CN117959448A

CN117959448A - New use of annular RNA CIRCTRIM2 expression promoter in diagnosis and treatment of liver cancer

Info

Publication number: CN117959448A
Application number: CN202410384117.8A
Authority: CN
Inventors: 李宏宇; 任文文; 苏冰; 谭帅帅; 王宇琛; 顾雨春; 吴理达
Original assignee: Chengnuo Regenerative Medical Technology Beijing Co ltd
Current assignee: Chengnuo Regenerative Medical Technology Beijing Co ltd
Priority date: 2024-04-01
Filing date: 2024-04-01
Publication date: 2024-05-03

Abstract

The invention discloses an application of a circular RNA CIRCTRIM < 2> expression promoter in preparing a medicament for treating and/or preventing liver cancer, wherein circBase ID of the circular RNA CIRCTRIM < 2> is hsa_circ_0005272. The invention discovers that the annular RNA CIRCTRIM is a novel liver cancer diagnosis and treatment target for the first time, and the annular RNA CIRCTRIM can exert the in-vivo treatment effect of effectively killing liver cancer cells, and can be used for preparing tumor immunotherapy medicaments. The invention provides a new target for diagnosis and treatment of liver cancer and has wide application prospect in clinical treatment of liver cancer.

Description

New use of annular RNA CIRCTRIM2 expression promoter in diagnosis and treatment of liver cancer

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a novel application of a circular RNA CIRCTRIM < 2 > expression promoter in diagnosis and treatment of liver cancer.

Background

Liver cancer, a malignant tumor that occurs in the liver, is mainly characterized by four aspects: the first is that early symptoms are hidden, liver cancer often has no obvious symptoms in the early stage, so that a plurality of patients enter middle and late stages when finding, and the best treatment opportunity is missed; secondly, the disease progress is rapid, the liver cancer grows faster, and surrounding tissues and organs are easy to invade, so that serious complications such as liver failure, ascites, jaundice and the like are caused; third, the treatment means is limited, although there are various methods for treating liver cancer at present, such as surgery, intervention, radiofrequency ablation, chemotherapy, etc., the curative effect varies from person to person, and some patients do not respond well to the existing treatment means; fourth, the recurrence rate is high, even though it is treated, the recurrence rate of liver cancer is still high, and the quality of life and prognosis of the patient are seriously affected. Therefore, developing effective diagnosis and treatment strategies has important significance for the attack of liver cancer diseases.

Circular RNA (circRNA) is a unique non-coding RNA molecule that exists stably in cells in its closed loop structure. Recent studies have revealed that circRNA plays a key role in the development and progression of various cancers such as liver cancer. They are involved in several key links of liver cancer, including tumor formation, progression and therapeutic effects. With the deep research of the circRNA, the method is expected to bring innovative strategies and means for early detection, treatment selection and prognosis judgment of liver cancer in the future.

So far, no related study or report on the application of the annular RNA CIRCTRIM2 in diagnosing and/or treating liver cancer is seen.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention aims to provide a novel application of the annular RNA CIRCTRIM in liver cancer diagnosis and treatment.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

the first aspect of the present invention provides the use of a cyclic RNA CIRCTRIM expression promoter in the manufacture of a medicament for the treatment and/or prophylaxis of liver cancer;

Further, circBase ID of the ring RNA CIRCTRIM is hsa_circle_ 0005272.

Further, the cDNA sequence corresponding to the ring RNA CIRCTRIM is shown as SEQ ID NO. 1;

the RNA sequence corresponding to the ring RNA CIRCTRIM2 is shown as SEQ ID NO. 2;

the ring RNA CIRCTRIM is a ring structure formed by splicing the nucleotide sequence shown in SEQ ID NO. 1 after transcription;

the ring RNA CIRCTRIM is a ring structure formed by connecting the nucleotide sequences shown in SEQ ID NO. 2 end to end.

Further, the medicine comprises a molecular targeting medicine, a biological agent and a pharmaceutical composition for treating and/or preventing liver cancer.

Further, the cyclic RNA CIRCTRIM2 expression promoter includes natural purified substances, modified natural purified substances, semisynthetic substances, chemically synthesized substances, and/or any combinations thereof capable of promoting expression of cyclic RNA CIRCTRIM.

Further, the circular RNA CIRCTRIM2 expression promoter includes circular RNA CIRCTRIM2, a recombinant vector containing circular RNA CIRCTRIM2, a nanoparticle containing circular RNA CIRCTRIM2, a protein microsphere containing circular RNA CIRCTRIM2, a liposome containing circular RNA CIRCTRIM2, a PEG-modified protein containing circular RNA CIRCTRIM2, an extracellular vesicle containing circular RNA CIRCTRIM2, and/or any combination thereof;

Preferably, the vector comprises a DNA plasmid vector, a lentiviral vector, a retroviral vector, a poxviral vector, a herpes simplex viral vector, an adenoviral vector, an adeno-associated viral vector, a liposome that binds a DNA plasmid, a molecular conjugate that binds a DNA plasmid, and/or a multimer that binds a DNA plasmid.

In some embodiments, the cyclic RNA CIRCTRIM2 expression promoter refers to a substance capable of promoting expression of cyclic RNA CIRCTRIM, including, but not limited to: any natural purified substance, modified natural purified substance, semisynthetic substance, chemically synthesized substance, and/or any combinations thereof that can promote expression of cyclic RNA CIRCTRIM2 are within the scope of the invention.

In some embodiments, the vector is not particularly limited as long as a vector capable of delivering the circular RNA CIRCTRIM2 of the present invention to overexpress circTRIM2 is within the scope of the present invention, and in particular embodiments of the present invention, the vector is a pcdna3.1 vector.

