AaM, which indicates that the mutants S58R, Q F and Q246W have better substrate affinity, thereby being more beneficial to the enzyme catalytic reaction. The maximum reaction speed of the mutants S58R, Q F and Q246W is higher than that of the starting template Pl7AaM, which is consistent with the specific activity of the enzyme, and shows that the mutants S58R, Q F and Q246W have higher hydrolysis efficiency.

TABLE 6Pl7AaM and kinetic parameters of the different mutant enzymes

Example 4 combinatorial mutations

The combined mutation was performed with the effective mutations S58R, Q F and Q246W obtained in example 3, to further increase the enzyme specific activity of the starting template Pl7AaM. Since mutant Q246W works best, the combined mutants Q246W-S58R, Q W-Q134F and Q246W-S58R-Q134F were constructed, respectively, using it as a template.

The construction process of the expression vector corresponding to the different combination mutants is identical to that of the saturated mutant in the embodiment 3, except that the amplification primers are respectively replaced by S58R-fw（GATGGTTAT AAAACGCGCACCAACACGAGTT）、S58R-rev（AACTCGTGTTGGTGCGCG TT TTATAACCATC）、Q134F-fw（CGCGTCATTATTGGTTTT ATTCATGCTTCTAGC）、Q134F-rev（GCTAGAAGCATGAATAAAACCAATAATGACGCG）、Q246W-fw（CC GGTGTGTCCAAGTGGAACAAAACTGGTGATG） and Q246W-rev (CATCACC AGTTTTGTTCCACTTGGA CACACCGG).

Through experiments, expression vectors pET28a-pl7aam-246-58 (corresponding to mutants Q246W-S58R), pET28a-pl7aam-246-134 (corresponding to mutants Q246W-Q134F) and pET28a-pl7aam-246-58-134 (corresponding to mutants Q246W-S58R-Q134F) corresponding to the combined mutants Q246W-S58R, Q W-Q134F, respectively, were finally obtained.

Construction, screening and purification of recombinant engineering bacteria corresponding to the combined mutants Q246W-S58R, Q W-Q134F and Q246W-S58R-Q134F were carried out according to example 3. The purified combined mutants Q246W-S58R, Q W-Q134F and Q246W-S58R-Q134F were finally obtained by experiment. The enzyme specific activities and kinetic parameters of the combined mutants Q246W-S58R, Q W-Q134F and Q246W-S58R-Q134F were measured respectively, and the whole experimental process was conducted by using the starting template Pl7AaM as a control, and the experimental results are shown in Table 7. As can be seen from Table 7, the combined mutation has a synergistic effect, and can further improve the specific activity of the enzymes, and the specific activities of the combined mutants Q246W-S58R, Q W-Q134F and Q246W-S58R-Q134F are 586.9U/mg, 612.3U/mg and 658.9U/mg, respectively, which are 1.36 times, 1.42 times and 1.53 times that of the starting template Pl7AaM, respectively. In addition, the affinity of the combined mutants Q246W-S58R, Q W-Q134F and Q246W-S58R-Q134F to the substrate is also improved, and the corresponding Mirabilitum constants are lower than that of the starting template Pl7AaM. The maximum reaction speed of the combined mutant is higher than that of the original template Pl7AaM. Since the combined mutant Q246W-S58R-Q134F was most effective, the next study was conducted using it as a template. For ease of writing, the combined mutant Q246W-S58R-Q134F was designated Pl7M, and its corresponding expression vector was designated pET28a-Pl7M.

TABLE 7Pl7AaM and different combinations of mutant enzyme kinetic parameters

EXAMPLE 7 recombinant mutant Pl7M temperature Properties

The enzyme activity of the mutant Pl7M at different temperatures of 30-55 ℃ is measured under the condition of pH7.0, the enzyme activity at the highest temperature of the measured enzyme activity is taken as 100%, the relative enzyme activities at other temperatures are calculated, and the template Pl7AaM is taken as a control in the whole experimental process.

As can be seen from a in fig. 2: the optimal reaction temperature of the mutant Pl7M and the starting template Pl7AaM is 45 ℃;

Compared with the template Pl7AaM, the mutant Pl7M has better activity in the range of 30-40 ℃ and has higher relative enzyme activity than the template Pl7AaM.

