CN117942403A

CN117942403A - New use of cyclic RNA CIRCFNDC B expression promoter in colorectal cancer diagnosis and treatment

Info

Publication number: CN117942403A
Application number: CN202410356053.0A
Authority: CN
Inventors: 李宏宇; 苏冰; 任文文; 王宇琛; 谭帅帅; 顾雨春; 吴理达
Original assignee: Chengnuo Regenerative Medical Technology Beijing Co ltd
Current assignee: Chengnuo Regenerative Medical Technology Beijing Co ltd
Priority date: 2024-03-27
Filing date: 2024-03-27
Publication date: 2024-04-30

Abstract

The invention discloses application of a cyclic RNA CIRCFNDC B expression promoter in preparation of a medicament for treating and/or preventing colorectal cancer, wherein CircBase ID of the cyclic RNA CIRCFNDC B is hsa_circ_0001362. The invention discovers that the annular RNA CIRCFNDC B is a brand-new colorectal cancer diagnosis and treatment target for the first time, and the annular RNA CIRCFNDC B can exert the in-vivo treatment effect of effectively killing colorectal cancer cells and can be used for preparing tumor immunotherapy medicaments. The invention provides a new target for diagnosis and treatment of colorectal cancer, and has wide application prospect in clinical treatment of colorectal cancer.

Description

New use of cyclic RNA CIRCFNDC B expression promoter in colorectal cancer diagnosis and treatment

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a novel application of a circular RNA CIRCFNDC B expression promoter in colorectal cancer diagnosis and treatment.

Background

Colorectal cancer is a common malignant tumor, has four harm to the health and life safety of patients, firstly, early stage concealment is realized, colorectal cancer has no obvious symptoms at early stage, so that a plurality of patients miss the optimal treatment time when finding, and the treatment difficulty is increased and the prognosis is poor; secondly, the progress is rapid, once colorectal cancer progresses, cancer cells can rapidly invade surrounding tissues and organs, and serious complications such as intestinal obstruction, perforation, bleeding and the like are caused; third, high mortality: colorectal cancer has a relatively high mortality rate, especially in late stage findings and treatments. Fourth, treatment challenge: although colorectal cancer has a variety of treatments, including surgery, chemotherapy, radiation therapy, targeted therapy, etc., the therapeutic effect varies from person to person and some patients may not respond well to existing treatments. Due to the adverse effects of colorectal cancer, there is an urgent need to develop effective therapeutic agents and accurate detection means.

Circular RNAs (circrnas) are a special non-coding RNA molecule whose unique circular structure makes them relatively stable in cells, not susceptible to degradation by exonucleases. With the progress of molecular biology technology, we have a more thorough understanding of the role of circRNA in the development and progression of tumors such as colorectal cancer. Studies indicate that circrnas play a key role in the regulation of colorectal cancer, and they may be involved in the processes of tumor growth, invasion and metastasis as oncogenes or tumor suppressor genes. Thus, circRNA is expected to be an important biomarker for colorectal cancer diagnosis, treatment and prognosis evaluation.

Although circFNDC B has been reported to be involved in colorectal cancer, not all cyclic circFNDC B structures have the effect of inhibiting colorectal cancer progression.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention aims to provide a novel application of the annular RNA CIRCFNDC B in colorectal cancer diagnosis and treatment.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

In a first aspect, the invention provides the use of a cyclic RNA CIRCFNDC B expression promoter in the manufacture of a medicament for the treatment and/or prophylaxis of colorectal cancer;

Further, circBase ID of the ring RNA CIRCFNDC B is hsa_circle_ 0001362.

Further, the cDNA sequence corresponding to the circular RNA CIRCFNDC B is shown as SEQ ID NO. 1;

The RNA sequence corresponding to the annular RNA CIRCFNDC B is shown as SEQ ID NO. 2;

The annular RNA CIRCFNDC B is an end-to-end annular structure formed by splicing after transcription of the nucleotide sequence shown in SEQ ID NO. 1;

The ring RNA CIRCFNDC B is a ring structure formed by connecting the nucleotide sequences shown in SEQ ID NO.2 end to end.

Further, the medicaments comprise molecular targeted medicaments, biological agents and pharmaceutical compositions for the treatment and/or prevention of colorectal cancer.

Further, the cyclic RNA CIRCFNDC B expression-promoting agent includes a natural purified substance, a modified natural purified substance, a semisynthetic substance, a chemically synthesized substance, and/or any combinations thereof capable of promoting expression of cyclic RNA CIRCFNDC B.

Further, the circular RNA CIRCFNDC B expression promoter includes circular RNA CIRCFNDC B, a recombinant vector containing circular RNA CIRCFNDC B, a nanoparticle containing circular RNA CIRCFNDC B, a protein microsphere containing circular RNA CIRCFNDC B, a liposome containing circular RNA CIRCFNDC B, a PEG-modified protein containing circular RNA CIRCFNDC B, an extracellular vesicle containing circular RNA CIRCFNDC B, and/or any combination thereof;

Preferably, the vector comprises a DNA plasmid vector, a lentiviral vector, a retroviral vector, a poxviral vector, a herpes simplex viral vector, an adenoviral vector, an adeno-associated viral vector, a liposome that binds a DNA plasmid, a molecular conjugate that binds a DNA plasmid, and/or a multimer that binds a DNA plasmid.

In some embodiments, the cyclic RNA CIRCFNDC B expression promoter refers to a substance capable of promoting expression of cyclic RNA CIRCFNDC B, including, but not limited to: any natural purified substance, modified natural purified substance, semisynthetic substance, chemically synthesized substance, and/or any combinations thereof that are capable of promoting expression of cyclic RNA CIRCFNDC3B are within the scope of the invention.

In some embodiments, the vector is not particularly limited as long as a vector capable of delivering the circular RNA CIRCFNDC B of the present invention to overexpress circFNDC B is within the scope of the present invention, and in particular embodiments of the present invention, the vector is a pcdna3.1 vector.

