CN117946950A - Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria - Google Patents

Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria Download PDF

Info

Publication number
CN117946950A
CN117946950A CN202211328428.XA CN202211328428A CN117946950A CN 117946950 A CN117946950 A CN 117946950A CN 202211328428 A CN202211328428 A CN 202211328428A CN 117946950 A CN117946950 A CN 117946950A
Authority
CN
China
Prior art keywords
hydroxyisovalerate
acetolactate synthase
encoding
gene
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211328428.XA
Other languages
Chinese (zh)
Inventor
张学礼
刘萍萍
唐金磊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin Institute of Industrial Biotechnology of CAS
Original Assignee
Tianjin Institute of Industrial Biotechnology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin Institute of Industrial Biotechnology of CAS filed Critical Tianjin Institute of Industrial Biotechnology of CAS
Priority to CN202211328428.XA priority Critical patent/CN117946950A/en
Publication of CN117946950A publication Critical patent/CN117946950A/en
Pending legal-status Critical Current

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention provides a genetically engineered 2-hydroxyisovalerate producing strain, wherein the strain has or has enhanced acetolactate synthase, acetohydroxy acid reductase isomerase, dihydroxy acid dehydratase and hydroxy acid dehydrogenase activities, as well as methods of producing the same and uses thereof in the production of 2-hydroxyisovalerate.

Description

Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria
Technical Field
The invention relates to the technical field of biology, in particular to dehydrogenase for producing 2-hydroxyisovalerate, construction of a recombinant strain for producing 2-hydroxyisovalerate and application of the recombinant strain in 2-hydroxyisovalerate production.
Background
2-Hydroxyisovaleric acid (2-hydroxy-3-methylbutyric acid) can be used directly as a base stock for surfactants and emulsifiers or for a number of important substances as a polyhydroxylic acid. In addition, studies have found that 2-hydroxyisovaleric acid has great potential for use as a monomer in the synthesis of novel polymers, or in the synthesis of polymers with compounds such as lactic acid, glycolic acid, 2-hydroxy-3-methylpentanoic acid, or 2-hydroxy-3-phenylpropionic acid.
Along with the rapid development of synthetic biology, the biological production of 2-hydroxyisovalerate is realized through metabolic engineering transformation, so that the production cost of 2-hydroxyisovalerate can be greatly reduced, the green environment-friendly production is realized, and meanwhile, the dependence on petroleum-based raw materials can be eliminated. There is currently very limited worldwide research on biosynthesis of 2-hydroxyisovalerate. However, based on the great application potential of 2-hydroxyisovaleric acid in the fields of polymeric materials and the like, research on the 2-hydroxyisovaleric acid is developed by a research group at present. In 2018, the Ramon Gonzalez group created a synthetic pathway of 2-hydroxyisovalerate in e.coli by overexpressing key genes of the synthetic pathway and introducing 2-hydroxy acid dehydrogenase encoding gene panE from lactococcus lactis (Lactococcus lactis) for 2-hydroxyisovalerate synthesis. Under aerobic conditions, the strain can produce 6.2g/L of 2-hydroxyisovalerate when glycerol is used as a substrate for fermentation, the conversion rate is 58% of the theoretical maximum conversion rate, and can produce 7.8g/L of 2-hydroxyisovalerate when glucose is used as a substrate, and the conversion rate is 73% of the theoretical maximum conversion rate. But it is worth noting that the aerobic process requires air in the production process, and the energy consumption is great; more importantly, a significant portion of the carbon source enters the tricarboxylic acid cycle (TCA) for cell growth, resulting in a much lower conversion than the theoretical maximum. Compared with the anaerobic process and the aerobic process, the anaerobic process has the advantages of low energy consumption and high conversion rate, and air is not required to be introduced in the production process, so that the energy consumption is greatly saved; the conversion of the product is usually close to the theoretical maximum. In addition, the yield of 2-hydroxyisovalerate in the current research is low, and the method is not suitable for industrial production. Therefore, there is a need for a more efficient and lower energy consumption engineering strain for the production of 2-hydroxyisovalerate.
Disclosure of Invention
The inventors screened from nature a new 2-hydroxy acid dehydrogenase capable of synthesizing 2-hydroxy isovalerate. The protein is introduced into an engineering strain, and meanwhile, the engineering strain with balanced reducing force is created based on genome-wide metabolic breeding, so that the obtained engineering strain can produce 2-hydroxyisovalerate, and the coupling of 2-hydroxyisovalerate synthesis and cell growth is realized, thereby providing a foundation for optimizing cell performance through metabolic domestication. The finally obtained 2-hydroxyisovalerate engineering strain can take glucose as a raw material to realize biosynthesis of 2-hydroxyisovalerate and obtain the highest 2-hydroxyisovalerate yield in the current known report.
The invention provides a genetically modified 2-hydroxyisovalerate producing strain and a preparation method thereof, wherein the genetically modified 2-hydroxyisovalerate producing strain can realize the efficient production of 2-hydroxyisovalerate in an anaerobic fermentation mode.
In one aspect, the invention provides a genetically engineered 2-hydroxyisovalerate producing strain having or having enhanced acetolactate synthase, acetohydroxy acid reductase isomerase, dihydroxy acid dehydratase, and hydroxy acid dehydrogenase activities.
In one embodiment, the acetolactate synthase comprises one or more, preferably all, of bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II and L-valine feedback resistant escherichia coli acetolactate synthase III.
In one aspect, the invention provides a method of producing a genetically engineered 2-hydroxyisovalerate producing strain comprising enhancing the activity of bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II and L-valine feedback resistant escherichia coli acetolactate synthase III, acetohydroxyacid reductase isomerase, dihydroxyacid dehydratase and hydroxyacid dehydrogenase in the strain.
In one aspect, the present invention provides a method of producing 2-hydroxyisovalerate comprising culturing (preferably under anaerobic conditions) a genetically engineered 2-hydroxyisovalerate producing strain of the present invention and/or a genetically engineered 2-hydroxyisovalerate producing strain obtained by a method of producing a genetically engineered 2-hydroxyisovalerate producing strain of the present invention.
In one aspect, the invention provides the use of a genetically engineered 2-hydroxyisovalerate producing strain of the invention and/or obtainable by a method of producing a genetically engineered 2-hydroxyisovalerate producing strain of the invention for the production of 2-hydroxyisovalerate, preferably under anaerobic conditions.
In one aspect, the present invention provides a hydroxy acid dehydrogenase useful for producing 2-hydroxyisovalerate or preparing a genetically engineered 2-hydroxyisovalerate producing strain producing 2-hydroxyisovalerate, wherein the hydroxy acid dehydrogenase comprises the amino acid sequence of SEQ ID NO:11 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity.
Brief Description of Drawings
Fig. 1: the results of fermentation of the S HMBA strain for 6 days to produce 2-hydroxyisovalerate are shown. FIG. A shows a standard of 2-hydroxyisovalerate and FIG. B shows S HMBA 020 fermentation broth.
Fig. 2: the metabolic evolution of strain S HMBA 023,023 is shown.
Fig. 3: the results of producing 2-hydroxyisovalerate after 60 hours of fermentation at S HMBA 023,023 are shown. FIG. A shows a standard of 2-hydroxyisovalerate and FIG. B shows a fermentation broth of S HMBA 023,023.
Detailed Description
Unless defined otherwise, technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art. See, for example ,Singleton et al.,DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY 2nd ed.,J.Wiley&Sons(New York,NY 1994);Sambrook et al.,MOLECULAR CLONING,A LABORATORY MANUAL,Cold Springs Harbor Press(Cold Springs Harbor,NY 1989).
As used herein, "genetically engineered" refers to a strain that is artificially altered by biological means, having one or more alterations, such as gene deletions, amplifications, or mutations, as compared to the original strain prior to the transformation, thereby having altered biological properties, such as improved productivity. As used herein, the initial strain may be the native strain to which the genetic modification is to be made or a strain with other genetic modifications.
As used herein, a 2-hydroxyisovalerate producing strain refers to a strain that can produce 2-hydroxyisovalerate under suitable conditions (e.g., via fermentation).
Strains known in the art for producing 2-hydroxyisovalerate include, for example, but are not limited to, escherichia such as E.coli (ESCHERICHIA COLI), enterobacter (Enterobacter), corynebacterium glutamicum (Corynebacterium glutamicum), and yeast.
As used herein, acetolactate synthase (EC 2.2.1.6) is responsible for catalyzing two molecules of pyruvic acid to form a single serving of acetolactate. There are three acetolactate synthetases in E.coli, acetolactate synthetase I, encoded by the ilvBN gene, acetolactate synthetase II, encoded by the ilvGM gene, and acetolactate synthetase III, encoded by the ilvIH gene, respectively. In contrast, microorganisms such as Corynebacterium glutamicum contain only one acetolactate synthase, which is encoded by the ilvBN gene. As used herein, having or having enhanced acetolactate synthase activity means that the strain has or has enhanced acetolactate synthase activity for converting pyruvate to acetolactate.
In one embodiment, the acetolactate synthase is an E.coli acetolactate synthase, such as E.coli acetolactate synthase I, E.coli acetolactate synthase II or E.coli acetolactate synthase III.