In a second aspect, the present invention provides a pharmaceutical composition for the treatment and/or prevention of liver cancer.

Further, the pharmaceutical composition comprises a cyclic RNA CIRCTRIM expression promoter as described in the first aspect of the present invention;

Preferably, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier and/or adjuvant;

Preferably, the pharmaceutical composition may further comprise other drugs for treating and/or preventing liver cancer;

More preferably, the additional drug comprises an antiviral drug, a chemotherapeutic drug, a targeted therapeutic drug, an immunotherapeutic drug, a mesogenic drug, and/or any combination thereof;

most preferably, the antiviral drug comprises entecavir, lamivudine, sofosbu Weida norprevir, tenofovir disoproxil, adefovir dipivoxil, oseltamivir, telbivudine, ritonavir;

most preferably, the chemotherapeutic agent comprises fluorouracil, cyclophosphamide, doxorubicin, cisplatin, carboplatin, mitomycin, daunorubicin, epirubicin, gemcitabine, irinotecan, oxaliplatin, mitoxantrone;

Most preferably, the targeted therapeutic comprises sorafenib, regorafenib, lenvatinib, dorafinib, regorafenib, apatinib, cabotinib;

Most preferably, the immunotherapeutic agent comprises atilizumab, melittin Li Shan, garelizumab, tirelizumab, bevacizumab, na Wu Liyou mab, palbociclizumab;

Most preferably, the Chinese patent medicine comprises pagodatree ear granule, liver complex music, cinobufagin capsule, and pill for invigorating middle warmer and replenishing qi.

In some embodiments, specific illustrative examples of the pharmaceutically acceptable carrier and/or adjuvant include, but are not limited to: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifying agents, such as wetting agents, e.g., sodium lauryl sulfate; a colorant; a flavoring agent; tabletting and stabilizing agent; an antioxidant; a preservative; non-thermal raw water; isotonic saline solution; and phosphate buffer, etc.

In some embodiments, suitable pharmaceutically acceptable carriers and/or excipients are described in detail in Remington's Pharmaceutical Sciences (19 th ed., 1995) which are used as needed to aid stability of the formulation or to aid in enhancing the bioavailability of the active or active substance or to impart an acceptable mouthfeel or odor in the case of oral administration, and formulations which may be used in such pharmaceutical compositions may be in the form of the original compound itself, or optionally in the form of a pharmaceutically acceptable salt thereof. The pharmaceutical composition so formulated may be administered by any suitable means known to those skilled in the art, as desired, and when used, a safe and effective amount of the pharmaceutical composition of the present invention is administered to a human.

In some embodiments, the pharmaceutical compositions of the present invention are suitable for administration in a variety of formulations depending on factors such as the method of formulation, the mode of administration, the age, weight, sex, condition, diet, time of administration, route of administration, rate of excretion and sensitivity of the reaction of the patient, and the like, and the skilled practitioner will typically be able to readily determine the formulation and the dosage of the formulation effective for the desired treatment and/or prophylaxis.

In a third aspect, the present invention provides the use of annular RNA CIRCTRIM as a diagnostic marker in the manufacture of a reagent for diagnosing and/or assessing liver cancer.

Further, the ring RNA CIRCTRIM is a ring RNA CIRCTRIM according to the first aspect of the present invention.

Further, the reagents include primers that specifically amplify loop RNA CIRCTRIM2 and/or probes that specifically recognize loop RNA CIRCTRIM;

preferably, the sequence of the primer of the specific amplification loop RNA CIRCTRIM is shown as SEQ ID NO. 3-SEQ ID NO. 4.

In a fourth aspect, the invention provides a product for diagnosing liver cancer.

Further, the product comprises an agent according to the third aspect of the invention;

Preferably, the product further comprises reagents for detecting the level of expression of circular RNA CIRCTRIM2 by sequencing techniques, nucleic acid hybridization techniques and/or nucleic acid amplification techniques;

preferably, the product comprises a kit, a chip and/or a test strip;

Preferably, the product diagnoses liver cancer by detecting the expression level of the ring RNA CIRCTRIM2 in the sample to be tested.

In some embodiments, the kit is an RT-PCR kit, which may further comprise the elements necessary for reverse transcription polymerase chain reaction. The RT-PCR kit comprises a pair of primers specific for loop RNA CIRCTRIM 2. The primer is a nucleotide having a nucleic acid sequence specific for the circular RNA, which may be about 7 to 50 bp, more particularly about 10-39 bp, in length.

In some embodiments, the RT-PCR kit may further comprise a test tube or suitable vessel, reaction buffers (different pH values and magnesium concentrations), deoxynucleotides (dntps), enzymes (e.g., taq polymerase and reverse transcriptase), deoxyribonuclease inhibitors, ribonuclease inhibitors, DEPC-water, and sterile water.

In some embodiments, the kit is a DNA chip kit, which may further comprise elements necessary for manipulating a DNA chip. The DNA chip kit may comprise a substrate to which a cDNA corresponding to loop RNA CIRCTRIM or an oligonucleotide corresponding to a fragment thereof is bound, and reagents, agents and enzymes for constructing a fluorescent-labeled probe. In addition, the substrate may comprise a control cDNA or an oligonucleotide corresponding to a fragment thereof.

In a fifth aspect, the present invention provides a method for inhibiting proliferation of liver cancer cells, inhibiting migration of liver cancer cells, inhibiting invasion of liver cancer cells and/or inhibiting formation of liver cancer tissue, which is non-therapeutic in vitro, the method comprising the steps of: an effective amount of a cyclic RNA CIRCTRIM expression promoter according to the first aspect of the present invention is added to a system in need thereof.