In a second aspect the present invention provides a pharmaceutical composition for the treatment and/or prophylaxis of colorectal cancer.

Further, the pharmaceutical composition comprises a cyclic RNA CIRCFNDC B expression promoter as described in the first aspect of the invention;

Preferably, the pharmaceutical composition may further comprise a pharmaceutically acceptable carrier and/or adjuvant;

preferably, the pharmaceutical composition may further comprise other drugs for the treatment and/or prevention of colorectal cancer;

more preferably, the additional drug comprises an antiviral drug, a chemotherapeutic drug, a targeted therapeutic drug, an immunotherapeutic drug, a mesogenic drug, and/or any combination thereof;

most preferably, the antiviral drug comprises entecavir, lamivudine, sofosbu Weida norprevir, tenofovir disoproxil, adefovir dipivoxil, oseltamivir, telbivudine, ritonavir;

Most preferably, the chemotherapeutic agent comprises fluorouracil, cyclophosphamide, doxorubicin, cisplatin, carboplatin, mitomycin, daunorubicin, epirubicin, gemcitabine, irinotecan, oxaliplatin, mitoxantrone;

Most preferably, the targeted therapeutic comprises sorafenib, regorafenib, lenvatinib, dorafinib, regorafenib, apatinib, cabotinib;

Most preferably, the immunotherapeutic agent comprises atilizumab, melittin Li Shan, garelizumab, tirelizumab, bevacizumab, na Wu Liyou mab, palbociclizumab;

most preferably, the Chinese patent medicine comprises compound plaque chelating capsules, anticancer Ping Wan, huabufonin capsules, zhenxiang capsules and Zhenqi Fuzheng granules.

In some embodiments, specific illustrative examples of the pharmaceutically acceptable carrier and/or adjuvant include, but are not limited to: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa butter; polyols such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifying agents, such as wetting agents, e.g., sodium lauryl sulfate; a colorant; a flavoring agent; tabletting and stabilizing agent; an antioxidant; a preservative; non-thermal raw water; isotonic saline solution; and phosphate buffer, etc.

In some embodiments, suitable pharmaceutically acceptable carriers and/or excipients are described in detail in Remington's Pharmaceutical Sciences (19 th ed., 1995) which are used as needed to aid stability of the formulation or to aid in enhancing the bioavailability of the active or active substance or to impart an acceptable mouthfeel or odor in the case of oral administration, and formulations which may be used in such pharmaceutical compositions may be in the form of the original compound itself, or optionally in the form of a pharmaceutically acceptable salt thereof. The pharmaceutical composition so formulated may be administered by any suitable means known to those skilled in the art, as desired, and when used, a safe and effective amount of the pharmaceutical composition of the present invention is administered to a human.

In some embodiments, the pharmaceutical compositions of the present invention are suitable for administration in a variety of formulations depending on factors such as the method of formulation, the mode of administration, the age, weight, sex, condition, diet, time of administration, route of administration, rate of excretion and sensitivity of the reaction of the patient, and the like, and the skilled practitioner will typically be able to readily determine the formulation and the dosage of the formulation effective for the desired treatment and/or prophylaxis.

In a third aspect the invention provides the use of annular RNA CIRCFNDC B as a diagnostic marker in the manufacture of a reagent for diagnosing and/or assessing colorectal cancer.

Further, the ring RNA CIRCFNDC B is a ring RNA CIRCFNDC B according to the first aspect of the present invention.

Further, the reagents include primers that specifically amplify loop RNA CIRCFNDC B and/or probes that specifically recognize loop RNA CIRCFNDC B;

Preferably, the sequence of the primer of the specific amplification loop RNA CIRCFNDC B is shown as SEQ ID NO. 3-SEQ ID NO. 4.

In a fourth aspect the invention provides a product for diagnosing colorectal cancer.

Further, the product comprises an agent according to the third aspect of the invention;

Preferably, the product further comprises reagents for detecting the level of expression of circular RNA CIRCFNDC B by sequencing techniques, nucleic acid hybridization techniques and/or nucleic acid amplification techniques;

preferably, the product comprises a kit, a chip and/or a test strip;

preferably, the product diagnoses colorectal cancer by detecting the expression level of loop RNA CIRCFNDC B in the test sample.

In some embodiments, the kit is an RT-PCR kit, which may further comprise the elements necessary for reverse transcription polymerase chain reaction. The RT-PCR kit contains a pair of primers specific for loop RNA CIRCFNDC B. The primer is a nucleotide having a nucleic acid sequence specific for the circular RNA, which may be about 7 to 50 bp, more particularly about 10-39 bp, in length.

In some embodiments, the RT-PCR kit may further comprise a test tube or suitable vessel, reaction buffers (different pH values and magnesium concentrations), deoxynucleotides (dntps), enzymes (e.g., taq polymerase and reverse transcriptase), deoxyribonuclease inhibitors, ribonuclease inhibitors, DEPC-water, and sterile water.

In some embodiments, the kit is a DNA chip kit, which may further comprise elements necessary for manipulating a DNA chip. The DNA chip kit may comprise a substrate to which a cDNA corresponding to loop RNA CIRCFNDC B or an oligonucleotide corresponding to a fragment thereof is bound, and reagents, agents and enzymes for constructing a fluorescent-labeled probe. In addition, the substrate may comprise a control cDNA or an oligonucleotide corresponding to a fragment thereof.

In a fifth aspect the present invention provides a method for inhibiting colorectal cancer cell proliferation, inhibiting colorectal cancer cell migration, inhibiting colorectal cancer cell invasion and/or inhibiting colorectal cancer tissue formation, for an in vitro non-therapeutic destination, the method comprising the steps of: an effective amount of a cyclic RNA CIRCFNDC B expression promoter according to the first aspect of the present invention is added to a system in need thereof.