In one embodiment, the E.coli acetolactate synthase I is encoded by an ilvBN gene sequence as shown below, wherein the ilvB gene sequence is ：atggcaagttcgggcacaacatcgacgcgtaagcgctttaccggcgcagaatttatcgttcatttcctggaacagcagggcattaagattgtgacgggcattccgggcggttctatcctgcctgtttacgatgccttaagccaaagtacgcaaatccgccatattctggctcgccatgaacagggcgcgggatttatcgctcagggaatggcgcgcaccgacggtaaaccggcggtctgtatggcctgtagcggaccgggtgcgactaacctggtgaccgccattgccgatgcgcggctggactccatcccgctgatttgcatcactggtcaggttcccgcctcgatgatcggcaccgacgccttccaggaagtcgacacctacggcatctctatccccatcaccaaacacaactatctggtcagacatatcgaagaactcccgcaggtcatgagcgatgccttccgcattgcgcaatcaggccgcccaggcccggtgtggatagacattcctaaggatgtgcaaacggcggtttttgagattgaagctcagcccgcggtggcagaaaaagccgctgcacccgcctttagcgaagaaagcattcgtgacgcagctacaatgattaacgctgccaaacgcccggtgctttatctgggtggtggtgtgatcaatgcgcctgcgcgggtgcgtgaactggcggagaaagcgcaactgcctaccaccatgactttaatggcgctgggcatgctgccaaaagcgcatccgttgtcgctgggtatgctggggatgcacggcgtgcgcagcactaactatatcttgcaggaggcggatttactgattgtgctcggtgcgcgttttgatgaccgggcgattggcaaaaccgagcagttctgtccgaatgccaaaatcattcatgtcgatatcgaccgtgcagagctgggtaaaatcaagcagccgcatgtggcgattcaggcggatgttgatgacgtgctggcgcagttgatcccgctggtggaagcgcaaccgcgtgcagagtggcaccagttggtagcggatttgcagcgtgagtttccgtgtccaatcccgaaagcgtgcgatccattaagccattacggcctgatcaacgccgttgccgcctgtgtcgatgacaatgcgattatcaccaccgatgtggggcagcatcagatgtggaccgcgcaagcttatccgctcaatcgcccacgccagtggctgacctccggtgggctgggcacgatgggttttggcctgcctgcggcgattggcgcggcgctggcgaacccggatcgcaaagtgttgtgtttctccggcgacggcagcctgatgatgaatattcaggagatggcgaccgccagtgaaaatcagctggatgtcaaaatcattctgatgaacaacgaagcgctggggctggtgcatcagcaacagagtctgttctacgagcaaggcgtttttgccgccacctatccgggcaaaatcaactttatgcagattgccgccggattcggcctcgaaacctgtgatttgaataacgaagccgatccgcaggctgcattgcaggaaatcatcaatcgccctggcccggcgctgatccatgtgcgcattgatgccgaagaaaaagtttacccgatggtgccgccaggtgcggcgaatactgaaatggtgggggaataa(SEQ ID NO：1), and the ilvN gene sequence is ：atgcaaaacacaactcatgacaacgtaattctggagctcaccgttcgcaaccatccgggcgtaatgacccacgtttgtggcctttttgcccgccgcgcttttaacgttgaaggcattctttgtctgccgattcaggacagcgacaaaagccatatctggctactggtcaatgacgaccagcgtctggagcagatgataagccaaatcgataagctggaagatgtcgtgaaagtgcagcgtaatcagtccgatccgacgatgtttaacaagatcgcggtgttttttcagtaa(SEQ ID NO：2).
In one embodiment, the E.coli acetolactate synthase II is encoded by the ilvGM gene, where the ilvG gene sequence is ：atgaatggcgcacagtgggtggtacatgcgttgcgggcacagggtgtgaataccgttttcggttatccgggtggcgcaattatgccggtttacgatgcattgtatgacggcggcgtggagcacttgctgtgccgacatgaacagggtgcggcaatggcggctatcggttatgcccgtgctactggcaaaactggcgtatgtatcgccacgtctggtccgggcgcaaccaacctgataaccgggcttgcggacgcactgttagattccatccccgttgttgccatcaccggtcaagtgtccgcaccgtttatcggcacggacgcatttcaggaagtggatgtcctgggattgtcgctagcctgtaccaagcacagcttcctggtgcagtcgctggaagagttgccgcgcatcatggctgaagcattcgacgttgccagctcaggtcgtcctggtccggttctggtcgatatcccaaaagatatccaattagccagcggcgacctggaaccgtggttcaccaccgttgaaaacgaagtgactttcccacatgccgaagtcgagcaagcgcgccagatgctggcaaaagcgcaaaaaccgatgctgtacgttggtggtggcgtgggtatggcgcaggcagttcctgctttacgagaatttctcgctaccacaaaaatgcctgccacctgcacgctgaaagggctgggcgcagttgaagcagattatccgtactatctgggcatgctgggaatgcatggcaccaaagcggcgaacttcgcggtgcaggagtgcgacttgctgatcgccgtgggtgcacgttttgatgaccgggtgaccggcaaactgaacaccttcgcaccacacgccagtgttatccatatggatatcgacccggcagaaatgaacaagctgcgtcaggcacatgtggcattacaaggtgatttaaatgctctgttaccagcattacagcagccgttaaatatcaatgactggcagcaacactgcgcgcagctgcgtgatgaacatgcctggcgttacgaccatcccggtgacgctatctacgcgccgttgttgttaaaacaactgtcggatcgtaaacctgcggattgcgtcgtgaccacagatgtggggcagcaccagatgtgggctgcgcagcacatcgcccacactcgcccggaaaatttcatcacctccagcggcttaggtaccatgggttttggtttaccggcggcggttggcgcacaagtcgcgcgaccgaacgataccgttgtctgtatctccggtgacggctctttcatgatgaatgtgcaagagctgggcaccgtaaaacgcaagcagttaccgttgaaaatcgtcttactcgataaccaacggttagggatggttcgacaatggcagcaactgttttttcaggaacgatacagcgaaaccacccttactgataaccccgatttcctcatgttagccagcgccttcggcatccctggccaacacatcacccgtaaagaccaggttgaagcggcactcaacaccatgctgaacagtgatgggccatacctgcttcatgtctcaatcgacgaacttgagaacgtctggccgctggtgccgccaggtgccagtaattcagaaatgttggagaaattatcatga(SEQ ID NO：3), and the ilvM gene sequence is ：atgatgcaacatcaggtcaatgtatcggctcgcttcaatccagaaaccttagaacgtgttttacgcgtggtgcgtcatcgtggtttccacgtctgctcaatgaatatggccgccgccagcgatgcacaaaatataaatatcgaattgaccgttgccagcccacggtcggtcgacttactgtttagtcagttaaataaactggtggacgtcgcacacgttgccatctgccagagcacaaccacatcacaacaaatccgcgcctga(SEQ ID NO：4).
In one embodiment, the E.coli acetolactate synthase III is encoded by the ilvIH gene, wherein the ilvI gene sequence is ：atggagatgttgtctggagccgagatggtcgtccgatcgcttatcgatcagggcgttaaacaagtattcggttatcccggaggcgcagtccttgatatttatgatgcattgcataccgtgggtggtattgatcatgtattagttcgtcatgagcaggcggcggtgcatatggccgatggcctggcgcgcgcgaccggggaagtcggcgtcgtgctggtaacgtcgggtccaggggcgaccaatgcgattactggcatcgccaccgcttatatggattccattccattagttgtcctttccgggcaggtagcgacctcgttgataggttacgatgcctttcaggagtgcgacatggtggggatttcgcgaccggtggttaaacacagttttctggttaagcaaacggaagacattccgcaggtgctgaaaaaggctttctggctggcggcaagtggtcgcccaggaccagtagtcgttgatttaccgaaagatattcttaatccggcgaacaaattaccctatgtctggccggagtcggtcagtatgcgttcttacaatcccactactaccggacataaagggcaaattaagcgtgctctgcaaacgctggtagcggcaaaaaaaccggttgtctacgtaggcggtggggcaatcacggcgggctgccatcagcagttgaaagaaacggtggaggcgttgaatctgcccgttgtttgctcattgatggggctgggggcgtttccggcaacgcatcgtcaggcactgggcatgctgggaatgcacggtacctacgaagccaatatgacgatgcataacgcggatgtgattttcgccgtcggggtacgatttgatgaccgaacgacgaacaatctggcaaagtactgcccaaatgccactgttctgcatatcgatattgatcctacttccatttctaaaaccgtgactgcggatatcccgattgtgggggatgctcgccaggtcctcgaacaaatgcttgaactcttgtcgcaagaatccgcccatcaaccactggatgagatccgcgactggtggcagcaaattgaacagtggcgcgctcgtcagtgcctgaaatatgacactcacagtgaaaagattaaaccgcaggcggtgatcgagactctttggcggttgacgaagggagacgcttacgtgacgtccgatgtcgggcagcaccagatgtttgctgcactttattatccattcgacaaaccgcgtcgctggatcaattccggtggcctcggcacgatgggttttggtttacctgcggcactgggcgtcaaaatggcgttgccagaagaaaccgtggtttgcgtcactggcgacggcagtattcagatgaacatccaggaactgtctaccgcgttgcaatacgagttgcccgtactggtggtgaatctcaataaccgctatctggggatggtgaagcagtggcaggacatgatctattccggccgtcattcacaatcttatatgcaatcgctacccgatttcgtccgtctggcggaagcctatgggcatgtcgggatccagatttctcatccgcatgagctggaaagcaaacttagcgaggcgctggaacaggtgcgcaataatcgcctggtgtttgttgatgttaccgtcgatggcagcgagcacgtctacccgatgcagattcgcgggggcggaatggatgaaatgtggttaagcaaaacggagagaacctga(SEQ ID NO：5), and the ilvH gene sequence (wild-type, without mutations) is ：atgcgccggatattatcagtcttactcgaaaatgaatcaggcgcgttatcccgcgtgattggccttttttcccagcgtggctacaacattgaaagcctgaccgttgcgccaaccgacgatccgacattatcgcgtatgaccatccagaccgtgggcgatgaaaaagtacttgagcagatcgaaaagcaattacacaagctggtcgatgtcttgcgcgtgagtgagttggggcagggcgcgcatgttgagcgggaaatcatgctggtgaaaattcaggccagcggttacgggcgtgacgaagtgaaacgtaatacggaaatattccgtgggcaaattatcgatgtcacaccctcgctttataccgttcaattagcaggcaccagcggtaagcttgatgcatttttagcatcgattcgcgatgtggcgaaaattgtggaggttgctcgctctggtgtggtcggactttcgcgcggcgataaaataatgcgttga(SEQ ID NO：6).
As used herein, L-valine feedback resistant E.coli acetolactate synthase III refers to the elimination of feedback inhibition of L-valine on acetolactate synthase III by mutation.