The residual enzyme activities of the mutant Pl7M and the starting template Pl7AaM were measured after water bath treatment at different temperatures (30℃to 50 ℃) for 30min at pH7.0, respectively, with the samples without heat treatment as controls.

As can be seen from B in fig. 2: in the range of 30-40 ℃, the mutant Pl7M and the starting template Pl7AaM have good heat stability, and after water bath treatment for 30min, the residual enzyme activities are more than 90%; when the heat treatment temperature is increased to 45 ℃, the residual enzyme activities of the mutant Pl7M and the starting template Pl7AaM are drastically reduced to 40.1 percent and 42.5 percent respectively; when the treatment temperature was continued to rise to 50 ℃, the residual enzyme activities of mutant Pl7M and starting template Pl7AaM were 10.6% and 13.2%, respectively.

Example 8 pH Properties of recombinant mutant Pl7M

The enzyme activities of the mutant Pl7M and the starting template Pl7AaM at pH4.0-9.0 were measured at 45℃to determine the highest pH of the enzyme activity as 100%, and the relative enzyme activities at the other pH were calculated.

As can be seen from A in FIG. 3, the optimal reaction pH of the mutant Pl7M is 7.0, and the optimal reaction pH of the starting template Pl7AaM is 8.0; in addition, the mutant Pl7M has better activity in the pH range of 4.0 to 7.0.

The mutant Pl7M and the starting template Pl7AaM were each left at pH4.0 to 9.0 for 4 hours at 25℃for the remaining enzyme activity measurement, and the untreated sample was used as a control.

As can be seen from B in FIG. 3, in the pH range of 5.0 to 8.0, both the mutant Pl7M and the starting template Pl7AaM have good stability, and the residual enzyme activities are more than 80%.

EXAMPLE 9 recombinant mutant Pl7M substrate specificity

Sodium alginate (abbreviated as MG), sodium polymannuronate (abbreviated as M) and sodium polyguluronate (abbreviated as G) are taken as substrates, enzyme activities of a mutant Pl7M and a starting template Pl7AaM at the pH value of 7.0 and the temperature of 45 ℃ are respectively measured, the substrate with the highest enzyme activity is set as 100%, and relative activities of other substrates are calculated.

As can be seen from FIG. 4, the optimal substrates for both mutant Pl7M and starting template Pl7AaM were sodium polymannuronate (abbreviated as M), followed by sodium alginate (abbreviated as MG) and sodium polyguluronic acid (abbreviated as G), respectively. Furthermore, as shown in fig. 4, the hydrolysis activities of the mutant Pl7M on sodium alginate (abbreviated MG) and sodium polyguluronate (abbreviated G) were higher than those of the starting template Pl7AaM.

EXAMPLE 10 efficient preparation of recombinant mutant Pl7M

The recombinant mutant Pl7M can be efficiently prepared, so that the production cost can be effectively reduced, and a foundation is laid for large-scale application of the recombinant mutant Pl 7M. Heretofore, the heterologous expression host for algin lyase is mainly Escherichia coli. Bacillus subtilis has many advantages over e.coli such as: food-grade expression hosts, extracellular secretory expression, easy high-density fermentation, and the like. The patent realizes the efficient preparation of recombinant mutant Pl7M by using a food-grade expression host bacillus subtilis WB800N, and lays a foundation for the application of the recombinant mutant Pl7M in different industrial fields.

The present research team had previously obtained vector pHY-P _cry-SP_bs2 -aprbpm, which contains the high-efficiency promoter Pcry and signal peptide SPbs2 (patent application number: CN 202210419863.7), by promoter optimization and signal peptide optimization. In the patent, an expression vector pHY-P _cry-SP_bs2 -aprbpm is taken as a template, and a coding gene Pl7M of the mutant Pl7M is replaced by a gene aprbpm carried by the vector by gene replacement, so that the expression vector pHY-P _cry-SP_bs2 -Pl7M is obtained.