The present invention also provides a method of treating and/or preventing colorectal cancer, the method comprising the steps of: administering to a subject in need thereof an effective amount of a cyclic RNA CIRCFNDC B and/or cyclic RNA CIRCFNDC B expression promoter as described in the first aspect of the invention, and/or a pharmaceutical composition as described in the second aspect of the invention.

In some embodiments, when the circular RNA CIRCFNDC B expression promoter described in the first aspect of the invention, and/or the pharmaceutical composition described in the second aspect of the invention, are administered, the substance may be administered systemically, or the substance may be administered directly to a specific site where cancerous or precancerous cells are present. Thus, administration can be accomplished in any manner effective to deliver the agent to the cancerous or precancerous cells.

In some embodiments, the mode of administration includes, but is not limited to: the substance is administered topically, transdermally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, orally, intranasally instilled, intracavity or intravesically instilled, intraocularly, intraarterially, intralesionally or by application to mucous membranes such as the nose, throat and bronchi.

The present invention also provides a method of diagnosing and/or aiding in the diagnosis of colorectal cancer, the method comprising the steps of: detecting the expression level of loop RNA CIRCFNDC B according to the first aspect of the invention in a sample derived from a subject, the subject being diagnosed as a patient suffering from colorectal cancer or as a suspected patient diagnosed as having a higher risk of suffering from colorectal cancer if the expression level of loop RNA CIRCFNDC B is significantly reduced in the sample derived from the subject compared to a normal human.

In some embodiments, the subject refers to any animal, and also refers to human and non-human animals. The non-human animals include all vertebrates, for example, mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any domestic animals or pets; and non-mammals, such as chickens, amphibians, reptiles, etc., in particular embodiments of the invention, the subject is preferably a human.

In some embodiments, the sample refers to a composition obtained or derived from a subject of interest comprising cellular entities and/or other molecular entities to be characterized and/or identified, e.g., based on physical, biochemical, chemical, and/or physiological characteristics. The sample may be obtained from blood and other fluid samples of biological origin and tissue samples of the subject, such as biopsy tissue samples or tissue cultures or cells derived therefrom. The source of the tissue sample may be solid tissue, such as tissue from fresh, frozen and/or preserved organs or tissue samples, biopsy tissue or aspirates; blood or any blood component; body fluid; cells from any time of gestation or development of an individual; or plasma. The sample includes biological samples that have been treated in any way after they have been obtained, such as by treatment with reagents, stabilization, or enrichment for certain components (such as proteins or polynucleotides), or embedding in a semi-solid or solid matrix for sectioning purposes. Samples described in the present invention include, but are not limited to: blood, tissue, blood-derived cells, serum, plasma, lymph, synovial fluid, cell extracts, and combinations thereof, in preferred embodiments, the sample is selected from a tissue sample or a blood sample of the subject.

Compared with the prior art, the invention has the advantages and beneficial effects that:

The invention discovers that the annular RNA CIRCFNDC B is a brand new colorectal cancer diagnosis and treatment target point for the first time, and results of in vitro cell experiments and in vivo function experiments show that the expression of the annular RNA CIRCFNDC B in colorectal cancer is obviously reduced, the over-expression circFNDC B can obviously inhibit the cell activity, the cell proliferation capacity, the cell migration and invasion capacity and the tumor formation capacity of colorectal cancer cells, and the annular RNA CIRCFNDC B can play an in vivo treatment effect of effectively killing the colorectal cancer cells and can be used for preparing tumor immunotherapy medicaments. The invention provides a new target for diagnosis and treatment of colorectal cancer, and has wide application prospect in clinical treatment of colorectal cancer.

Drawings

FIG. 1 is a feature block diagram of circFNDC B;

FIG. 2 is a first generation sequencing view of circFNDC B amplification product splice sites;

FIG. 3 is a graph showing the relative expression levels of RNA after digestion of circFNDC B and mFNDC B with RNase R enzyme;

FIG. 4 is a graph showing comparison of the results of QPCR detection of circFNDC B expression in colorectal and paracancestral tissues;

FIG. 5 is a graph showing the comparison of the results of QPCR detection of circFNDC B expression in colorectal cancer cell HCT116, colorectal cancer cell DLD-1 and normal colorectal cancer cell NCM 460;

FIG. 6 is a graph comparing cell viability of colorectal cancer cells overexpressing circFNDC B with control cell lines, wherein colorectal cancer cell HCT116 is on the left and colorectal cancer cell DLD-1 is on the right; the abscissa is the group, the ordinate is the OD450 value (representing relative cell viability), vector is the control cell line transfected with empty vector pCDNA3.1-vector, circFNDC B is the cell line transfected with pCDNA3.1-circFNDC B plasmid (overexpressing circFNDC B);

Fig. 7 is an EDU cell proliferation assay result, wherein fig. 7A is an EDU cell proliferation assay result graph, and fig. 7B is an EDU cell proliferation assay result statistical graph; wherein vector is a control cell line transfected with empty vector pCDNA3.1-vector, circFNDC B is a cell line transfected with pCDNA3.1-circFNDC B plasmid (overexpressing circFNDC B);

Fig. 8 is a graph showing the results of a cell scratch test, wherein fig. 8A is a graph showing the results of the scratch test, and fig. 8B is a statistical graph showing the healing rate of scratches; wherein vector is a control cell line transfected with empty vector pcdna3.1-vector, circFNDC B is a cell line transfected with pcdna3.1-circFNDC B plasmid (overexpressing circFNDC 3B);

FIG. 9 is a graph showing the results of the clone formation experiments, wherein FIG. 9A is a graph showing the results of the clone formation experiments, and FIG. 9B is a statistical graph showing the results of the clone formation experiments; wherein vector is a control cell line transfected with empty vector pcdna3.1-vector, circFNDC B is a cell line transfected with pcdna3.1-circFNDC B plasmid (overexpressing circFNDC 3B);

FIG. 10 shows the effect of over-expression circFNDC B on proliferation of colorectal cancer tumors in NCG mice, wherein FIG. 10A shows the growth of the NCG mice on the day 28 following intratumoral injection of circFNDC B over-expressed nanoparticles, and FIG. 10B shows the curve of the growth of the NCG mice on the subcutaneous tumor volume; wherein vector is a control cell line transfected with empty vector pCDNA3.1-vector, circFNDC B is a cell line transfected with pCDNA3.1-circFNDC B plasmid (overexpressing circFNDC 3B).