In one embodiment, L-valine feedback resistant E.coli acetolactate synthase III is encoded by the ilvH gene, wherein the ilvH gene sequence (mutant, containing a mutation that releases feedback inhibition) is ：atgcgccggatattatcagtcttactcgaaaatgaatcagAcgcgttatTccgcgtgattggccttttttcccagcgtggctacaacattgaaagcctgaccgttgcgccaaccgacgatccgacattatcgcgtatgaccatccagaccgtgggcgatgaaaaagtacttgagcagatcgaaaagcaattacacaagctggtcgatgtcttgcgcgtgagtgagttggggcagggcgcgcatgttgagcgggaaatcatgctggtgaaaattcaggccagcggttacgggcgtgacgaagtgaaacgtaatacggaaatattccgtgggcaaattatcgatgtcacaccctcgctttataccgttcaattagcaggcaccagcggtaagcttgatgcatttttagcatcgattcgcgatgtggcgaaaattgtggaggttgctcgctctggtgtggtcggactttcgcgcggcgataaaataatgcgttga(SEQ ID NO：7).
In one embodiment, the Bacillus subtilis (Bacillus subtilis) acetolactate synthase comprises an amino acid sequence ：MLTKATKEQKSLVKNRGAELVVDCLVEQGVTHVFGIPGAKIDAVFDALQDKGPEIIVARHEQNAAFMAQAVGRLTGKPGVVLVTSGPGASNLATGLLTANTEGDPVVALAGNVIRADRLKRTHQSLDNAALFQPITKYSVEVQDVKNIPEAVTNAFRIASAGQAGAAFVSFPQDVVNEVTNTKNVRAVAAPKLGPAADDAISAAIAKIQTAKLPVVLVGMKGGRPEAIKAVRKLLKKVQLPFVETYQAAGTLSRDLEDQYFGRIGLFRNQPGDLLLEQADVVLTIGYDPIEYDPKFWNINGDRTIIHLDEIIADIDHAYQPDLELIGDIPSTINHIEHDAVKVEFAEREQKILSDLKQYMHEGEQVPADWKSDRAHPLEIVKELRNAVDDHVTVTCDIGSHAIWMSRYFRSYEPLTLMISNGMQTLGVALPWAIGASLVKPGEKVVSVSGDGGFLFSAMELETAVRLKAPIVHIVWNDSTYDMVAFQQLKKYNRTSAVDFGNIDIVKYAESFGATGLRVESPDQLADVLRQGMNAEGPVIIDVPVDYSDNINLASDKLPKEFGELMKTKAL(SEQ ID NO：8).
As used herein, the acetohydroxy acid reductase (EC1.1.1.382, EC1.1.1.383, EC1.1.1.86) is a key enzyme responsible for catalyzing acetolactate to produce 2, 3-dihydroxyisovalerate, and commonly used acetohydroxy acid reductase is derived from microorganisms, such as E.coli, corynebacterium glutamicum, bacillus subtilis, and the like. As used herein, having or having enhanced acetohydroxy acid reductase activity means that the strain has or has enhanced acetohydroxy acid reductase activity for converting acetolactate to 2, 3-dihydroxyisovalerate.
In one embodiment, the acetylhydroxy acid reductase isomerase is from Thermacetogenium phaeum. In one embodiment, the acetylhydroxy acid reductase isomerase comprises an amino acid sequence ：MKIYYDQDADLQYLDGKTVAVIGYGSQGHAQSQNLRDSGVKVVVADIPSSENWKKAEEAQFQPLTADEAAREADIIQILVPDEKQAALYRESIAPNLRPGKALVFSHGFNIHFKQIVPPPDVDVFMVAPKGPGHLVRRMYEEGAGVPSLVAVEQDYSGQALNLALAYAKGIGATRAGVIQTTFKEETETDLFGEQAVLCGGITELIRAGFDTLVDAGYQPEIAYFECLHEMKLIVDLIYEGGISTMRYSISDTAEYGDLTRGKRIITEATREEMKKILKEIQDGVFAREWLLENQVGRPVYNALRRKEQNHLIETVGARLRGMMPWLKKKVI(SEQ ID NO：9).
As used herein, dihydroxy-acid dehydratase (EC4.2.1.9) is the key enzyme responsible for catalyzing the conversion of 2, 3-dihydroxyisovalerate to 2-ketoisovalerate. The dihydroxy-acid dehydratase is usually derived from microorganisms, such as Escherichia coli, corynebacterium glutamicum, and Bacillus subtilis. As used herein, having or having enhanced dihydroxy-acid dehydratase activity refers to a strain having or having enhanced dihydroxy-acid dehydratase activity of converting 2, 3-dihydroxyisovalerate to 2-ketoisovalerate.
In one embodiment, the dihydroxy-acid dehydratase comprises an amino acid sequence ：MPKYRSATTTHGRNMAGARALWRATGMTDADFGKPIIAVVNSFTQFVPGHVHLRDLGKLVAEQIEAAGGVAKEFNTIAVDDGIAMGHGGMLYSLPSRELIADSVEYMVNAHCADAMVCISNCDKITPGMLMASLRLNIPVIFVSGGPMEAGKTKLSDQIIKLDLVDAMIQGADPKVSDSQSDQVERSACPTCGSCSGMFTANSMNCLTEALGLSQPGNGSLLATHADRKQLFLNAGKRIVELTKRYYEQNDESALPRNIASKAAFENAMTLDIAMGGSTNTVLHLLAAAQEAEIDFTMSDIDKLSRKVPQLCKVAPSTQKYHMEDVHRAGGVIGILGELDRAGLLNRDVKNVLGLTLPQTLEQYDVMLTQDDAVKNMFRAGPAGIRTTQAFSQDCRWDTLDDDRANGCIRSLEHAYSKDGGLAVLYGNFAENGCIVKTAGVDDSILKFTGPAKVYESQDDAVEAILGGKVVAGDVVVIRYEGPKGGPGMQEMLYPTSFLKSMGLGKACALITDGRFSGGTSGLSIGHVSPEAASGGSIGLIEDGDLIAIDIPNRGIQLQVSDAELAARREAQDARGDKAWTPKNRERQVSFALRAYASLATSADKGAVRDKSKLGG(SEQ ID NO：10).
As used herein, hydroxy acid dehydrogenase (EC 1.1.1.345) is the key enzyme responsible for the last reaction step in the 2-hydroxyisovalerate synthesis pathway, i.e., catalyzing the production of 2-hydroxyisovalerate from 2-ketoisovalerate. As used herein, having or having enhanced hydroxy acid dehydrogenase activity means that the strain has or has enhanced hydroxy acid dehydrogenase activity that catalyzes the production of 2-hydroxyisovalerate from 2-ketoisovalerate.
The hydroxy acid dehydrogenase gene panE used for 2-hydroxyisovalerate synthesis in the current literature is derived from lactococcus lactis and is NADH dependent hydroxy acid dehydrogenase. In addition, the gene encoding 2-dehydropantoic acid 2-reductase (EC 1.1.1.169), which catalyzes a key synthesis step in the calcium pantothenate synthesis pathway that is widely present in nature, is also called panE, and the protein encoded by this gene is NADPH-dependent.
The inventors found that: panE, which is noted to be useful for calcium pantothenate synthesis rather than 2-hydroxyisovalerate synthesis, is capable of playing a very good role in 2-hydroxyisovalerate synthesis. The novel hydroxy acid dehydrogenase which can be used for biosynthesis of 2-hydroxyisovalerate is derived from Burkholderia (Burkholderia seminalis), and comprises the amino acid sequence ：MQIAILGAGAMGSFFGGRLALAGHSVSLLDIDEAHLASIRAHGLRLSTDSGEQVVRNLVALRPEDAGKPVDLVIVFTKTMHTTAALAAASAVLGSDTVILSLQNGLGNAERLARSVSSDRIMVGVTTWPADKSEPGAVRSHGQGTIRLMSVNGAHTSALEQTVQALNDAGLSCHVDPDVWAAIWEKVAFNAALNSLCAVTQCMVGELTNTPDGEELALKIVAEVMAVARALGISATEEHVVSNVRDALAHHRTHRPSMLQDVLAGRRTEIEAINGAVVEAARKVGVEVPYTNSLACLVRLVDARARQSDGATARH(SEQ ID NO：11). the present invention designates the novel gene which codes for panE which can be used for 2-hydroxyisovalerate synthesis as panE8 which codes for a protein (SEQ ID NO: 11) which has only 31% amino acid homology with the reported panE from lactococcus lactis for 2-hydroxyisovalerate synthesis and is therefore a completely different novel hydroxy acid dehydrogenase.
As used herein, propionic acid kinase (EC 2.7.2.15) is responsible for catalyzing the production of propionate from propionyl phosphate, encoded by the tdcD gene. In one embodiment, the tdcD gene comprises ：atgaatgaatttccggttgttttggttattaactgtggttcgtcttcgattaagttttccgtactcgatgccagcgactgtgaagtattaatgtcaggtattgccgacggtattaactcggaaaatgcattcttatccgtaaatgggggagagccagcaccgctggctcaccacagctacgaaggtgcattgaaggcaattgcatttgaactggaaaaacggaatttaaatgacagcgtggccttaattggccaccgcatcgctcacggcggcagtatttttaccgagtccgccattattaccgatgaagtcattgataatatccgtcgcgtttctccactggcacccctgcataattacgccaatttaagtggtattgaatcggcgcagcaattatttccgggcgtaactcaggtggcggtatttgataccagtttccaccagacgatggctccggaagcttatttatacggcctgccgtggaaatattatgaagagttaggtgtacgccgttatggtttccacggcacgtcgcaccgctatgtttcccagcgcgcacattcgctgctgaatctggcggaagatgactccggcctggttgtggcgcatcttggcaatggcgcgtcaatctgcgcggttcgcaacggtcagagtgttgatacttcaatgggaatgacgccgctggaaggcttgatgatgggtacccgcagtggcgatgtcgactttggtgcgatgtcctgggtcgccagccaaaccaaccagagcctgggtgacctggaacgcgtagtgaataaagagtcgggattattaggtatttccggtctttcttcggatttacgtgttctggaaaaagcctggcatgaaggtcacgaacgcgcgcaactggcaattaaaacctttgttcaccgaattgcccgtcatattgccggacacgcagcttcattacgtcgcctggatggaattatattcaccggcggaataggagagaattcaagtttaattcgtcgtctggtcatggaacatttggctgtattaggcgtagtgattgatacagaaatgaataatcgatctaactcttttggagagcgaattgtttccagtgaaaatgcgcgtgtcatttgtgccgttattccgactaacgaagaaaaaatgattgctttggatgccattcatttaggcaaagttaacgcgcccgcagaatttgcataa(SEQ ID NO：76).