The invention also provides a method for treating and/or preventing liver cancer, which comprises the following steps: administering to a subject in need thereof an effective amount of a cyclic RNA CIRCTRIM and/or cyclic RNA CIRCTRIM2 expression promoter as described in the first aspect of the invention, and/or a pharmaceutical composition as described in the second aspect of the invention.

In some embodiments, when the circular RNA CIRCTRIM expression promoter described in the first aspect of the invention, and/or the pharmaceutical composition described in the second aspect of the invention, are administered, the substance may be administered systemically, or the substance may be administered directly to a specific site where cancerous or precancerous cells are present. Thus, administration can be accomplished in any manner effective to deliver the agent to the cancerous or precancerous cells.

In some embodiments, the mode of administration includes, but is not limited to: the substance is administered topically, transdermally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, orally, intranasally instilled, intracavity or intravesically instilled, intraocularly, intraarterially, intralesionally or by application to mucous membranes such as the nose, throat and bronchi.

The invention also provides a method for diagnosing and/or assisting in diagnosing liver cancer, which comprises the following steps: detecting the expression level of circular ring RNA CIRCTRIM2 according to the first aspect of the present invention in a sample derived from a subject, wherein the subject is diagnosed as a patient having liver cancer or as a suspected patient having a higher risk of having liver cancer if the expression level of circular ring RNA CIRCTRIM2 is significantly reduced in the sample derived from the subject compared to a normal human.

In some embodiments, the subject refers to any animal, and also refers to human and non-human animals. The non-human animals include all vertebrates, for example, mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any domestic animals or pets; and non-mammals, such as chickens, amphibians, reptiles, etc., in particular embodiments of the invention, the subject is preferably a human.

In some embodiments, the sample refers to a composition obtained or derived from a subject of interest comprising cellular entities and/or other molecular entities to be characterized and/or identified, e.g., based on physical, biochemical, chemical, and/or physiological characteristics. The sample may be obtained from blood and other fluid samples of biological origin and tissue samples of the subject, such as biopsy tissue samples or tissue cultures or cells derived therefrom. The source of the tissue sample may be solid tissue, such as tissue from fresh, frozen and/or preserved organs or tissue samples, biopsy tissue or aspirates; blood or any blood component; body fluid; cells from any time of gestation or development of an individual; or plasma. The sample includes biological samples that have been treated in any way after they have been obtained, such as by treatment with reagents, stabilization, or enrichment for certain components (such as proteins or polynucleotides), or embedding in a semi-solid or solid matrix for sectioning purposes. Samples described in the present invention include, but are not limited to: blood, tissue, blood-derived cells, serum, plasma, lymph, synovial fluid, cell extracts, and combinations thereof, in preferred embodiments, the sample is selected from a tissue sample or a blood sample of the subject.

Compared with the prior art, the invention has the advantages and beneficial effects that:

The invention discovers that the annular RNA CIRCTRIM is a novel liver cancer diagnosis and treatment target for the first time, and results of in vitro cell experiments and in vivo function experiments show that the expression of the annular RNA CIRCTRIM in liver cancer is obviously reduced, the over-expression circTRIM2 can obviously inhibit the cell activity, the cell proliferation capacity, the cell migration and invasion capacity and the tumor formation capacity of liver cancer cells, and the annular RNA CIRCTRIM2 can play an in vivo treatment effect of effectively killing the liver cancer cells and can be used for preparing tumor immunotherapy medicaments. The invention provides a new target for diagnosis and treatment of liver cancer and has wide application prospect in clinical treatment of liver cancer.

Drawings

FIG. 1 is a feature block diagram of circTRIM;

FIG. 2 is a first generation sequencing view of circTRIM amplification product splice sites;

FIG. 3 is a graph showing the relative expression levels of RNA after digestion of circTRIM and mTRIM with RNase R enzyme pairs;

FIG. 4 is a graph showing comparison of the result of QPCR detection of circTRIM2 expression in liver cancer tissue and paracancestor tissue;

FIG. 5 is a graph showing comparison of the result of QPCR detection of circTRIM2 expression in liver cancer cell HepG2, liver cancer cell HCCLM3 and normal liver cell L02;

FIG. 6 is a graph showing comparison of cell viability of a liver cancer cell overexpressing circTRIM2 and a control cell line, wherein the left side is liver cancer cell HepG2 and the right side is liver cancer cell HCCLM3; the abscissa is the group, the ordinate is the OD450 value (representing relative cell viability), vector is a control cell line transfected with empty vector pCDNA3.1-vector, circTRIM2 is a cell line transfected with pCDNA3.1-circTRIM2 plasmid (overexpressing circTRIM 2);

FIG. 7 shows the results of EDU cell proliferation assay, wherein Panel A is the results plot, panel B is the statistics plot, vector is the control cell line transfected with empty vector pCDNA3.1-vector, circTRIM2 is the cell line transfected with pCDNA3.1-circTRIM2 plasmid (overexpressing circTRIM 2).

FIG. 8 shows the results of a cell scoring experiment, wherein FIG. A is a graph showing the results, FIG. B is a graph showing statistics, vector is a control cell line transfected with empty vector pCDNA3.1-vector, circTRIM2 is a cell line transfected with pCDNA3.1-circTRIM2 plasmid (overexpressing circTRIM 2);

FIG. 9 shows the results of a cloning experiment, wherein FIG. A is a graph showing the results, FIG. B is a graph showing statistics, vector is a control cell line transfected with empty vector pCDNA3.1-vector, circTRIM2 is a cell line transfected with pCDNA3.1-circTRIM2 plasmid (overexpressing circTRIM 2);

FIG. 10 shows the effect of over-expression circTRIM2 on proliferation of hepatoma tumors in NCG mice, wherein, A shows the growth of NCG mice on day 28 after intratumoral injection of circTRIM over-expression nanoparticles, B shows the growth curve of NCG mice on subcutaneous tumor volume, vector is a control cell line transfected with empty vector pCDNA3.1-vector, and circTRIM2 is a cell line transfected with pCDNA3.1-circTRIM plasmid (over-expression circTRIM 2).