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In order to facilitate an understanding of the present invention, the following terms referred to in the present invention are explained herein:

As used herein, the term "colorectal cancer" refers to colon or rectal cancer. "colon cancer" refers to cancers and/or tumors that form in the colon tissue (the longest portion of the large intestine). Most colon cancers are adenocarcinomas (cancers that originate in cells that produce and release mucus and other fluids). "rectal cancer" refers to cancers and/or tumors that form in the rectal tissue (the last few inches of the large intestine before the anus).

As used herein, the term "primer" refers to 7-50 nucleic acid sequences that are capable of forming base pairs (basepair) complementary to the template strand and serve as starting points for replication of the template strand. Primers are usually synthesized, but naturally occurring nucleic acids may also be used. The sequence of the primer need not be exactly the same as the sequence of the template, but may be sufficiently complementary to hybridize with the template. Additional features may be incorporated that do not alter the basic properties of the primer. Examples of additional features that can be incorporated include methylation, capping, substitution of one or more nucleic acids with homologs, and modification between nucleic acids, but are not limited thereto.

As used herein, the term "probe" refers to a nucleic acid fragment, e.g., RNA or DNA, as short as a few to as long as hundreds of bases, which can establish specific binding with mRNA and can determine the presence of a particular mRNA due to a Labeling effect. Probes can be prepared in the form of oligonucleotide probes, single-stranded DNA probes, double-stranded DNA probes, RNA probes, and the like. Probes and hybridization conditions can be appropriately selected based on what is known in the art.

As used herein, the term "expression level" and "level" refer to the absolute or relative amount of expression of loop RNA CIRCFNDC B of the present invention, and the expression level of loop RNA CIRCFNDC B may be determined by a variety of techniques, and in particular, the absolute or relative amount of loop RNA CIRCFNDC B of the present invention may be detected by using methods well known to those of skill in the art.

As used herein, the term "treatment" generally relates to the treatment of a human or animal (e.g., as applied by a veterinarian) in which certain desired therapeutic effects can be achieved, for example, inhibiting the development of a disorder (including reducing the rate of development of a disorder, halting the development of a disorder), ameliorating a disorder, and curing a disorder. Also included are treatments as a prophylactic measure (e.g., prophylaxis). The use of a patient who has not yet developed, but is at risk of developing, a disorder is also included in the term "treatment".

As used herein, the term "preventing" refers to complete or partial inhibition of the development, recurrence, onset or spread of a colorectal cancer disease disorder or condition caused by administration of the cyclic RNA CIRCFNDC B and/or cyclic RNA CIRCFNDC B expression promoters described in the first aspect of the invention, and/or the pharmaceutical composition described in the second aspect of the invention.

As used herein, the term "diagnosis" refers to the discovery, judgment, or cognition of an individual's state of health or condition based on one or more symptoms, data, or other information associated with the individual. The health status of an individual may be diagnosed as healthy/normal (i.e., no disease or condition present) or may be diagnosed as unhealthy/abnormal (i.e., disease or condition present), the terms diagnosis, early diagnosis, making a diagnosis and variations of these terms include early detection of a disease/condition associated with a particular disease or condition (in the present invention, colorectal cancer); characteristics or classification of disease; discovery of progression, cure, or recurrence of disease; discovery of the response to disease following treatment or therapy in an individual, in the present invention, the diagnosis and/or assisted diagnosis of colorectal cancer includes distinguishing between individuals not suffering from colorectal cancer and individuals suffering from colorectal cancer.

As used herein, the term "pharmaceutical composition" may have any one of the formulations selected from the group consisting of: solutions, granules, suspensions, tablets, pills, powders, capsules, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, lyophilized formulations and suppositories. Furthermore, the pharmaceutical composition may be administered one or more times. In this case, the pharmaceutical composition may be administered in the form of a liquid formulation, powder, aerosol, capsule or suppository. In particular embodiments, the pharmaceutical compositions provided herein can be formulated into various dosage forms according to actual needs, and the dosage beneficial to the patient can be determined by the clinician based on the type, age, weight and general disease condition of the subject, mode of administration, and the like. The mode of administration may be, for example, injection or any other suitable mode of administration known to those skilled in the art.

As used herein, the term "effective amount" refers to an amount that has a therapeutic effect or is required to produce a therapeutic effect in a subject. For example, a pharmaceutically or pharmaceutically effective amount refers to the amount of drug required to produce a desired therapeutic effect, which can be reflected by the results of a clinical trial, a model animal study, and/or an in vitro study. The pharmaceutically effective amount depends on several factors, including but not limited to: the characteristic factors of the subject (such as height, weight, sex, age and history of administration), the severity of the disease, etc.

As used herein, the term "administering" refers to the act of injecting or physically delivering a substance present outside the body (e.g., the cyclic RNA CIRCFNDC B, cyclic RNA CIRCFNDC B expression promoter, and/or pharmaceutical composition described herein) into a subject, e.g., by mucosal, intradermal, intravenous, intramuscular delivery, and/or any other physical delivery method known in the art. When a disease, disorder or condition, or symptom thereof is treated, administration of the substance is typically performed after the onset of the disease, disorder or condition, or symptom thereof. When a disease, disorder or condition, or symptom thereof is prevented, administration of the substance is typically performed prior to the onset of the disease, disorder or condition, or symptom thereof.

The invention is further illustrated below in conjunction with specific examples, which are intended to illustrate the invention and are not to be construed as limiting the invention. One of ordinary skill in the art can appreciate that: many changes, modifications, substitutions and variations may be made to the embodiments without departing from the spirit and principles of the invention, the scope of which is defined by the claims and their equivalents. The experimental procedure, in which no specific conditions are noted in the examples below, is generally carried out according to conventional conditions or according to the conditions recommended by the manufacturer.