As used herein, an alcohol dehydrogenase (EC 1.1.1.1) is responsible for catalyzing the production of ethanol from acetaldehyde, encoded by the adhE gene. In one embodiment, the adhE gene comprises ：atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtaaaaaaagcccagcgtgaatatgccagtttcactcaagagcaagtagacaaaatcttccgcgccgccgctctggctgctgcagatgctcgaatcccactcgcgaaaatggccgttgccgaatccggcatgggtatcgtcgaagataaagtgatcaaaaaccactttgcttctgaatatatctacaacgcctataaagatgaaaaaacctgtggtgttctgtctgaagacgacacttttggtaccatcactatcgctgaaccaatcggtattatttgcggtatcgttccgaccactaacccgacttcaactgctatcttcaaatcgctgatcagtctgaagacccgtaacgccattatcttctccccgcacccgcgtgcaaaagatgccaccaacaaagcggctgatatcgttctgcaggctgctatcgctgccggtgctccgaaagatctgatcggctggatcgatcaaccttctgttgaactgtctaacgcactgatgcaccacccagacatcaacctgatcctcgcgactggtggtccgggcatggttaaagccgcatacagctccggtaaaccagctatcggtgtaggcgcgggcaacactccagttgttatcgatgaaactgctgatatcaaacgtgcagttgcatctgtactgatgtccaaaaccttcgacaacggcgtaatctgtgcttctgaacagtctgttgttgttgttgactctgtttatgacgctgtacgtgaacgttttgcaacccacggcggctatctgttgcagggtaaagagctgaaagctgttcaggatgttatcctgaaaaacggtgcgctgaacgcggctatcgttggtcagccagcctataaaattgctgaactggcaggcttctctgtaccagaaaacaccaagattctgatcggtgaagtgaccgttgttgatgaaagcgaaccgttcgcacatgaaaaactgtccccgactctggcaatgtaccgcgctaaagatttcgaagacgcggtagaaaaagcagagaaactggttgctatgggcggtatcggtcatacctcttgcctgtacactgaccaggataaccaaccggctcgcgtttcttacttcggtcagaaaatgaaaacggcgcgtatcctgattaacaccccagcgtctcagggtggtatcggtgacctgtataacttcaaactcgcaccttccctgactctgggttgtggttcttggggtggtaactccatctctgaaaacgttggtccgaaacacctgatcaacaagaaaaccgttgctaagcgagctgaaaacatgttgtggcacaaacttccgaaatctatctacttccgccgtggctccctgccaatcgcgctggatgaagtgattactgatggccacaaacgtgcgctcatcgtgactgaccgcttcctgttcaacaatggttatgctgatcagatcacttccgtactgaaagcagcaggcgttgaaactgaagtcttcttcgaagtagaagcggacccgaccctgagcatcgttcgtaaaggtgcagaactggcaaactccttcaaaccagacgtgattatcgcgctgggtggtggttccccgatggacgccgcgaagatcatgtgggttatgtacgaacatccggaaactcacttcgaagagctggcgctgcgctttatggatatccgtaaacgtatctacaagttcccgaaaatgggcgtgaaagcgaaaatgatcgctgtcaccaccacttctggtacaggttctgaagtcactccgtttgcggttgtaactgacgacgctactggtcagaaatatccgctggcagactatgcgctgactccggatatggcgattgtcgacgccaacctggttatggacatgccgaagtccctgtgtgctttcggtggtctggacgcagtaactcacgccatggaagcttatgtttctgtactggcatctgagttctctgatggtcaggctctgcaggcactgaaactgctgaaagaatatctgccagcgtcctaccacgaagggtctaaaaatccggtagcgcgtgaacgtgttcacagtgcagcgactatcgcgggtatcgcgtttgcgaacgccttcctgggtgtatgtcactcaatggcgcacaaactgggttcccagttccatattccgcacggtctggcaaacgccctgctgatttgtaacgttattcgctacaatgcgaacgacaacccgaccaagcagactgcattcagccagtatgaccgtccgcaggctcgccgtcgttatgctgaaattgccgaccacttgggtctgagcgcaccgggcgaccgtactgctgctaagatcgagaaactgctggcatggctggaaacgctgaaagctgaactgggtattccgaaatctatccgtgaagctggcgttcaggaagcagacttcctggcgaacgtggataaactgtctgaagatgcattcgatgaccagtgcaccggcgctaacccgcgttacccgctgatctccgagctgaaacagattctgctggatacctactacggtcgtgattatgtagaaggtgaaactgcagcgaagaaagaagctgctccggctaaagctgagaaaaaagcgaaaaaatccgcttaa(SEQ ID NO：77).
As used herein, formate acetyl transferase (EC 2.3.1.54) is responsible for catalyzing pyruvate to formate and acetyl coa, encoded by the tdcE gene. In one embodiment, the tdcE gene comprises a sequence ：atgaaggtagatattgataccagcgataagctgtacgccgacgcatggcttggctttaaaggtacggactggaaaaacgaaattaatgtccgcgattttattcaacataactatacaccgtatgaaggcgatgaatctttcctcgccgaagcgacgcctgccaccacggaattgtgggaaaaagtaatggaaggcatccgtatcgaaaatgcaacccacgcgccggttgatttcgataccaatattgccaccacaattaccgctcatgatgcgggatatattaaccagccgctggaaaaaattgttggcctgcaaacggatgcgccgttgaaacgtgcgctacacccgttcggtggcattaatatgattaaaagttcattccacgcctatggccgagaaatggacagtgaatttgaatatctgtttaccgatctgcgtaaaacccataaccagggcgtatttgatgtttactcaccggatatgctgcgctgccgtaaatctggcgtactgaccggtttaccagatggttatggacgtgggcgcattatcggtgactatcgccgcgtagcgctgtatggcattcgttatctggtgcgtgaacgcgaactgcaatttgccgatctccagtctcgtctggaaaaaggcgaggatctggaagccaccatccgtctgcgtgaggagctggcagagcatcgtcatgcgctgttgcagattcaggaaatggcggcgaaatatggctttgatatctctcgcccggcgcagaatgcgcaggaagcggtgcagtggctctacttcgcttatctggcggcagtgaaatcacagaacggcggcgcgatgtcgctggggcgcacggcatcgttcctcgatatctacattgaacgcgactttaaagcaggcgtactcaatgagcagcaggcacaggaactgatcgatcacttcattatgaagatccgtatggtgcgcttcttgcgtacgccggaatttgattcgctgttctccggcgacccaatctgggcgacggaagtgatcggcgggatggggctggacggtcgtacgctggtgaccaaaaactccttccgctatttgcacaccctgcacactatggggccggcaccggagcctaacctgaccattctttggtcggaagaattaccgattgccttcaaaaaatatgccgcgcaggtgtcgatcgtcacctcttccttgcagtatgaaaatgacgatctgatgcgtactgacttcaacagcgacgattacgcgattgcctgctgcgtcagcccaatggtgattggtaagcaaatgcagttctttggtgcacgcgctaacctggcgaaaacgctgctctacgcaattaacggcggggtggacgagaagctgaagattcaggtcgggccgaaaacagcaccgctgatggacgacgtgctggattacgacaaagtgatggacagcctcgatcacttcatggactggctggcggtgcagtacatcagcgcactgaatatcattcactacatgcacgacaagtacagctacgaagcttcgctgatggcgctgcacgatcgtgatgtctatcgcactatggcatgcggcatcgcgggcctgtcggtggcgacggactccctgtctgccatcaaatatgcccgcgtgaaaccaatccgtgacgaaaacggcctggcggtggactttgaaatcgacggtgaatatccgcagtacggcaacaacgacgagcgcgtagacagcattgcctgcgacctggttgaacgctttatgaagaaaattaaagcgctgccaacctatcgcaacgccgtccctacccagtcgattctgactatcacttctaacgtggtgtacggccagaaaaccggtaatacgccggacggtcgtcgcgccggaacaccgttcgcgccgggcgctaacccgatgcatggtcgtgaccgcaaaggtgccgtggcctcattgacgtcggtggcgaaactgccgttcacctacgccaaagatgggatctcgtacaccttctcaatcgttcctgcggcgctgggcaaagaagatccagtacgtaaaaccaaccttgtcggcctgctggatgggtatttccaccacgaagcggatgtcgaaggcggtcaacacctcaacgtcaacgtaatgaatcgggaaatgctgctggatgccatcgagcacccggaaaaatatcctaacctgacaatccgtgtctctggctacgccgtgcgcttcaacgcactgacccgtgaacagcaacaggatgttatttcacgtacctttacccaggcgctctga(SEQ ID NO：78).