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In order to facilitate an understanding of the present invention, the following terms referred to in the present invention are explained herein:

As used herein, the term "primer" refers to 7-50 nucleic acid sequences that are capable of forming base pairs (basepair) complementary to the template strand and serve as starting points for replication of the template strand. Primers are usually synthesized, but naturally occurring nucleic acids may also be used. The sequence of the primer need not be exactly the same as the sequence of the template, but may be sufficiently complementary to hybridize with the template. Additional features may be incorporated that do not alter the basic properties of the primer. Examples of additional features that can be incorporated include methylation, capping, substitution of one or more nucleic acids with homologs, and modification between nucleic acids, but are not limited thereto.

As used herein, the term "probe" refers to a nucleic acid fragment, e.g., RNA or DNA, as short as a few to as long as hundreds of bases, which can establish specific binding with mRNA and can determine the presence of a particular mRNA due to a Labeling effect. Probes can be prepared in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes, RNA probes, and the like. Probes and hybridization conditions can be appropriately selected based on what is known in the art.

As used herein, the term "expression level" and "level" refer to the absolute or relative amount of expression of the loop RNA CIRCTRIM2 of the invention, and the expression level of the loop RNA CIRCTRIM may be determined by a variety of techniques, and in particular, the absolute or relative amount of the loop RNA CIRCTRIM2 of the invention may be detected by using methods well known to those of skill in the art.

As used herein, the term "treatment" generally relates to the treatment of a human or animal (e.g., as applied by a veterinarian) in which certain desired therapeutic effects can be achieved, for example, inhibiting the development of a disorder (including reducing the rate of development of a disorder, halting the development of a disorder), ameliorating a disorder, and curing a disorder. Also included are treatments as a prophylactic measure (e.g., prophylaxis). The use of a patient who has not yet developed, but is at risk of developing, a disorder is also included in the term "treatment".

As used herein, the term "prevention" refers to complete or partial inhibition of the development, recurrence, onset, or spread of a liver cancer disease disorder or condition caused by administration of a cyclic RNA CIRCTRIM and/or cyclic RNA CIRCTRIM expression-promoting agent as described in the first aspect of the invention, and/or a pharmaceutical composition as described in the second aspect of the invention.

As used herein, the term "diagnosis" refers to the discovery, judgment, or cognition of an individual's state of health or condition based on one or more symptoms, data, or other information associated with the individual. The health status of an individual may be diagnosed as healthy/normal (i.e., no disease or condition present) or may be diagnosed as unhealthy/abnormal (i.e., disease or condition present), the terms diagnosis, early diagnosis, making a diagnosis and variations of these terms include early detection of a disease/condition associated with a particular disease or condition (in the present invention, liver cancer); characteristics or classification of disease; discovery of progression, cure, or recurrence of disease; discovery of the treatment or post-treatment response of an individual to a disease in the present invention, the diagnosis and/or auxiliary diagnosis of liver cancer includes distinguishing between an individual not suffering from liver cancer and an individual suffering from liver cancer.

As used herein, the term "pharmaceutical composition" may have any one of the formulations selected from the group consisting of: solutions, granules, suspensions, tablets, pills, powders, capsules, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, lyophilized formulations and suppositories. Furthermore, the pharmaceutical composition may be administered one or more times. In this case, the pharmaceutical composition may be administered in the form of a liquid formulation, powder, aerosol, capsule or suppository. In particular embodiments, the pharmaceutical compositions provided herein can be formulated into various dosage forms according to actual needs, and the dosage beneficial to the patient can be determined by the clinician based on the type, age, weight and general disease condition of the subject, mode of administration, and the like. The mode of administration may be, for example, injection or any other suitable mode of administration known to those skilled in the art.

As used herein, the term "effective amount" refers to an amount that has a therapeutic effect or is required to produce a therapeutic effect in a subject. For example, a pharmaceutically or pharmaceutically effective amount refers to the amount of drug required to produce a desired therapeutic effect, which can be reflected by the results of a clinical trial, a model animal study, and/or an in vitro study. The pharmaceutically effective amount depends on several factors, including but not limited to: the characteristic factors of the subject (such as height, weight, sex, age and history of administration), the severity of the disease, etc.

As used herein, the term "administering" refers to the act of injecting or physically delivering a substance present outside the body (e.g., the cyclic RNA CIRCTRIM, cyclic RNA CIRCTRIM2 expression promoter, and/or pharmaceutical composition described herein) into a subject, e.g., by mucosal, intradermal, intravenous, intramuscular delivery, and/or any other physical delivery method known in the art. When a disease, disorder or condition, or symptom thereof is treated, administration of the substance is typically performed after the onset of the disease, disorder or condition, or symptom thereof. When a disease, disorder or condition, or symptom thereof is prevented, administration of the substance is typically performed prior to the onset of the disease, disorder or condition, or symptom thereof.

The invention is further illustrated below in conjunction with specific examples, which are intended to illustrate the invention and are not to be construed as limiting the invention. One of ordinary skill in the art can appreciate that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents. The experimental procedure, in which no specific conditions are noted in the examples below, is generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer.

The principal materials and reagent information used in the present invention are shown in Table 1 below.