The principal materials and reagent information used in the present invention are shown in Table 1 below.

TABLE 1 Main materials and reagents

Sequence number	Reagent name	Production company	Goods number
				1	EasyScript® First-Strand cDNA Synthesis SuperMix	Beijing full-type gold organism	AE301-02
2	RNase R enzyme	Shanghai Biyun biotechnology Co., ltd	R7092S
				3	SuperReal fluorescent quantitative premix reagent enhanced version (SYBR Green)	Tiangen Biochemical technology (Beijing) Co., ltd	FP205
4	Cell Counting Kit-8 (CCK-8 kit)	Shanghai Biyun biotechnology Co.Ltd	C0038
				5	BeyoClick ™ EdU-555 cell proliferation detection kit	Shanghai Biyun biotechnology Co.Ltd	C0075S
6	Human normal colon epithelial cell NCM460	Shang En Biotech Co., ltd	SNL-519
				7	Human colon cancer cell HCT116	North Biotech Co.Ltd	BNCC287750
8	Human colorectal adenocarcinoma epithelial cell DLD-1	North Biotech Co.Ltd	BNCC100190

The cyclic RNA CIRCFNDC B (CircBase ID: hsa_circ_ 0001362) is derived from 4,6 and 8 exons of 26 exons of FNDC3B gene on chromosome 3, the cyclized nucleotide sequence has 585 bases, and no report on circFNDC B and colorectal cancer cell functions exists at present.

CircFNDC3B has the cDNA sequence shown as SEQ ID NO:1 is a circular structure formed by splicing after transcription of the nucleotide sequence shown in SEQ ID NO. 1. The RNA sequence corresponding to circFNDC B is shown as SEQ ID NO. 2, and the structure of circFNDC B is shown as SEQ ID NO:2, and the nucleotide sequence is connected end to form a circular structure.

CircFNDC3B (SEQ ID NO: 1):

GTGATTGAAGATAGTACTGGAGTCCGCCGGGTGGTGGTCACACCCCAGTCTCCTGAGTGTTATCCCCCAAGCTACCCCTCAGCCATGTCTCCAACCCATCATCTCCCTCCCTATCTGACTCACCATCCACATTTTATTCATAACTCACACACGGCTTACTACCCACCTGTTACCGGACCTGGAGATATGCCGCCTCAGTTTTTTCCCCAGCATCATCTTCCCCACACAATATATGGTGAGCAAGAAATTATACCATTTTATGGAATGTCAACCTACATCACCCGAGAAGACCAGTACAGCAAGCCTCCGCACAAAAAACTGAAAGACCGCCAGATCGATCGCCAGAACCGCCTCAACAGCCCTCCTTCTTCTATCTACAAAAGCAGCTGCACAACAGTATACAATGGCTATGGGAAGGGCCATAGTGGTGGAAGTGGCGGAGGCGGCAGCGGTAGTGGTCCCGGAATTAAGAAAACAGAGCGACGAGCAAGAAGCAGCCCAAAGTCGAATGATTCAGACTTGCAAGAATATGAGTTGGAAGTAAAGAGGGTGCAAGACATTCTTTCGGGAATAGAGAAACCACAG

circFNDC3B (SEQ ID NO: 2):

GUGAUUGAAGAUAGUACUGGAGUCCGCCGGGUGGUGGUCACACCCCAGUCUCCUGAGUGUUAUCCCCCAAGCUACCCCUCAGCCAUGUCUCCAACCCAUCAUCUCCCUCCCUAUCUGACUCACCAUCCACAUUUUAUUCAUAACUCACACACGGCUUACUACCCACCUGUUACCGGACCUGGAGAUAUGCCGCCUCAGUUUUUUCCCCAGCAUCAUCUUCCCCACACAAUAUAUGGUGAGCAAGAAAUUAUACCAUUUUAUGGAAUGUCAACCUACAUCACCCGAGAAGACCAGUACAGCAAGCCUCCGCACAAAAAACUGAAAGACCGCCAGAUCGAUCGCCAGAACCGCCUCAACAGCCCUCCUUCUUCUAUCUACAAAAGCAGCUGCACAACAGUAUACAAUGGCUAUGGGAAGGGCCAUAGUGGUGGAAGUGGCGGAGGCGGCAGCGGUAGUGGUCCCGGAAUUAAGAAAACAGAGCGACGAGCAAGAAGCAGCCCAAAGUCGAAUGAUUCAGACUUGCAAGAAUAUGAGUUGGAAGUAAAGAGGGUGCAAGACAUUCUUUCGGGAAUAGAGAAACCACAG

EXAMPLE 1 construction of circular RNA

In this example, the inventors designed a specific primer pair capable of amplifying circFNDC B (CircBase ID: hsa_circ_ 0001362), and amplified the circular RNA of the FNDC3B gene using the primer pair, confirmed the splice site (backsplicing junction site) of the circular RNA by a one-generation sequencing method, and then determined circFNDC3B to express a circular RNA molecule having a closed circular structure by RNase R digestion experiments. The specific experimental method is as follows:

1. cell total RNA extraction and concentration determination

(1) When the cells of the 6-well plate exceed 90%, the old culture solution is discarded, after the cells are washed once by PBS, 1mLTrizol is added to each well, and then the cells are transferred to a 1.5 mL EP tube;

(2) The EP tube was left at room temperature for 10 minutes in order for the nucleic acid protein complex to be sufficiently separated;

(3) 0.2mL of chloroform was added to the EP tube, shaken for about 10s, and then allowed to stand at room temperature for 5min; chloroform is a nonpolar molecule, and can effectively inhibit the activity of RNase, when the cell solution added with Trizol is mixed with chloroform, water molecules of protein are removed by chloroform, so that the protein is denatured due to water loss and state, and the separation of aqueous phase and organic phase is accelerated;