As used herein, pyruvate formate lyase (EC 2.3.1.54), responsible for cleaving pyruvate to formate and acetyl coa in the presence of coa, is encoded by the pflB gene. In one embodiment, the pflB gene comprises the sequence ：atgtccgagcttaatgaaaagttagccacagcctgggaaggttttaccaaaggtgactggcagaatgaagtaaacgtccgtgacttcattcagaaaaactacactccgtacgagggtgacgagtccttcctggctggcgctactgaagcgaccaccaccctgtgggacaaagtaatggaaggcgttaaactggaaaaccgcactcacgcgccagttgactttgacaccgctgttgcttccaccatcacctctcacgacgctggctacatcaacaagcagcttgagaaaatcgttggtctgcagactgaagctccgctgaaacgtgctcttatcccgttcggtggtatcaaaatgatcgaaggttcctgcaaagcgtacaaccgcgaactggatccgatgatcaaaaaaatcttcactgaataccgtaaaactcacaaccagggcgtgttcgacgtttacactccggacatcctgcgttgccgtaaatctggtgttctgaccggtctgccagatgcatatggccgtggccgtatcatcggtgactaccgtcgcgttgcgctgtacggtatcgactacctgatgaaagacaaactggcacagttcacttctctgcaggctgatctggaaaacggcgtaaacctggaacagactatccgtctgcgcgaagaaatcgctgaacagcaccgcgctctgggtcagatgaaagaaatggctgcgaaatacggctacgacatctctggtccggctaccaacgctcaggaagctatccagtggacttacttcggctacctggctgctgttaagtctcagaacggtgctgcaatgtccttcggtcgtacctccaccttcctggatgtgtacatcgaacgtgacctgaaagctggcaagatcaccgaacaagaagcgcaggaaatggttgaccacctggtcatgaaactgcgtatggttcgcttcctgcgtactccggaatacgatgaactgttctctggcgacccgatctgggcaaccgaatctatcggtggtatgggcctcgacggtcgtaccctggttaccaaaaacagcttccgtttcctgaacaccctgtacaccatgggtccgtctccggaaccgaacatgaccattctgtggtctgaaaaactgccgctgaacttcaagaaattcgccgctaaagtgtccatcgacacctcttctctgcagtatgagaacgatgacctgatgcgtccggacttcaacaacgatgactacgctattgcttgctgcgtaagcccgatgatcgttggtaaacaaatgcagttcttcggtgcgcgtgcaaacctggcgaaaaccatgctgtacgcaatcaacggcggcgttgacgaaaaactgaaaatgcaggttggtccgaagtctgaaccgatcaaaggcgatgtcctgaactatgatgaagtgatggagcgcatggatcacttcatggactggctggctaaacagtacatcactgcactgaacatcatccactacatgcacgacaagtacagctacgaagcctctctgatggcgctgcacgaccgtgacgttatccgcaccatggcgtgtggtatcgctggtctgtccgttgctgctgactccctgtctgcaatcaaatatgcgaaagttaaaccgattcgtgacgaagacggtctggctatcgacttcgaaatcgaaggcgaatacccgcagtttggtaacaatgatccgcgtgtagatgacctggctgttgacctggtagaacgtttcatgaagaaaattcagaaactgcacacctaccgtgacgctatcccgactcagtctgttctgaccatcacttctaacgttgtgtatggtaagaaaacgggtaacaccccagacggtcgtcgtgctggcgcgccgttcggaccgggtgctaacccgatgcacggtcgtgaccagaaaggtgcagtagcctctctgacttccgttgctaaactgccgtttgcttacgctaaagatggtatctcctacaccttctctatcgttccgaacgcactgggtaaagacgacgaagttcgtaagaccaacctggctggtctgatggatggttacttccaccacgaagcatccatcgaaggtggtcagcacctgaacgttaacgtgatgaaccgtgaaatgctgctcgacgcgatggaaaacccggaaaaatatccgcagctgaccatccgtgtatctggctacgcagtacgtttcaactcgctgactaaagaacagcagcaggacgttattactcgtaccttcactcaatctatgtaa(SEQ ID NO：79).
As used herein, lactate dehydrogenase (EC 1.1.1.28) is responsible for converting pyruvate to D-lactate, encoded by the ldhA gene. In one embodiment, the ldhA gene comprises the sequence ：atgaaactcgccgtttatagcacaaaacagtacgacaagaagtacctgcaacaggtgaacgagtcctttggctttgagctggaattttttgactttctgctgacggaaaaaaccgctaaaactgccaatggctgcgaagcggtatgtattttcgtaaacgatgacggcagccgcccggtgctggaagagctgaaaaagcacggcgttaaatatatcgccctgcgctgtgccggtttcaataacgtcgaccttgacgcggcaaaagaactggggctgaaagtagtccgtgttccagcctatgatccagaggccgttgctgaacacgccatcggtatgatgatgacgctgaaccgccgtattcaccgcgcgtatcagcgtacccgtgacgctaacttctctctggaaggtctgaccggctttactatgtatggcaaaacggcaggcgttatcggtaccggtaaaatcggtgtggcgatgctgcgcattctgaaaggttttggtatgcgtctgctggcgttcgatccgtatccaagtgcagcggcgctggaactcggtgtggagtatgtcgatctgccaaccctgttctctgaatcagacgttatctctctgcactgcccgctgacaccggaaaactaccatctgttgaacgaagccgccttcgatcagatgaaaaatggcgtgatgatcgtcaataccagtcgcggtgcattgattgattctcaggcagcaattgaagcgctgaaaaatcagaaaattggttcgttgggtatggacgtgtatgagaacgaacgcgatctgttctttgaagataaatccaacgacgtgatccaggatgacgtattccgtcgcctgtctgcctgccacaacgtgctgtttaccgggcaccaggcattcctgacagcagaagctctgaccagtatttctcagactacgctgcaaaacttaagcaatctggaaaaaggcgaaacctgcccgaacgaactggtttaa(SEQ ID NO：80).
As used herein, phosphoacetyl transferase (EC 2.3.1.8) is responsible for catalyzing the conversion of acetyl-coa to acetyl-phosphate, encoded by the pta gene. In one embodiment, the pta gene comprises the sequence ：gtgtcccgtattattatgctgatccctaccggaaccagcgtcggtctgaccagcgtcagccttggcgtgatccgtgcaatggaacgcaaaggcgttcgtctgagcgttttcaaacctatcgctcagccgcgtaccggtggcgatgcgcccgatcagactacgactatcgtgcgtgcgaactcttccaccacgacggccgctgaaccgctgaaaatgagctacgttgaaggtctgctttccagcaatcagaaagatgtgctgatggaagagatcgtcgcaaactaccacgctaacaccaaagacgctgaagtcgttctggttgaaggtctggtcccgacacgtaagcaccagtttgcccagtctctgaactacgaaatcgctaaaacgctgaatgcggaaatcgtcttcgttatgtctcagggcactgacaccccggaacagctgaaagagcgtatcgaactgacccgcaacagcttcggcggtgccaaaaacaccaacatcaccggcgttatcgttaacaaactgaacgcaccggttgatgaacagggtcgtactcgcccggatctgtccgagattttcgacgactcttccaaagctaaagtaaacaatgttgatccggcgaagctgcaagaatccagcccgctgccggttctcggcgctgtgccgtggagctttgacctgatcgcgactcgtgcgatcgatatggctcgccacctgaatgcgaccatcatcaacgaaggcgacatcaatactcgccgcgttaaatccgtcactttctgcgcacgcagcattccgcacatgctggagcacttccgtgccggttctctgctggtgacttccgcagaccgtcctgacgtgctggtggccgcttgcctggcagccatgaacggcgtagaaatcggtgccctgctgctgactggcggctacgaaatggacgcgcgcatttctaaactgtgcgaacgtgctttcgctaccggcctgccggtatttatggtgaacaccaacacctggcagacctctctgagcctgcagagcttcaacctggaagttccggttgacgatcacgaacgtatcgagaaagttcaggaatacgttgctaactacatcaacgctgactggatcgaatctctgactgccacttctgagcgcagccgtcgtctgtctccgcctgcgttccgttatcagctgactgaacttgcgcgcaaagcgggcaaacgtatcgtactgccggaaggtgacgaaccgcgtaccgttaaagcagccgctatctgtgctgaacgtggtatcgcaacttgcgtactgctgggtaatccggcagagatcaaccgtgttgcagcgtctcagggtgtagaactgggtgcagggattgaaatcgttgatccagaagtggttcgcgaaagctatgttggtcgtctggtcgaactgcgtaagaacaaaggcatgaccgaaaccgttgcccgcgaacagctggaagacaacgtggtgctcggtacgctgatgctggaacaggatgaagttgatggtctggtttccggtgctgttcacactaccgcaaacaccatccgtccgccgctgcagctgatcaaaactgcaccgggcagctccctggtatcttccgtgttcttcatgctgctgccggaacaggtttacgtttacggtgactgtgcgatcaacccggatccgaccgctgaacagctggcagaaatcgcgattcagtccgctgattccgctgcggccttcggtatcgaaccgcgcgttgctatgctctcctactccaccggtacttctggtgcaggtagcgacgtagaaaaagttcgcgaagcaactcgtctggcgcaggaaaaacgtcctgacctgatgatcgacggtccgctgcagtacgacgctgcggtaatggctgacgttgcgaaatccaaagcgccgaactctccggttgcaggtcgcgctaccgtgttcatcttcccggatctgaacaccggtaacaccacctacaaagcggtacagcgttctgccgacctgatctccatcgggccgatgctgcagggtatgcgcaagccggttaacgacctgtcccgtggcgcactggttgacgatatcgtctacaccatcgcgctgactgcgattcagtctgcacagcagcagtaa(SEQ ID NO：81).