The construction flow of the expression vector pHY-P _cry-SP_bs2 -Pl7M is shown in FIG. 5, and the experimental procedure is approximately as follows: (1) PCR amplification was performed using the expression vector pET28a-Pl7M obtained in example 4 as a template, with primers Pl7M-fw (5'-GCAACATGTCTGCGCAGGCTTTAGATTTTTATCGCTG-3') and Pl7M-rev (5'-ACAGC GTTATTATTATTGTTAGTCGTGAGTAGCAT-3'), and the PCR amplification conditions and amplification system were carried out as described in example 2, whereby the gene Pl7M was obtained by amplification; (2) PCR amplification was performed using the vector pHY-P _cry-SP_bs2 -aprbpm as a template and primers pHY-fw (5'-CAATAATAATAACG CTGTG TG-3') and pHY-rev (5'-AGCCTGCGCAGACATGTTGCT-3'), and the PCR amplification conditions and amplification system were carried out as described in example 2, whereby a frame pHY-P _cry-SP_bs2 (with the gene aprbpm removed) was obtained by amplification; (3) The frame pHY-P _cry-SP_bs2 and the gene Pl7M were fused and connected by fusion PCR, the fusion system is shown in Table 8, and the reaction conditions of the fusion PCR are as follows: pre-denaturing at 98 ℃ for 20s; denaturation at 98℃for 10s, annealing at 60℃for 20s, elongation at 72℃for 30s,18 cycles; (4) The fusion product was transferred into E.coli competent cell Top10, and both transformation and screening procedures were identical to example 2 except that the medium was changed to LBA medium; (5) The plasmid of the positive transformant is obtained through extraction and screening by a plasmid extraction kit (# DP 103-03), the target plasmid is sent to the biological limited company of Guangzhou Ai Ji for sequencing, and finally the expression vector pHY-P _cry-SP_bs2 -Pl7M is obtained according to the sequencing result.

TABLE 8 Gene amplification reaction System

Transferring the constructed expression vector pHY-P _cry-SP_bs2 -pl7m into bacillus subtilis WB800N, and performing the following experimental process: (1) A single colony (diameter 2-3 mm) was picked from LB plate incubated at 37℃for 20h, transferred to a 50mL centrifuge tube containing 5mL LB liquid medium, and vigorously shaken overnight at 37 ℃; (2) The strain shaken overnight was inoculated in 50mL of GM medium (LB+0.5M sorbitol) at an inoculum size of 1%, the OD in the shake flask was measured, and the inoculum size was controlled so that the OD of the medium after inoculation was between 0.19 and 0.2. Culturing at 37deg.C and 200rpm until OD600 = 0.8-1.0 (about 3-4 hr); (3) Taking all bacterial liquid for ice water bath for 10min, then centrifuging at 4 ℃ and 5000rpm for 8min, and collecting bacterial cells; (4) The cells were washed with 30mL of pre-chilled electrotransfer buffer ETM (0.5M sorbitol, 0.5M mannitol and 10% glycerol), centrifuged at 5000rpm at 4℃for 8min, and the supernatant was removed and rinsed 3 times in this manner; (5) The washed bacteria were resuspended in 500. Mu.L of ETM and each tube was sub-filled with 100. Mu.L; (6) 1-6. Mu.L of expression vector pHY-P _cry-SP_bs2 -Pl7M was added to 100. Mu.L of competent cells, incubated in an ice bath for 5min, and the mixture was added to a pre-chilled electrocuvette (1 mm) and shocked once. And (3) setting an electric converter: 1.5kv, 25. Mu.F, 200Ω,1mm, 1 shock. (duration between 4.5ms-5 ms); (7) Immediately after completion of the electric shock, 0.5mL of recovery medium RM (LB+0.5M sorbitol+0.38M mannitol) was added, and after 3 hours of recovery, the transformants were plated on LBT solid plates and cultured overnight at 37 ℃.

And (3) taking the bacillus subtilis recombinant transformant grown by overnight culture of the LBT solid flat plate as an experimental object, and carrying out screening experiments. The target recombinant transformants of bacillus subtilis were picked up one by one with toothpicks into 24-well plates containing 1.6mL of maltose medium per well, cultured at 37 ℃ and 200rpm for 24 hours, and the supernatants were centrifuged for enzyme activity measurement. 3 dominant bacteria of enzyme activity are obtained through a screening experiment and are respectively named as P12, P35 and P65.