(4) 12000g, centrifuging at 4deg.C for 15min, wherein the EP tube solution is divided into 3 layers, the bottom layer is red organic matter, the upper layer is colorless water phase, and RNA exists in the water phase;

(5) The supernatant (about 450 mL) was transferred to a fresh EP tube, then the same volume of isopropanol was added and left at room temperature for 10min; isopropanol absorbs water around RNA to precipitate it;

(6) 12000g, centrifuging at 4deg.C for 10min, observing white RNA precipitate at the bottom and side of the tube, and discarding supernatant;

(7) Washing the RNA precipitate with 75% DEPC-ethanol solution, centrifuging at 4deg.C for 5min, and discarding supernatant;

(8) Placing the RNA precipitate in a biosafety cabinet for 5min, and adding 20 microliters of DEPC water to dissolve RNA after airing, wherein the steps are operated on ice;

(9) The total RNA purity and concentration of the cells were measured using ScanDrop100,100 ultra-micro nucleic acid assay.

2. CDNA reverse transcription

Preparation of a reverse transcription reaction system (for example, 20. Mu.L system) was performed on ice, and after completion of the preparation, prepared total RNA of cells was added for reverse transcription, and the reverse transcription reaction system was as shown in Table 2.

TABLE 2 reaction system

The reverse transcription reaction conditions were as follows: the reaction was carried out at 37℃for 15 minutes, followed by 85℃for 5 seconds. Cooling to 4 deg.c, diluting the cDNA to 5 times, and storing in-20 deg.c refrigerator.

3. Primer design

Primers were designed using Primer3.0 on-line tool and verified with NCBI Blast.

The design principle of the primer is as follows: (1) the GC content of the primer is 50-60%; (2) the primer length is 17-25bp; (3) the Tm of the primer is 57-63 ℃; (4) the position of the primer avoids the tertiary structure of the target sequence; (5) avoiding repeating G or C bases a number of times; (6) avoiding the primer terminal base to be A; (7) the primer and the product avoid forming a secondary structure; (8) the product length is between 100 and 150 bp; the product of (9) avoids 4 single base repeats.

By the design principle, the primer 5 pair is designed together, and the primer pair adopted in the embodiment is as follows, wherein the primer pair is synthesized by the company Boxing of the Beijing Rui:

F：5 '-AGCAGCCCAAAGTCGAATGA-3 '（SEQ ID NO:3）

R：5 '-GAGGGGTAGCTTGGGGGATA-3 '（SEQ ID NO:4）

In one or more embodiments, other primer pairs than those described above may be used for amplification.

4. First generation sequencing

The cDNA obtained by reverse transcription is amplified by using the primer set described above, and then the amplified product is subjected to first-generation sequencing.

5. RNase R digestion experiment

RNase R enzyme is an RNase capable of digesting linear RNA but has little effect on circular RNA.

Mu.g of total RNA from cells was incubated with 3U RNase R enzyme at 37℃for 30 minutes in a volume of 10. Mu.L, then warmed to 75℃and held for 10 minutes to inactivate the RNase R enzyme, and finally analyzed by RT-qPCR for the effect of RNase R addition on circFNDC B and mFNDC B.

6. Experimental results

The feature structure of circFNDC B and the first generation sequencing result of the splice site of the circFNDC B amplified product are shown in fig. 1 and 2, respectively, circFNDC B is derived from the exon of the FNDC3B gene, and the first generation sequencing result proves that circFNDC B has reverse cleavage ligation and accurately shows the splice site of the amplified product, indicating that circFNDC B formation is not due to recombination mismatch of the genome.

The comparison of RNase R digestion with circFNDC B and mFNDC B is shown in fig. 3, where linear mFNDC B expression is significantly reduced after RNase R enzyme digestion, while circFNDC B is resistant to RNase R enzyme digestion, confirming its cyclic structure.

Example 2 detection of expression of circFNDC3B in clinical sample tissues and cell lines

The expression level of circFNDC B in colorectal cancer and paracancestral tissues of 12 clinical patients, as well as the expression differences in colorectal cancer cell lines and corresponding Normal liver cell lines, were detected by fluorescent Quantitative PCR (QPCR), and circFNDC B was found to be significantly lower in colorectal cancer tissue (Tumor) than paracancestral tissue (Normal), as well as in colorectal cancer cell lines, indicating that circFNDC B can be used for colorectal cancer diagnosis. The specific experimental method is as follows:

1. total RNA extraction and concentration determination in cells

(1) 1ML Trizol was added to the 6-well cell culture plate and lysed for 10min, followed by 1.5 mL EP tube;

(2) The EP tube is left at room temperature for about 10 minutes so that the nucleic acid protein complex can be sufficiently separated;

(3) 0.2mL of chloroform was added to the EP tube, shaken for about 10s, and then allowed to stand at room temperature for 5min;

(5) The supernatant (about 450 mL) was transferred to a fresh EP tube, then the same volume of isopropanol was added and left at room temperature for 10min;

(8) Placing the RNA precipitate in a biosafety cabinet for 5min, airing, and adding 20 mu L of DEPC water to dissolve the RNA, wherein the steps are operated on ice;

(9) RNA purity and concentration were measured using ScanDrop100,100 ultra-micro nucleic acid assay.

2. QPCR amplification assay

Tissue RNA reverse transcription was performed using the cDNA reverse transcription method of example 1.

Preparation of PCR reaction system (for example, 20. Mu.L system) was performed on ice, and after completion of the preparation, cDNA template obtained by reverse transcription was added. Wherein, the PCR reaction system is shown in Table 3:

TABLE 3 PCR reaction system

The primer set used for amplifying circular RNA CIRCFNDC B was the one shown in example 1 as SEQ ID NO:3-SEQ ID NO: 4:

F：5 '-AGCAGCCCAAAGTCGAATGA-3 '（SEQ ID NO:3）

R：5 '-GAGGGGTAGCTTGGGGGATA-3 '（SEQ ID NO:4）

The reaction conditions include:

The first step, pre-denaturation, 95 ℃ for 5 minutes;

Second, PCR (40 cycles), 95℃for 20 seconds; 60 ℃ for 20 seconds; 72℃for 20 seconds.