As used herein, acetate kinase (EC 2.7.2.1) is responsible for catalyzing the production of acetate from acetyl phosphate, encoded by the ackA gene. In one embodiment, the ackA gene comprises the sequence ：atgtcgagtaagttagtactggttctgaactgcggtagttcttcactgaaatttgccatcatcgatgcagtaaatggtgaagagtacctttctggtttagccgaatgtttccacctgcctgaagcacgtatcaaatggaaaatggacggcaataaacaggaagcggctttaggtgcaggcgccgctcacagcgaagcgctcaactttatcgttaatactattctggcacaaaaaccagaactgtctgcgcagctgactgctatcggtcaccgtatcgtacacggcggcgaaaagtataccagctccgtagtgatcgatgagtctgttattcagggtatcaaagatgcagcttcttttgcaccgctgcacaacccggctcacctgatcggtatcgaagaagctctgaaatctttcccacagctgaaagacaaaaacgttgctgtatttgacaccgcgttccaccagactatgccggaagagtcttacctctacgccctgccttacaacctgtacaaagagcacggcatccgtcgttacggcgcgcacggcaccagccacttctatgtaacccaggaagcggcaaaaatgctgaacaaaccggtagaagaactgaacatcatcacctgccacctgggcaacggtggttccgtttctgctatccgcaacggtaaatgcgttgacacctctatgggcctgaccccgctggaaggtctggtcatgggtacccgttctggtgatatcgatccggcgatcatcttccacctgcacgacaccctgggcatgagcgttgacgcaatcaacaaactgctgaccaaagagtctggcctgctgggtctgaccgaagtgaccagcgactgccgctatgttgaagacaactacgcgacgaaagaagacgcgaagcgcgcaatggacgtttactgccaccgcctggcgaaatacatcggtgcctacactgcgctgatggatggtcgtctggacgctgttgtattcactggtggtatcggtgaaaatgccgcgatggttcgtgaactgtctctgggcaaactgggcgtgctgggctttgaagttgatcatgaacgcaacctggctgcacgtttcggcaaatctggtttcatcaacaaagaaggtacccgtcctgcggtggttatcccaaccaacgaagaactggttatcgcgcaagacgcgagccgcctgactgcctga(SEQ ID NO：82).
As used herein, methylglyoxal synthase (EC 4.2.3.3) is responsible for converting glycerophosphate to methylglyoxal, encoded by the mgsA gene. In one embodiment, the mgsA gene comprises the sequence ：atggaactgacgactcgcactttacctgcgcggaaacatattgcgctggtggcacacgatcactgcaaacaaatgctgatgagctgggtggaacggcatcaaccgttactggaacaacacgtactgtatgcaacaggcactaccggtaacttaatttcccgcgcgaccggcatgaacgtcaacgcgatgttgagtggcccaatggggggtgaccagcaggttggcgcattgatctcagaagggaaaattgatgtattgattttcttctgggatccactaaatgccgtgccgcacgatcctgacgtgaaagccttgctgcgtctggcgacggtatggaacattccggtcgccaccaacgtggcaacggcagacttcataatccagtcgccgcatttcaacgacgcggtcgatattctgatccccgattatcagcgttatctcgcggaccgtctgaagtaa(SEQ ID NO：83).
As used herein, fumaric acid reductase (EC 1.3.5.1) is involved in the interconversion between fumaric acid and succinic acid, responsible for the conversion of fumaric acid to succinic acid, consisting of four subunits frdA, frdB, frdC and frdD. In one embodiment, the genetically engineered 2-hydroxyisovalerate producing strain of the present invention has weakened or knocked out frdB and frdC genes. In one embodiment, the frdB gene comprises ：atggctgagatgaaaaacctgaaaattgaggtggtgcgctataacccggaagtcgataccgcaccgcatagcgcattctatgaagtgccttatgacgcaactacctcattactggatgcgctgggctacatcaaagacaacctggcaccggacctgagctaccgctggtcctgccgtatggcgatttgtggttcctgcggcatgatggttaacaacgtgccaaaactggcatgtaaaaccttcctgcgtgattacaccgacggtatgaaggttgaagcgttagctaacttcccgattgaacgcgatctggtggtcgatatgacccacttcatcgaaagtctggaagcgatcaaaccgtacatcatcggcaactcccgcaccgcggatcagggtactaacatccagaccccggcgcagatggcgaagtatcaccagttctccggttgcatcaactgtggtctgtgctacgccgcgtgcccgcagtttggcctgaacccagagttcatcggtccggctgccattacgctggcgcatcgttataacgaagatagccgcgaccacggtaagaaggagcgtatggcgcagttgaacagccagaacggcgtatggagctgtactttcgtgggctattgctccgaagtctgcccgaaacacgtcgatccggctgcggccattcagcagggcaaagtagaaagttcgaaagactttcttatcgcgaccctgaaaccacgctaa(SEQ ID NO：84); and/or the frdC gene comprises ：atgacgactaaacgtaaaccgtatgtacggccaatgacgtccacctggtggaaaaaattgccgttttatcgcttttacatgctgcgcgaaggcacggcggttccggctgtgtggttcagcattgaactgattttcgggctgtttgccctgaaaaatggcccggaagcctgggcgggattcgtcgactttttacaaaacccggttattgtgatcattaacctgatcactctggcggcagctctgctgcacaccaaaacctggtttgaactggcaccgaaagcggccaatatcattgtaaaagacgaaaaaatgggtccagagccaattatcaaaagtctctgggcggtaactgtggttgccaccatcgtaatcctgtttgttgccctgtactggtaa(SEQ ID NO：85).
As used herein, the terms "polypeptide," "amino acid sequence," "peptide," and "protein" are used interchangeably herein to refer to an amino acid chain of any length that may comprise modified amino acids and/or may be interrupted by non-amino acids. The term also encompasses amino acid chains modified by natural or human intervention; such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation to a labeling element.
As used herein, the expressions "gene," "nucleic acid sequence," "polynucleotide," and "nucleotide sequence" are used interchangeably to refer to a strand of nucleotides, including DNA and RNA. "expression of a gene" refers to transcription of a DNA region operably linked to an appropriate regulatory region, particularly a promoter, into biologically active RNA and the RNA can be translated into a biologically active protein or peptide.
As used herein, a degenerate sequence refers to a nucleotide sequence that encodes the same amino acid sequence as a specified sequence but differs from the nucleotide sequence due to the degeneracy of the genetic code.
As used herein, the terms "homology", "sequence identity", and the like are used interchangeably herein. Sequence identity can be detected by aligning the number of identical nucleotide bases between the polynucleotide and the reference polynucleotide, e.g., can be determined by standard alignment algorithm procedures using default gap penalties established by each vendor. Whether two nucleic acid molecules have at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical" nucleotide sequences can be determined using known computer algorithms, such as BLASTN, FASTA, DNAStar and Gap (University of Wisconsin Genetics Computer Group (UWG), madison WI, USA). For example, the percent identity of nucleic acid molecules can be determined, for example, by comparing sequence information using the GAP computer program (e.g., NEEDLEMAN ET al.J.mol.biol.48:443 (1970), revised by SMITH AND WATERMAN (adv.appl.Math.2:482 (1981)), briefly, the GAP program defines similarity by dividing the number of symbols (i.e., nucleotides) of similar alignments by the total number of symbols of shorter sequences in the two sequences.
As used herein, "having … … activity" refers to having a detectable activity as compared to a reference (e.g., an initial strain or a wild-type strain) that does not have that activity.
As used herein, "having enhanced … … activity" refers to an increase in activity of at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300% or more as compared to a reference (e.g., an initial strain or wild-type strain) having that activity.
As used herein, "reduced activity or inactivated" refers to a reduction in activity of at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or more, or even 100% compared to a reference activity (e.g., the corresponding activity in the original strain or wild-type strain).
In this context, the reference may be a wild-type microorganism or a microorganism prior to performing the desired genetic manipulation (e.g., the initial microorganism used to perform the genetic manipulation to increase gene activity). The parent microorganism and the original microorganism are used interchangeably herein to refer to a microorganism to which a desired genetic manipulation (e.g., enhancement or attenuation of gene or protein activity) is performed.
The activity of a protein (e.g., an enzyme) may be produced or enhanced by any suitable means known in the art, including, for example, but not limited to, expression or overexpression (e.g., by a vector such as a plasmid) of the corresponding gene encoding the protein in a strain, introduction of a mutation that results in an increase in the activity of the protein, and the like.
The activity of a protein (e.g., an enzyme) may be reduced or inactivated by any suitable means known in the art, including, for example, but not limited to, the use of a attenuated or inactivated corresponding gene encoding the protein, the introduction of mutations that result in reduced or inactivated activity of the protein, the use of antagonists or inhibitors (e.g., antibodies, ligands, etc.) of the protein.
As used herein, "attenuated or inactivated gene" refers to a decrease in activity, e.g., expression level (as a protein-encoding gene) or regulatory performance (as a regulatory element), of a gene by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or more, or even undetectable, as compared to a reference (e.g., the corresponding gene in the original strain or wild-type strain). In the case of a gene encoding a protein, e.g. an enzyme, it is also contemplated that the level of activity of the protein expressed by the gene is reduced, e.g. by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or more, or even 100%, compared to the level of activity of the corresponding protein in the original strain or wild-type strain.
In one aspect, the invention provides a genetically engineered 2-hydroxyisovalerate producing strain having or having enhanced acetolactate synthase, acetohydroxy acid reductase isomerase, dihydroxy acid dehydratase, and hydroxy acid dehydrogenase activities.
In one embodiment, the acetolactate synthase comprises one or more, preferably all, of bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II and L-valine feedback resistant escherichia coli acetolactate synthase III.
In one embodiment, having or having enhanced activity is achieved by expressing or overexpressing a corresponding coding gene in the strain. Thus, in one embodiment, the genetically engineered 2-hydroxyisovalerate producing strain expresses or overexpresses genes encoding bacillus subtilis acetolactate synthase, bacillus coli acetolactate synthase I, bacillus coli acetolactate synthase II, and L-valine feedback resistant bacillus coli acetolactate synthase III, acetohydroxyacid reductase isomerase, dihydroxyacid dehydratase, hydroxyacid dehydrogenase.
In one embodiment, the bacillus subtilis acetolactate synthase comprises the amino acid sequence of SEQ ID NO:8, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and acetolactate synthase activity.
In one embodiment, the E.coli acetolactate synthase I is encoded by an ilvBN gene sequence as shown below, wherein the ilvB gene sequence comprises the sequence of SEQ ID NO:1, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvN gene sequence comprising SEQ ID NO:2, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto.
In one embodiment, the escherichia coli acetolactate synthase II is encoded by an ilvG gene, wherein the ilvG gene sequence comprises the nucleotide sequence of SEQ ID NO:3, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvM gene sequence comprising the nucleotide sequence set forth in SEQ ID NO:4, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto.