TABLE 1 Main materials and reagents

< B > sequence number >	< B > reagent name >	< B > production Co Ltd	< B > goods number >
				1	EasyScript® First-Strand cDNA Synthesis SuperMix	Beijing full-type gold organism	AE301-02
2	RNase R enzyme	Shanghai Biyun biotechnology Co., ltd	R7092S
				3	SuperReal fluorescent quantitative premix reagent enhanced version (SYBR Green)	Tiangen Biochemical technology (Beijing) Co., ltd	FP205
4	Cell Counting Kit-8 (CCK-8 kit)	Shanghai Biyun biotechnology Co.Ltd	C0038
				5	BeyoClick ™ EdU-555 cell proliferation detection kit	Shanghai Biyun biotechnology Co.Ltd	C0075S
6	Normal hepatocytes L02	Shang En Biotech Co., ltd	SNL-141
				7	Human liver cancer cell line HepG2	North Biotech Co.Ltd	BNCC338070
8	Human high-metastasis liver cancer cell HCCLM3	North Biotech Co.Ltd	BNCC338460

In the invention, the circular RNA CIRCTRIM2 (circBase ID: hsa_circ_ 0005272) is derived from 2 # and 3 # 2 exons in 12 exons of TRIM2 gene on chromosome 4, the cyclized nucleotide sequence has 423 bases, and no circTRIM has been reported at present about liver cancer cell functions.

CircTRIM2 is shown as SEQ ID NO. 1, and the structure of the circular RNA is an end-to-end circular structure formed by splicing after transcription of the nucleotide sequence shown as SEQ ID NO. 1. The RNA sequence corresponding to circTRIM < 2 > is shown as SEQ ID NO. 2, and the circTRIM < 2 > has a circular structure formed by connecting the nucleotide sequences shown as SEQ ID NO. 2 end to end.

CircTRIM2 (SEQ ID NO: 1):

CAGCAGCGTGCAGGGTCAAAGACAGCCGGCCCCCCATGTCAGTGGTCTAGGATGGCCAGTGAAGGCACCAACATCCCAAGTCCTGTGGTGCGCCAGATTGACAAGCAGTTTCTGATTTGCAGTATATGCCTGGAACGGTACAAGAATCCCAAGGTTCTCCCCTGTCTGCACACTTTCTGCGAGAGGTGCCTGCAGAACTACATTCCTGCCCACAGTTTAACCCTCTCCTGCCCAGTGTGCCGCCAGACCTCCATCCTGCCCGAGAAAGGGGTGGCCGCGCTCCAGAACAATTTCTTCATCACAAACCTGATGGACGTGCTGCAGCGAACTCCAGGCAGCAACGCTGAGGAGTCTTCCATCCTGGAGACAGTCACTGCTGTGGCTGCGGGAAAGCCTCTCTCTTGCCCAAACCACGATGGGAAT

circTRIM2 (SEQ ID NO: 2):

CAGCAGCGUGCAGGGUCAAAGACAGCCGGCCCCCCAUGUCAGUGGUCUAGGAUGGCCAGUGAAGGCACCAACAUCCCAAGUCCUGUGGUGCGCCAGAUUGACAAGCAGUUUCUGAUUUGCAGUAUAUGCCUGGAACGGUACAAGAAUCCCAAGGUUCUCCCCUGUCUGCACACUUUCUGCGAGAGGUGCCUGCAGAACUACAUUCCUGCCCACAGUUUAACCCUCUCCUGCCCAGUGUGCCGCCAGACCUCCAUCCUGCCCGAGAAAGGGGUGGCCGCGCUCCAGAACAAUUUCUUCAUCACAAACCUGAUGGACGUGCUGCAGCGAACUCCAGGCAGCAACGCUGAGGAGUCUUCCAUCCUGGAGACAGUCACUGCUGUGGCUGCGGGAAAGCCUCUCUCUUGCCCAAACCACGAUGGGAAU

EXAMPLE 1 construction of circular RNA

In this example, the inventors designed a specific primer pair capable of amplifying circTRIM2 (circBase ID: hsa_circ_ 0005272), and amplified the circular RNA of TRIM2 gene using the primer pair, confirmed the splice site (backsplicing junction site) of the circular RNA by a one-generation sequencing method, and then determined circTRIM2 as a circular RNA molecule expressed as having a closed circular structure by RNase R digestion assay. The specific experimental method is as follows:

1. Cell total RNA extraction and concentration determination

(1) When the cells of the 6-well plate exceed 90%, the old culture solution is discarded, after the cells are washed once by PBS, 1mL Trizol is added to each well, and then the cells are transferred to a 1.5 mL EP tube;

(2) The EP tube was left at room temperature for 10 minutes in order for the nucleic acid protein complex to be sufficiently separated;

(3) 0.2 mL chloroform was added to the EP tube, shaken for about 10s, and then allowed to stand at room temperature for 5min; chloroform is a nonpolar molecule, and can effectively inhibit the activity of RNase, when the cell solution added with Trizol is mixed with chloroform, water molecules of protein are removed by chloroform, so that the protein is denatured due to water loss and state, and the separation of aqueous phase and organic phase is accelerated;

(4) 12000g, centrifuging at 4deg.C for 15min, wherein the EP tube solution is divided into 3 layers, the bottom layer is red organic matter, the upper layer is colorless water phase, and RNA exists in the water phase;

(5) The supernatant (about 450 mL) was transferred to a new EP tube, then the same volume of isopropanol was added and left to stand at room temperature for 10min; isopropanol absorbs water around RNA to precipitate it;

(6) 12000g, centrifuging at 4deg.C for 10min, observing white RNA precipitate at the bottom and side of the tube, and discarding supernatant;

(7) Washing the RNA precipitate with 75% DEPC-ethanol solution, centrifuging at 4deg.C for 5min, and discarding supernatant;

(8) Placing the RNA precipitate in a biosafety cabinet for 5min, and adding 20 microliters of DEPC water to dissolve RNA after airing, wherein the steps are operated on ice;

(9) The total RNA purity and concentration of the cells were measured using ScanDrop100,100 ultra-micro nucleic acid assay.