Thirdly, analyzing a melting curve, namely, at 65 ℃ for 5 seconds; 95℃for 5 seconds.

Quantitative analysis was performed after PCR amplification. The calculation formula of the relative expression quantity of the target gene is as follows: 2- ΔΔct=2- [ Δct ] Test- (. DELTA.ct) Control ]. Wherein, Δct=ct target-Ct housekeeping, ct target is target gene Ct value, ct housekeeping is housekeeping gene Ct value, Δct represents phase Ct value of each sample target gene relative to housekeeping gene, ΔΔct= (Δct) Test- (Δct) Control, represents normalization of the treatment group relative to the Control group, and 2- Δct represents relative expression amount of the treatment group relative to the Control group, and represents relative expression multiple of the target gene.

3. Experimental results

As shown in the results of the QPCR experiments in figures 4 and 5, the expression level of circFNDC B in colorectal cancer tissues (Tumor) is obviously lower than that of paracancestral tissues (Normal), and the expression level of circFNDC B in colorectal cancer cells, namely colorectal cancer cells HCT116 and DLD-1, is obviously lower than that of Normal colorectal cancer cells NCM460, so that the QPCR experiment shows that the circFNDC B has important significance in colorectal cancer occurrence and development, can be used as an ideal prognosis marker of colorectal cancer patients, and can play a positive role in colorectal cancer diagnosis.

Example 3 Effect of over-expression circFNDC B on colorectal cancer cell proliferation, invasion and metastasis

CircFNDC3B and a random sequence vector are constructed on a special pCDNA3.1 vector for over-expressing circular RNA, pCDNA3.1-circFNDC B and pCDNA3.1-vector are transfected on HCT116 cells as a treatment group and a control group, the effect of over-expression of circFNDC B on the activity of colorectal cancer cells is detected by CCK8 cell activity, the effect of over-expression of circFNDC B on the proliferation capacity of colorectal cancer cells is detected by EDU cell proliferation experiments, the effect of over-expression of circFNDC B on the migration and invasion capacity of colorectal cancer cells is examined by cell scratch experiments, and the effect of over-expression of circFNDC B on the proliferation capacity of colorectal cancer cells is examined by clone formation experiments.

1. CCK-8 cell Activity assay

The dehydrogenase in the mitochondria of living cells can react with the WST-8 compound, and finally the dehydrogenase is reduced into hydrophilic formazan dye, the dye is yellow after being dissolved, the number of generated yellow formazan is positively correlated with the number of living cells, namely, the more the number of living cells is, the higher the degree of yellow of the solution is, so that the characteristic is utilized for detecting the proliferation of cells.

(1) 10000 HCT116 cells are inoculated in each well of a 96-well plate, and pCDNA3.1-circFNDC B and pCDNA3.1-vector are respectively transfected as a treatment group and a control group after 12h of cell adherence is cultivated;

(2) Add 10. Mu.L of CCK-8 reagent to the corresponding wells at 48 h;

(3) Placing the mixture in a constant temperature incubator with the temperature of 37 ℃ and the concentration of 5% CO ₂ for culturing for about 2 hours;

(4) Finally, the absorbance was measured at 450nm using an microplate reader.

2. EDU cell proliferation assay

A cell proliferation assay kit (BeyoClick ™ EdU Cell Proliferation Kit with Alexa Fluor, 555) (available from Shanghai Biyun biotechnology Co., ltd.) is a kit for simply, rapidly and highly sensitively detecting cell proliferation based on the incorporation of thymidine (thymidine) analogue EdU (5-ethynyl-2' -deoxyuridine) during DNA synthesis, and the subsequent Click reaction (Click reaction) to label the EdU with Alexa Fluor 555.

(1) Inoculating 30 ten thousand cancer cells into a 6-hole plate, and respectively transfecting pCDNA3.1-circFNDC B and pCDNA3.1-vector as a treatment group and a control group after 12h of cell adherence is cultivated;

(2) After 48h of culture, the culture medium is discarded, PBS is added for three times, 1ml of 4% paraformaldehyde is added for fixation at room temperature for 10min;

(3) Discarding 4% paraformaldehyde, adding PBS, washing for three times, adding 1ml of 0.1% triton X-100, and incubating for 10min at room temperature;

(4) The solution of triton X-100 at 0.1% was discarded, washed three times with PBS, and then detected using the BeyoClick ™ EdU-555 cell proliferation assay kit described above.

3. Cell scratch assay

(1) Scribing on a 24-hole cell culture plate, firstly scribing 3-5 lines on the back of the 24-hole plate by using a Mark pen, then inoculating 6 ten thousand HCT116 cells, and respectively transfecting pCDNA3.1-circFNDC B and pCDNA3.1-vector as a treatment group and a control group after 12h of cell adherence is cultivated;

(2) After six hours of transfection, a vertical trace is marked in the middle of the culture hole by using a yellow gun head of 200ul, then the culture hole is washed once by using PBS, and a fresh culture medium is added to take a picture under a lens and record for 0 hour;

(3) After 48h, washing with PBS for one time, taking a picture, and recording as 48h;

(4) Scratch healing rate was calculated using image J-processed pictures.

4. Cloning formation experiments

(1) Each experimental group in the 6-hole plate culture plate is inoculated with 1000 cells/hole, and pCDNA3.1-circFNDC B and pCDNA3.1-vector are respectively transfected as a treatment group and a control group after 12h of cell attachment is cultivated;

(2) Culturing continuously until the number of cells in 14 days or most single clones is greater than 50, changing liquid every 3 days in the middle, and observing the cell state;

(3) After cloning is completed, photographing the cells under a microscope, washing the cells for 1 time by using PBS, adding 1mL of 4% paraformaldehyde into each hole for fixation for 30-60 min, and washing the cells for 1 time by using PBS;

(4) 1ml of crystal violet dye solution is added into each hole, and cells are dyed by 10-20 min;

(5) Washing the cells with PBS for several times, airing, and taking pictures with a digital camera (taking pictures of the whole six-well plate and each well separately);

(6) The number of clonally formed cells was calculated using image J-processed pictures.