In one embodiment, the L-valine feedback resistant escherichia coli acetolactate synthase III is encoded by an ilviii gene, wherein the ilvI gene sequence comprises the nucleotide sequence of SEQ ID NO:5, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and an ilvH gene sequence comprising SEQ ID NO: 7.
In one embodiment, the acetylhydroxy acid reductase isomerase comprises SEQ ID NO:9, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having acetylhydroxy acid reductase activity. In one embodiment, the acetylhydroxy acid reductase isomerase is from Thermacetogenium phaeum.
In one embodiment, the dihydroxy-acid dehydratase comprises the amino acid sequence of SEQ ID NO:10, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and dihydroxy-acid dehydratase activity. In one embodiment, the dihydroxy-acid dehydratase is from E.coli.
In one embodiment, the hydroxy acid dehydrogenase comprises SEQ ID NO:11, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity. In one embodiment, the hydroxy acid dehydrogenase is from Burkholderia (Burkholderia), particularly from Burkholderia seminalis.
In some embodiments, in a genetically engineered 2-hydroxyisovalerate producing strain of the invention, one or more copies of a gene of interest or a homologous gene thereof may be integrated into the genome (e.g., by homologous recombination), optionally at any locus in the genome (as long as such integration does not significantly adversely affect the growth and production of the strain), e.g., one copy of any gene within the genome is replaced with one or more copies of the gene of interest or a homologous gene thereof. Those skilled in the art know how to integrate transgenes and select strains that integrate transgenes.
In one embodiment, the gene encoding acetolactate synthase (e.g., bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II, and/or L-valine feedback resistant escherichia coli acetolactate synthase III), acetohydroxyacid reductase isomerase, dihydroxyacid dehydratase, and/or hydroxyacid dehydrogenase is incorporated into the genome of the genetically engineered 2-hydroxyisovalerate producing strain (e.g., escherichia coli), e.g., at the locus of a propionic acid kinase encoding gene and/or a formate acetyltransferase encoding gene. The coding gene may be under the control of a suitable promoter and/or terminator.
In further embodiments, the one or more genes encoding bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II, and L-valine feedback resistant escherichia coli acetolactate synthase III, acetohydroxyacid reductase isomerase, dihydroxyacid dehydratase, or hydroxyacid dehydrogenase are incorporated at the position of one or more loci in a locus of a gene encoding: (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase, (ix) fumarate reductase.
In a further embodiment, the genetically engineered 2-hydroxyisovalerate producing strain further has at least one of reduced activity or inactivated: (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase, (ix) fumarate reductase.
In one embodiment, the genetically engineered 2-hydroxyisovalerate producing strain has reduced activity or is inactivated phosphoacetyl transferase, acetate kinase, methylglyoxal synthase, and fumaric acid reductase.
In one embodiment, the genetically engineered 2-hydroxyisovalerate producing strain has reduced activity or is inactivated propionic acid kinase, alcohol dehydrogenase, formate acetyltransferase, pyruvate formate lyase, lactate dehydrogenase, phosphate acetyltransferase, acetate kinase, methylglyoxal synthase, and fumarate reductase.
In one embodiment, the genetically engineered 2-hydroxyisovalerate producing strain has reduced activity or is inactivated propionic acid kinase, alcohol dehydrogenase, formate acetyltransferase, pyruvate formate lyase, lactate dehydrogenase, phosphate acetyltransferase, acetate kinase, methylglyoxal synthase, and fumarate reductase.
In one embodiment, the genetically engineered 2-hydroxyisovalerate producing strain has one or more of the genes encoding (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase, and (ix) fumarate reductase attenuated or inactivated.
In one embodiment, one or more of the genes encoding (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase, and (ix) fumarate reductase in the genetically engineered 2-hydroxyisovalerate producing strain are knocked out.
In one embodiment, the genes encoding phosphoacetyltransferase, acetate kinase, methylglyoxal synthase and fumaric acid reductase in the genetically engineered 2-hydroxyisovalerate producing strain are knocked out.
In one embodiment, the genes encoding propionic acid kinase, alcohol dehydrogenase, formate acetyl transferase, pyruvate formate lyase, lactate dehydrogenase, phosphate acetyl transferase, acetate kinase, methylglyoxal synthase, and fumarate reductase in the genetically engineered 2-hydroxyisovalerate producing strain are knocked out.
In a preferred embodiment, the genetically engineered 2-hydroxyisovalerate producing strain is escherichia coli (ESCHERICHIA COLI) deposited at the China general microbiological culture Collection center (CGMCC) of the western Highway 1, no. 3, the Korean area North Star, of Beijing, as deposited at month 6 and 27 of 2022, with a accession number of CGMCC No. 25185.
In one aspect, the invention provides a method of producing a genetically engineered 2-hydroxyisovalerate producing strain comprising enhancing the activity of acetolactate synthase, acetohydroxyacid reductase isomerase, dihydroxyacid dehydratase, and hydroxyacid dehydrogenase in the strain.
In one embodiment, the method comprises enhancing feedback resistance of one or more, preferably all, of bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II and L-valine in the strain.
As used herein, "conferring … … activity" refers to producing in a genetically engineered 2-hydroxyisovalerate producing strain an activity that is not present in the original strain prior to being genetically engineered.
As used herein, "enhancing … … activity" refers to increasing activity, for example by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300% or more.
Various methods are known in the art for conferring or enhancing the activity of a desired protein, including, for example, but not limited to, expression or overexpression of a protein-encoding gene, as well as mutations or other modifications that increase the activity of the protein.
As used herein, "overexpression" refers to an increase in the expression level of a gene relative to the level prior to genetic manipulation, e.g., by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300% or more. Methods of overexpressing genes are well known in the art and include, for example, but are not limited to, the use of strong promoters, increasing gene copy number, enhancers, and the like. Increasing the copy number of a gene may be accomplished, for example, but not limited to, by introducing one or more copies of an exogenous gene or an endogenous gene, for example, by an expression vector or integration into the genome.
As used herein, "exogenous gene" refers to a gene from another cell or organism, such as a gene from the same species or a different species.
As used herein, "endogenous gene" refers to a gene of the cell or organism itself.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding a bacillus subtilis acetolactate synthase comprising the amino acid sequence of SEQ ID NO:8, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and acetolactate synthase activity.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding the ilvBN gene of E.coli acetolactate synthase I, wherein the ilvB gene sequence comprises the sequence of SEQ ID NO:1, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvN gene sequence comprising SEQ ID NO:2, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding the ilvGM gene of E.coli acetolactate synthase II, where the ilvG gene sequence comprises the sequence of SEQ ID NO:3, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvM gene sequence comprising the nucleotide sequence set forth in SEQ ID NO:4, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding an ilvH gene of L-valine feedback resistant E.coli acetolactate synthase III, wherein the ilvH gene sequence comprises the nucleotide sequence of SEQ ID NO: 7.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding an acetylhydroxy acid reductase isomerase comprising the amino acid sequence of SEQ ID NO:9, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having acetylhydroxy acid reductase activity. In one embodiment, the acetylhydroxy acid reductase isomerase is from Thermacetogenium phaeum.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding a dihydroxy-acid dehydratase comprising the amino acid sequence of SEQ ID NO:10, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and dihydroxy-acid dehydratase activity. In one embodiment, the dihydroxy-acid dehydratase is from E.coli.
In one embodiment, the method comprises overexpressing a nucleic acid sequence encoding a hydroxy acid dehydrogenase comprising the amino acid sequence of SEQ ID NO:11, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity. In one embodiment, the hydroxy acid dehydrogenase is from Burkholderia (Burkholderia), particularly from Burkholderia seminalis.
In some embodiments, in a genetically engineered 2-hydroxyisovalerate producing strain of the invention, one or more copies of a gene of interest or a homologous gene thereof may be integrated into the genome (e.g., by homologous recombination), optionally at any locus in the genome (as long as such integration does not significantly adversely affect the growth and production of the strain), e.g., one copy of any gene within the genome is replaced with one or more copies of the gene of interest or a homologous gene thereof. Those skilled in the art know how to integrate transgenes and select strains that integrate transgenes.
In one embodiment, the gene encoding the bacillus subtilis acetolactate synthase is incorporated into the genome of a genetically engineered 2-hydroxyisovalerate producing strain (e.g., e.coli), e.g., at a locus. The gene encoding the bacillus subtilis acetolactate synthase may be placed under the control of a suitable promoter and/or terminator.
The promoter may be selected from any suitable promoter known in the art, including, for example, but not limited to, promoters of other genes such as the FBA1 gene encoding fructose 1, 6-bisphosphate aldolase, the TDH3 gene encoding glyceraldehyde 3-phosphate dehydrogenase, the PDC1 gene encoding pyruvate decarboxylase, the ADH1 gene encoding alcohol dehydrogenase 1, the PGK1 gene encoding 3-phosphoglycerate kinase, the TEF1 gene encoding transcriptional elongation factor, the phosphoglycerate mutase GPM1 gene, the triose phosphate isomerase TPI1 gene and the enolase ENO1 gene, and artificial regulatory sequences such as the M1-93 promoter (TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGTTTAAACCAGGAAACAGCT,SEQ ID NO：12)、RBSL5 promoter (TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGTTTAAACCAGGAGGACTACG,SEQ ID NO：13)、RBSL4 promoter (TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGTTTAAACCAGGAGGGTTCGA,SEQ ID NO：14).
In a further embodiment, the method further comprises inserting one or more of the genes encoding bacillus subtilis acetolactate synthase, escherichia coli acetolactate synthase I, escherichia coli acetolactate synthase II and L-valine feedback resistant escherichia coli acetolactate synthase III, acetohydroxy acid reductase isomerase, dihydroxy acid dehydratase or hydroxy acid dehydrogenase into a strain (e.g., escherichia coli) at a position of one or more of the loci encoding: (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase, (ix) fumarate reductase.
In a further embodiment, the method further comprises weakening or inactivating at least one, preferably all, of the following of the strains: (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase, and (ix) fumarate reductase.
In one embodiment, the method further comprises weakening or inactivating phosphoacetyltransferase, acetate kinase, methylglyoxal synthase, and fumaric acid reductase in the strain.