2. CDNA reverse transcription

Preparation of a reverse transcription reaction system (for example, 20. Mu.L system) was performed on ice, and after completion of the preparation, prepared total RNA of cells was added for reverse transcription, and the reverse transcription reaction system was as shown in Table 2.

TABLE 2 reaction system

The reverse transcription reaction conditions were as follows: the reaction was carried out at 37℃for 15 minutes, followed by 85℃for 5 seconds. Cooling to 4 deg.c, diluting the cDNA to 5 times, and storing in-20 deg.c refrigerator.

3. Primer design

Primers were designed using Primer3.0 on-line tool and verified with NCBI Blast.

The design principle of the primer is as follows: (1) the GC content of the primer is 50-60%; (2) the primer length is 17-25bp; (3) the Tm of the primer is 57-63 ℃; (4) the position of the primer avoids the tertiary structure of the target sequence; (5) avoiding repeating G or C bases a number of times; (6) avoiding the primer terminal base to be A; (7) the primer and the product avoid forming a secondary structure; (8) the product length is between 100 and 150 bp; the product of (9) avoids 4 single base repeats.

By the design principle, the primer 5 pair is designed together, and the primer pair adopted in the embodiment is as follows, wherein the primer pair is synthesized by the company Boxing of the Beijing Rui:

F：5 '-CAGCAACGCTGAGGAGTCTT-3 '（SEQ ID NO:3）

R：5 '-ACTGGCCATCCTAGACCACT-3 '（SEQ ID NO:4）

In one or more embodiments, other primer pairs than those described above may be used for amplification.

4. First generation sequencing

The cDNA obtained by reverse transcription is amplified by using the primer set described above, and then the amplified product is subjected to first-generation sequencing.

5. RNase R digestion experiment

RNase R enzyme is an RNase capable of digesting linear RNA but has little effect on circular RNA.

Mu.g of total RNA from cells was incubated with 3U RNase R enzyme at 37℃for 30 minutes in a volume of 10. Mu.L, then warmed to 75℃and held for 10 minutes to inactivate the RNase R enzyme, and finally analyzed by RT-qPCR for the effect of RNase R addition on circTRIM and mTRIM.

6. Experimental results

The feature structure of circTRIM2 and the first generation sequencing result of the splice site of the circTRIM amplification product are shown in fig. 1 and 2, respectively, circTRIM2 is derived from the exon of TRIM2 gene, and the first generation sequencing result proves that circTRIM2 has reverse cleavage ligation and accurately shows the splice site of the amplification product, indicating that circTRIM2 formation is not due to recombination mismatch of genome.

The comparison of RNase R digestion with circTRIM and mTRIM2 is shown in fig. 3, where linear mTRIM2 is significantly reduced in expression after RNase R enzyme digestion, while circTRIM is resistant to RNase R enzyme digestion, confirming its cyclic structure.

Example 2 detection of expression of circTRIM2 in clinical sample tissues and cell lines

The expression level of circTRIM2 in liver cancer and paracancestral tissues of 12 clinical patients and the expression difference between a liver cancer cell line and a corresponding Normal liver cell line are detected by fluorescence Quantitative PCR (QPCR), and the expression level of circTRIM2 is found to be obviously lower than that of paracancestral tissues (Normal) in liver cancer tissues (Tumor), and the expression level of the circTRIM in the liver cancer cell line is also obviously lower than that of Normal liver cells, so that circTRIM2 can be used for diagnosing liver cancer. The specific experimental method is as follows:

1. total RNA extraction and concentration determination in cells

(1) 1.5ML EP tube was received after 10min of lysis by addition of 1mL Trizol to a 6-well cell culture plate;

(2) The EP tube is left at room temperature for about 10 minutes so that the nucleic acid protein complex can be sufficiently separated;

(3) Adding 0.2 mL chloroform in an EP tube, vibrating for about 10s, and then standing at room temperature for 5min;

(5) The supernatant (about 450 mL) was transferred to a new EP tube, then the same volume of isopropanol was added and left to stand at room temperature for 10min;

(8) Placing the RNA precipitate in a biosafety cabinet for 5min, airing, and adding 20 mu L of DEPC water to dissolve the RNA, wherein the steps are operated on ice;

(9) RNA purity and concentration were measured using ScanDrop100,100 ultra-micro nucleic acid assay.

2. QPCR amplification assay

Tissue RNA reverse transcription was performed using the cDNA reverse transcription method of example 1.

Preparation of PCR reaction system (for example, 20. Mu.L system) was performed on ice, and after completion of the preparation, cDNA template obtained by reverse transcription was added. Wherein, the PCR reaction system is shown in Table 3:

TABLE 3 PCR reaction system

The primer pair used for amplifying loop RNA CIRCTRIM2 was the primer pair shown in example 1 as SEQ ID NO:3-SEQ ID NO: 4:

F：5 '-CAGCAACGCTGAGGAGTCTT-3 '（SEQ ID NO:3）

R：5 '-ACTGGCCATCCTAGACCACT-3 '（SEQ ID NO:4）

The reaction conditions include:

The first step, pre-denaturation, 95 ℃ for 5 minutes;

second, PCR (40 cycles), 95℃for 20 seconds; 60 ℃ for 20 seconds; 72℃for 20 seconds.

Thirdly, analyzing a melting curve, namely, at 65 ℃ for 5 seconds; 95℃for 5 seconds.