Recombinant engineering bacteria P12, P35 and P65 were further verified by shake flask culture. Shake flask culture is carried out in a 250mL triangular flask, firstly, the corresponding recombinant engineering bacteria are inoculated into a 50mL centrifuge tube containing 5mL of maltose culture medium, the culture is carried out for about 24 hours at 30 ℃ and 220rpm, and the cultured recombinant bacillus subtilis engineering bacteria are inoculated into a 250mL triangular flask containing 50mL of maltose culture medium according to the inoculation amount of 1% (v/v). Shake flask culture conditions were 30℃and 200rpm, and samples were taken after 48 hours of culture for activity measurement. Recombinant engineering bacteria P12, P35 and P65, and the enzyme activities after 48 hours of shake flask culture are 52.3U/mL, 61.6U/mL and 58.7U/mL respectively.

Because the activity of the recombinant engineering bacteria P35 is highest under the shake flask culture condition, the recombinant engineering bacteria P35 is used as a target strain for high-density fermentation culture. The high-density fermentation of the recombinant engineering bacteria P35 is carried out in a 7L fermentation tank, and the specific process is approximately as follows: the single colony was inoculated into a 250mL Erlenmeyer flask containing 50mL of maltose medium, and cultured overnight at 30℃with shaking at 200 rpm. Then, the recombinant engineering bacteria P35 cultured overnight was inoculated into 500mL Erlenmeyer flask containing 100mL of maltose medium at an inoculum size of 1% (v/v), and cultured overnight at 30℃with shaking at 200 rpm. The recombinant engineering bacteria P35 cultured overnight for the second time was inoculated into a 7L fermenter containing 3L of maltose medium at an inoculum size of 10% (v/v). And timely feeding maltose culture medium according to dissolved oxygen (not less than 10%) in the culture process.

The fermentation curve of the recombinant engineering bacteria P35 is shown as A in FIG. 6, and after 60 hours of culture, the fermentation enzyme activity reaches to be 725.6U/mL at the highest.

In order to further promote the high-density fermentation enzyme activity of the recombinant engineering bacteria P35, the culture conditions of the recombinant engineering bacteria P35 in a 7L fermentation tank are optimized, the fermentation temperature is optimized firstly, the fermentation temperature is respectively set to 30 ℃, 33 ℃, 36 ℃ and 39 ℃, the pH is controlled to 6.0, and the stirring speed is 500rpm. As is clear from FIG. 6B, the fermentation enzyme activity is preferably 978.7U/mL at a fermentation temperature of 36 ℃.

The culture pH was optimized based on the optimum culture temperature, the fermentation temperature during the culture was 36℃and the stirring speed was 400rpm, and the pH was set to 5,6,7 and 8, respectively. As is clear from FIG. 6C, the fermentation pH was found to be 7.0, and the fermentation activity was found to be 1175.9U/mL.

The culture medium reducing sugar concentration is optimized on the basis of the optimal culture temperature and pH, the fermentation temperature is 36 ℃ in the culture process, the fermentation pH is 7.0, and the stirring speed is 400rpm. The reducing sugar content was controlled at 0.5%,1%,1.5%, and 2%, respectively. As is clear from FIG. 6D, the effect was best when the reducing sugar content was 1.5%, and the fermentation enzyme activity was 1421.3U/mL.

Finally, it should be noted that the above-mentioned embodiments are merely illustrative of the principles, performances and effects of the present invention, and are not meant to limit the invention. Modifications and variations may be made to the above-described embodiments by those skilled in the art without departing from the spirit and scope of the invention. Accordingly, it is intended that all equivalent modifications and variations of the invention be covered by the claims, which are within the ordinary skill of the art, be within the spirit and scope of the present disclosure.

Claims (7)

1. The algin lyase mutant Pl7M is characterized in that the amino acid sequence of the algin lyase mutant Pl7M is shown as SEQ ID NO. 1.

2. The algin lyase mutant Pl7M according to claim 1, wherein the sequence encoding the amino acid is a polynucleotide sequence as shown in SEQ ID No. 2.

3. A recombinant expression vector comprising the polynucleotide sequence of alginate lyase mutant Pl7M of claim 2.

4. A recombinant engineering bacterium comprising the recombinant expression vector of claim 3.

5. The recombinant engineering bacterium according to claim 4, wherein the bacillus subtilis engineering strain is used as a host.

6. The recombinant engineering bacterium of claim 5, wherein the bacillus subtilis comprises bacillus subtilis WB800N.

7. Use of a recombinant engineering bacterium according to any one of claims 4-6 for the preparation of a mutant Pl7M with high enzymatic specific activity.