5. Experimental results

The experimental results of CCK-8 cell activity detection are shown in FIG. 6, and after circFNDC B is over-expressed, the cell activity of colorectal cancer cells is obviously inhibited, and the activity of colorectal cancer cells is obviously weakened.

The experimental results of EDU cell proliferation assay are shown in FIG. 7, and after circFNDC B is over-expressed, the cell proliferation capacity of colorectal cancer cells is obviously inhibited, and the cell division capacity of colorectal cancer cells is obviously weakened.

The experimental results of the cell scratch experiments are shown in fig. 8A and 8B, and compared with the colorectal cancer cell line of the control group of empty vector, the colorectal cancer cell line of the over-expression circFNDC B has obviously inhibited migration and invasion capacity.

The results of the cloning experiments are shown in fig. 9A and 9B, and the cell strain overexpressing circFNDC B significantly inhibited the oncologic capacity of colorectal cancer cells compared to the empty vector control cell strain.

The experiment shows that circFNDC B gene and its expression product can be used in colorectal cancer treatment.

Example 4 Effect of over-expression circFNDC B on proliferation of colorectal cancer cells in NCG mice

1. Experimental method

This example was performed using 6 week male NCG mice, all purchased from Peking Vitre Liwa laboratory animal Co.

After digestion with pancreatin, 300g of the log-phase grown CACO2 cells were centrifuged for 5min for cell count, the cells were resuspended in serum-free DMEM medium at a density of 10 ⁷/100 ul, injected subcutaneously in the left armpit of NCG mice at a volume of 100 ul/only, tumor size was detected after 7 days, and after tumor volume exceeded 100mm ³, the subsequent experiments were performed.

Tumor-forming NCG mice meeting the standard are selected as an evaluation model, pCDNA3.1-vector and pCDNA3.1-circFNDC B over-expression nano particles are injected into the tumor in the NCG mice subcutaneous tumor, tumor volume is measured once a week (V=1/2×a×b2, a is a long axis and B is a short axis), the longest and shortest positions of the tumor are measured by a vernier caliper, and a tumor volume increase curve is drawn.

2. Experimental results

The experimental results are shown in fig. 10A and 10B, and the volume of circFNDC B group tumor into which the over-expression circFNDC B was introduced is significantly reduced (see fig. 10A). NCG mice were sacrificed on day 28, tumors were removed, photographed, and a subcutaneous tumor volume increase curve was plotted in nude mice, showing that the tumor volume of the pCDNA3.1-circFNDC3B group overexpressing circFNDC B was significantly smaller than that of the control group pCDNA3.1-Vector (see FIG. 10B).

The experiment shows that over-expression circFNDC B can obviously inhibit the subcutaneous tumorigenicity of colorectal cancer cells in NCG mice, namely circFNDC B and an expression product thereof can be effectively applied to colorectal cancer treatment.

Claims

1. Use of a cyclic RNA CIRCFNDC B expression promoter in the manufacture of a medicament for the treatment and/or prophylaxis of colorectal cancer;

CircBase ID of the ring RNA CIRCFNDC B is hsa_circle_ 0001362.

2. The use according to claim 1, wherein the cDNA sequence corresponding to the loop RNA CIRCFNDC B is shown in SEQ ID NO. 1;

3. The use of claim 1, wherein the cyclic RNA CIRCFNDC B expression promoter comprises a natural purification substance, a modified natural purification substance, a semisynthetic substance, a chemically synthetic substance, and/or any combinations thereof capable of promoting expression of cyclic RNA CIRCFNDC B.

4. The use of claim 1, wherein the circular RNA CIRCFNDC B expression promoter comprises circular RNA CIRCFNDC B, a recombinant vector comprising circular RNA CIRCFNDC B, a nanoparticle comprising circular RNA CIRCFNDC B, a protein microsphere comprising circular RNA CIRCFNDC3B, a liposome comprising circular RNA CIRCFNDC B, a PEG-modified protein comprising circular RNA CIRCFNDC B, an extracellular vesicle comprising circular RNA CIRCFNDC B, and/or any combination thereof.

5. A pharmaceutical composition for the treatment and/or prevention of colorectal cancer, characterized in that the pharmaceutical composition comprises a cyclic RNA CIRCFNDC B expression promoter as defined in any one of claims 1 to 4.

6. Use of the loop RNA CIRCFNDC B as a diagnostic marker in the manufacture of a reagent for diagnosing and/or assessing colorectal cancer, characterized in that the loop RNA CIRCFNDC B is the loop RNA CIRCFNDC B as claimed in any one of claims 1 to 4.

7. The use according to claim 6, wherein the reagent comprises a primer that specifically amplifies loop RNA CIRCFNDC B and/or a probe that specifically recognizes loop RNA CIRCFNDC B;

The sequence of the primer of the specific amplification ring RNA CIRCFNDC B is shown as SEQ ID NO. 3-SEQ ID NO. 4.

8. A product for diagnosing colorectal cancer, characterized in that it comprises the agent as claimed in claim 6 or 7;

the product comprises a kit, a chip and/or a test strip;

The product diagnoses colorectal cancer by detecting the expression level of the ring RNA CIRCFNDC B in a sample to be tested.

9. A method of inhibiting colorectal cancer cell proliferation, inhibiting colorectal cancer cell migration, inhibiting colorectal cancer cell invasion and/or inhibiting colorectal cancer tissue formation at a non-therapeutic destination in vitro, the method comprising the steps of: adding an effective amount of a cyclic RNA CIRCFNDC B expression promoter as described in any one of claims 1 to 4 to a system in need thereof.