Quantitative analysis was performed after PCR amplification. The calculation formula of the relative expression quantity of the target gene is as follows: 2- ΔΔct=2- [ Δct ] Test- (. DELTA.ct) Control ]. Wherein, Δct=ct target-Ct housekeeping, ct target is target gene Ct value, ct housekeeping is housekeeping gene Ct value, Δct represents phase Ct value of each sample target gene relative to housekeeping gene, ΔΔct= (Δct) Test- (Δct) Control, represents normalization of the treatment group relative to the Control group, and 2- Δct represents relative expression amount of the treatment group relative to the Control group, and represents relative expression multiple of the target gene.

3. Experimental results

As shown in FIGS. 4 and 5, the QPCR experiment results show that the expression level of circTRIM2 in liver cancer tissue (Tumor) is obviously lower than that of a beside-cancer tissue (Normal), and the expression level of circTRIM2 in liver cancer cells HepG2 and HCCLM3 is obviously lower than that of Normal liver cells L02, so that circTRIM2 has important significance in the occurrence and development of liver cancer, can be used as an ideal prognosis marker of a liver cell cancer patient, and can play a positive role in diagnosis of liver cancer.

Example 3 Effect of over-expression circTRIM2 on proliferation, invasion and metastasis of liver cancer cells

CircTRIM2 and a random sequence vector are constructed on a special pCDNA3.1 vector for over-expressing circular RNA, pCDNA3.1-circTRIM2 and pCDNA3.1-vector are transfected on HepG2 cells as a treatment group and a control group, the influence of the over-expression of circTRIM on the activity of liver cancer cells is detected through CCK8 cell activity, the influence of the over-expression of circTRIM on the proliferation capacity of the liver cancer cells is detected through EDU cell proliferation experiments, the influence of the over-expression of circTRIM2 on the migration and invasion capacity of the liver cancer cells is examined through cell scratch experiments, and the influence of the over-expression of circTRIM on the tumorigenicity capacity of the liver cancer cells is examined through clone formation experiments.

1. CCK-8 cell Activity assay

The dehydrogenase in the mitochondria of living cells can react with the WST-8 compound, and finally the dehydrogenase is reduced into hydrophilic formazan dye, the dye is yellow after being dissolved, the number of generated yellow formazan is positively correlated with the number of living cells, namely, the more the number of living cells is, the higher the degree of yellow of the solution is, so that the characteristic is utilized for detecting the proliferation of cells.

(1) 10000 HepG2 cells are inoculated in each well of a 96-well plate, and pCDNA3.1-circTRIM2 and pCDNA3.1-vector are respectively transfected as a treatment group and a control group after 12h of cell attachment is cultivated;

(2) Add 10. Mu.L of CCK-8 reagent to the corresponding wells at 48 h;

(3) Placing the mixture in a constant temperature incubator with the temperature of 37 ℃ and the concentration of 5% CO ₂ for culturing for about 2 hours;

(4) Finally, the absorbance was measured at 450nm using an microplate reader.

2. EDU cell proliferation assay

A cell proliferation assay kit (BeyoClick ™ EdU Cell Proliferation Kit with Alexa Fluor, 555) (available from Shanghai Biyun biotechnology Co., ltd.) is a kit for simply, rapidly and highly sensitively detecting cell proliferation based on the incorporation of thymidine (thymidine) analogue EdU (5-ethynyl-2' -deoxyuridine) during DNA synthesis, and the subsequent Click reaction (Click reaction) to label the EdU with Alexa Fluor 555.

(1) Inoculating 30 ten thousand cancer cells into a 6-hole plate, and respectively transfecting pCDNA3.1-circTRIM2 and pCDNA3.1-vector after 12h of cell adherence is cultured to serve as a treatment group and a control group;

(2) After 48h of culture, the culture medium is discarded, PBS is added for three times of washing, and 1 mL of 4% paraformaldehyde is added for fixation at room temperature for 10min;

(3) Discarding 4% paraformaldehyde, adding PBS, washing for three times, adding 1 mL of 0.1% triton X-100, and incubating at room temperature for 10min;

(4) The solution of triton X-100 at 0.1% was discarded, washed three times with PBS, and then detected using the BeyoClick ™ EdU-555 cell proliferation assay kit described above.

3. Cell scratch assay

(1) Scribing on a 24-hole cell culture plate, firstly scribing 3-5 lines on the back of the 24-hole plate by using a Mark pen, then inoculating 6 ten thousand HepG2 cells, and respectively transfecting pCDNA3.1-circTRIM2 and pCDNA3.1-vector as a treatment group and a control group after 12h of cell adhesion is cultivated;

(2) After six hours of transfection, a vertical trace is marked in the middle of the culture hole by using a yellow gun head of 200 mu L, then the culture hole is washed once by using PBS, and a fresh culture medium is added for photographing under a lens and recording as 0 hour;

(3) After 48h, washing with PBS for one time, taking a picture, and recording as 48h;

(4) Scratch healing rate was calculated using image J-processed pictures.

4. Cloning formation experiments

(1) Each experimental group in the 6-hole plate culture plate is inoculated with 1000 cells/hole, and pCDNA3.1-circTRIM and pCDNA3.1-vector are respectively transfected as a treatment group and a control group after 12 hours of cell attachment is cultivated;

(2) Culturing continuously until the number of cells in 14 days or most single clones is greater than 50, changing liquid every 3 days in the middle, and observing the cell state;

(3) After cloning is completed, photographing the cells under a microscope, washing the cells for 1 time by using PBS, adding 1mL of 4% paraformaldehyde into each hole for fixation for 30-60 min, and washing the cells for 1 time by using PBS;

(4) Adding crystal violet dye solution 1mL into each hole to dye cells 10-20 min;

(5) Washing the cells with PBS for several times, airing, and taking pictures with a digital camera (taking pictures of the whole six-well plate and each well separately);

(6) The number of clonally formed cells was calculated using image J-processed pictures.

5. Experimental results

The experimental result of CCK-8 cell activity detection is shown in FIG. 6, and after circTRIM is over-expressed, the cell activity of the liver cancer cell is obviously inhibited, and the activity of the liver cancer cell is obviously weakened.

As shown in FIG. 7, the experimental results of EDU cell proliferation assay show that after circTRIM is over-expressed, the cell proliferation capacity of liver cancer cells is obviously inhibited, and the division capacity of liver cancer cells is obviously weakened.

The experimental results of the cell scratch experiments are shown in fig. 8A and 8B, and compared with the liver cancer cell line of the control group of empty vector, the liver cancer cell line of over-expression circTRIM2 has obviously inhibited migration and invasion capacities.

The experimental results of the clone formation experiments are shown in fig. 9A and 9B, and compared with the control cell strain of the empty vector, the cell strain of the over-expressed circTRIM is obviously inhibited in the tumor formation capacity of liver cancer cells.

The experiments show that circTRIM gene and its expression product can be used in treating liver cancer.

Example 4 Effect of over-expression circTRIM2 on proliferation of hepatoma cells in NCG mice

1. Experimental method

This example was performed using 6 week male NCG mice, all purchased from Peking Vitre Liwa laboratory animal Co.

HepG2 cells grown in log phase were digested with pancreatin, centrifuged at 300g for 5min for cell count, resuspended in serum-free DMEM medium at a density of 10 ⁷/100. Mu.L, injected subcutaneously in the left armpit of NCG mice at a volume of 100. Mu.L/min, tumor size detected after 7 days, and after tumor volume exceeded 100mm ³, the subsequent experiments were performed.

Tumor-forming NCG mice meeting the standard are selected as an evaluation model, pCDNA3.1-vector and pCDNA3.1-circTRIM2 over-expression nano particles are injected into the tumor of the NCG mice subcutaneously, tumor volumes are measured once a week (V=1/2×a×b ², a is a long axis and b is a short axis), the longest and shortest positions of the tumor are measured by a vernier caliper, and a tumor volume increase curve is drawn.

2. Experimental results

The experimental results are shown in fig. 10A and 10B, and the volume of circTRIM2 group tumor into which over-expression circTRIM2 was introduced is significantly reduced (see fig. 10A). NCG mice were sacrificed on day 28, tumors were removed, photographed, and the subcutaneous tumor volume increase curves were plotted for nude mice, showing that the tumor volume of the circTRIM2 overexpressed pCDNA3.1-circTRIM group was significantly smaller than that of the control group pCDNA3.1-Vector (see FIG. 10B).

The experiment shows that over-expression circTRIM of the polypeptide can obviously inhibit the subcutaneous tumorigenicity of liver cancer cells in NCG mice, namely circTRIM and an expression product thereof can be effectively applied to the treatment of liver cancer.

Claims

1. Use of a cyclic RNA CIRCTRIM expression promoter in the manufacture of a medicament for the treatment and/or prophylaxis of liver cancer.

2. The use according to claim 1, wherein circBase ID of the ring RNA CIRCTRIM is hsa_circle_ 0005272.

3. The use according to claim 2, wherein the cDNA sequence corresponding to the loop RNA CIRCTRIM is shown in SEQ ID NO. 1;

4. The use of claim 1, wherein the cyclic RNA CIRCTRIM2 expression promoter comprises a natural purified substance, a modified natural purified substance, a semisynthetic substance, a chemically synthesized substance, and/or any combinations thereof capable of promoting expression of cyclic RNA CIRCTRIM.

5. The use of claim 1, wherein the circular RNA CIRCTRIM2 expression promoter comprises circular RNA CIRCTRIM2, a recombinant vector comprising circular RNA CIRCTRIM2, a nanoparticle comprising circular RNA CIRCTRIM2, a protein microsphere comprising circular RNA CIRCTRIM2, a liposome comprising circular RNA CIRCTRIM2, a PEG-modified protein comprising circular RNA CIRCTRIM2, an extracellular vesicle comprising circular RNA CIRCTRIM2, and/or any combination thereof.

6. A pharmaceutical composition for the treatment and/or prevention of liver cancer, characterized in that the pharmaceutical composition comprises a cyclic RNA CIRCTRIM expression promoter as described in any one of claims 1 to 5.

7. Use of cyclic ring RNA CIRCTRIM2 as a diagnostic marker in the manufacture of a reagent for diagnosing and/or assessing liver cancer, wherein the cyclic ring RNA CIRCTRIM2 is cyclic ring RNA CIRCTRIM2 as claimed in any one of claims 1 to 5.

8. The use according to claim 7, wherein the reagent comprises a primer that specifically amplifies loop RNA CIRCTRIM2 and/or a probe that specifically recognizes loop RNA CIRCTRIM 2;

The sequence of the primer of the specific amplification ring RNA CIRCTRIM is shown as SEQ ID NO. 3-SEQ ID NO. 4.

9. A product for diagnosing liver cancer, characterized in that the product comprises the agent as claimed in claim 7 or 8;

The product comprises a kit, a chip and/or a test strip;

the product diagnoses liver cancer by detecting the expression level of the annular RNA CIRCTRIM2 in a sample to be tested.

10. A method for inhibiting proliferation of liver cancer cells, inhibiting migration of liver cancer cells, inhibiting invasion of liver cancer cells and/or inhibiting formation of liver cancer tissue in vitro for non-therapeutic purposes, the method comprising the steps of: adding an effective amount of a cyclic RNA CIRCTRIM expression promoter as described in any one of claims 1-5 to a system in need thereof.