In one embodiment, the method further comprises weakening or inactivating propionic acid kinase, alcohol dehydrogenase, formate acetyl transferase, pyruvate formate lyase, lactate dehydrogenase, phosphoacetyl transferase, acetate kinase, methylglyoxal synthase, and fumaric acid reductase in the strain.
As used herein, reducing or inactivating the activity of a protein, e.g., an enzyme, refers to reducing the activity of the protein by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or more, or even undetectable. A variety of means for reducing or inactivating are known in the art, including, for example, inhibiting gene expression such as knockdown (e.g., using small interfering RNAs), using weak promoters (when the gene is a polypeptide-encoding gene), and the like; gene knockout, deletion of part or all of the gene or polypeptide sequence; mutating certain sites in the gene or polypeptide, such as the coding sequence or the active domain, to reduce gene expression or to modulate activity or activity of the expression product; and the use of antagonists or inhibitors (e.g., including but not limited to antibodies, interfering RNAs, etc.).
As used herein, attenuating or inactivating a gene refers to reducing the expression level (as a protein encoding gene) or regulatory performance (as a regulatory element) of the gene by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or more, or even undetectable. Various means of attenuating or inactivating genes are known in the art, including, for example, inhibiting gene expression such as knockdown (e.g., using small interfering RNAs), using weak promoters (when the gene is a polypeptide-encoding gene), and the like; gene knockout, deletion of part or all of the gene sequence; some sites in the gene, such as the coding sequence, are mutated to reduce gene expression or regulatory activity or activity of the expression product, etc.
In one embodiment, the method comprises knocking out one or more, preferably all, of the genes encoding (i) propionic acid kinase, (ii) alcohol dehydrogenase, (iii) formate acetyltransferase, (iv) pyruvate formate lyase, (v) lactate dehydrogenase, (vi) phosphoacetyltransferase, (vii) acetate kinase, (viii) methylglyoxal synthase and (ix) fumarate reductase in the strain.
In one embodiment, the method comprises knocking out genes encoding phosphoacetyltransferase, acetate kinase, methylglyoxal synthase and fumaric acid reductase in the strain.
In one embodiment, the method comprises knocking out genes encoding propionic acid kinase, alcohol dehydrogenase, formate acetyl transferase, pyruvate formate lyase, lactate dehydrogenase, phosphoacetyl transferase, acetate kinase, methylglyoxal synthase, and fumarate reductase in the strain.
In a further embodiment, the method further comprises evolutionarily metabolizing the genetically engineered 2-hydroxyisovalerate producing strain and selecting a strain having increased 2-hydroxyisovalerate production.
In one aspect, the present invention provides a method of producing 2-hydroxyisovalerate comprising culturing a genetically engineered 2-hydroxyisovalerate producing strain of the present invention or a genetically engineered 2-hydroxyisovalerate producing strain prepared according to a method of producing a genetically engineered 2-hydroxyisovalerate producing strain of the present invention, optionally comprising isolating and purifying the produced 2-hydroxyisovalerate, under conditions suitable for fermentative production of 2-hydroxyisovalerate.
Conditions for fermentative production of 2-hydroxyisovalerate by fermentation culture of 2-hydroxyisovalerate producing strains are known in the art and include, for example, but are not limited to, pH, temperature, medium composition, fermentation time, etc.
Temperatures for fermentative production of 2-hydroxyisovalerate by 2-hydroxyisovalerate producing strains are known in the art, e.g., about 25-37 ℃, e.g., about 25 ℃, about 26 ℃, about 27 ℃, about 28 ℃, about 29 ℃, about 30 ℃, about 31 ℃, about 32 ℃, about 33 ℃, about 34 ℃, about 35 ℃, about 36 ℃, about 37 ℃. In one embodiment, the 2-hydroxyisovalerate producing yeast strain of the present invention is fermented at 37℃to produce 2-hydroxyisovalerate.
The 2-hydroxyisovalerate producing strains of the present invention may be fermented at a suitable pH as known in the art, for example, a pH of about 6.5 to 7.5. In one embodiment, the 2-hydroxyisovalerate producing strains of the present invention are fermented at a pH of about 7.0 to produce 2-hydroxyisovalerate.
For the production of 2-hydroxyisovalerate, the 2-hydroxyisovalerate producing strains of the present invention may be fermented for a suitable period of time, for example, about 12-96 hours, such as about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 60 hours, about 72 hours, about 96, about 120, about 144, about 168 hours.
In one embodiment, the process for producing 2-hydroxyisovalerate described herein is performed under anaerobic conditions. Anaerobic conditions mean that no gas is introduced during fermentation.
In one aspect, the invention provides the use of a genetically engineered 2-hydroxyisovalerate producing strain of the invention or a genetically engineered 2-hydroxyisovalerate producing strain prepared according to the method of producing a genetically engineered 2-hydroxyisovalerate producing strain of the invention for the production of 2-hydroxyisovalerate, in particular for the production of 2-hydroxyisovalerate under anaerobic conditions.
As shown herein, comprising SEQ ID NO:11 can produce 2-hydroxyisovalerate. Accordingly, in one aspect, the present invention provides a hydroxy acid dehydrogenase which can be used for the production of 2-hydroxyisovalerate or for the preparation of a genetically engineered 2-hydroxyisovalerate producing strain producing 2-hydroxyisovalerate, wherein the hydroxy acid dehydrogenase comprises the amino acid sequence of SEQ ID NO:11 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity. In one embodiment, the hydroxy acid dehydrogenase is from Burkholderia (Burkholderia), particularly from Burkholderia seminalis.
As used herein, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, an optionally included step refers to the presence or absence of that step.
As used herein, the term "about" refers to a range of values that includes the specified value, which one of ordinary skill in the art would reasonably consider to be similar to the specified value. In some embodiments, the term "about" means within standard error of measurement using measurements commonly accepted in the art. In some embodiments, about +/-10% of a particular value.
References herein to "one or more" should be understood to correspondingly disclose specific various combinations, e.g., one or more of A, B, C should be taken to disclose specific A, B, C, AB, AC, BC and ABC, respectively, specific combinations.
The scope of the disclosure herein should be considered to also specifically disclose all possible sub-ranges and individual values within the range. For example, a description of a range from 1 to 6 should be considered to have explicitly disclosed subranges from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within the range, e.g., 1, 2, 3, 4, 5, and 6.
Examples
The invention is further illustrated by the following examples, but any examples or combinations thereof should not be construed as limiting the scope or embodiments of the invention. The scope of the present invention is defined by the appended claims, and the scope of the claims will be apparent to those skilled in the art from consideration of the specification and the common general knowledge in the field. Any modifications or variations of the technical solution of the present invention may be carried out by those skilled in the art without departing from the spirit and scope of the present invention, and such modifications and variations are also included in the scope of the present invention.
The experimental methods used in the following examples are conventional methods unless otherwise specified. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Table 1: the strains and plasmids used in the present invention
Table 2: primers for use in the present invention
/>
/>
Example 1: insertion of acetolactate synthase Gene alsS into ATCC 8739 Strain with the coding gene tdcD for propionic acid kinase and the coding gene tdcE for formate acetyltransferase
Starting from E.coli ATCC 8739, the acetolactate synthase (SEQ ID NO: 8) gene alsS from Bacillus subtilis (Bacillus subtilis, ATCC 23857) was inserted into the chromosomal propionic acid kinase-encoding gene tdcD and the formate acetyltransferase-encoding gene tdcE together with the promoter sequence for alsS expression by means of two-step homologous recombination, as follows:
(1) The primer tdcDE-incs-up/tdcDE-incs-down was used to amplify a 2719bp DNA fragment I for the first step of homologous recombination using pXZ-CS (Tan, et al Appl Environ Microbiol,2013, 79:4838-4844) plasmid DNA as template.
The amplification system is as follows: phusion 5X buffer (NEWENGLAND BIOLABS) 10. Mu.l, dNTPs (10 mM each) 1. Mu.l, DNA template 20ng, primer (10. Mu.M) 2. Mu.l each, phusion High-FIDELITY DNA polymerase (2.5U/. Mu.l) 0.5. Mu.l, distilled water 33.5. Mu.l, total volume 50. Mu.l.
Amplification conditions were 98℃for 2 min (1 cycle) of pre-denaturation; denaturation at 98℃for 10 seconds, annealing at 56℃for 10 seconds, extension at 72℃for 2 minutes (30 cycles); extension at 72℃for 10 min (1 cycle).
The above DNA fragment I was used for the first homologous recombination: the pKD46 plasmid (purchased from the university of U.S. CGSC E.coli collection, CGSC # 7739) was first transformed into E.coli ATCC 8739 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli ATCC 8739 harboring pKD 46.
The electric conversion conditions are as follows: first, preparing an electrotransformed competent cell of E.coli ATCC 8739 harboring the pKD46 plasmid (preparation method according to Power et al, 1988,Nucleic Acids Res 16:6127-6145); mu.l of competent cells were placed on ice, 50ng of DNA fragment I was added, and the mixture was placed on ice for 2 minutes and transferred to a 0.2cm Bio-Rad cuvette. An electroporation apparatus (Bio-Rad Co.) was used, and the electric shock parameter was 2.5kv. 1ml of LB medium was immediately transferred to a cuvette after electric shock, 5 times with blowing, transferred to a test tube, and incubated at 75rpm for 2 hours at 30 ℃. 200. Mu.l of the bacterial liquid was applied to LB plates containing ampicillin (final concentration: 100. Mu.g/ml) and chloramphenicol (final concentration: 34. Mu.g/ml), cultured overnight at 30℃and single colonies were selected for PCR verification, and the primers XZ-tdcDE-up/XZ-tdcDE-down were used, and the correct colony amplification product was a 3615bp fragment, and one correct single colony was selected and designated as S HMBA 001.
(2) The alsS gene was inserted into the S HMBA 001 genome together with the promoter at position tdcDE.
First, a 1796bp DNA fragment II was amplified using the wild-type Bacillus subtilis (Bacillus subtilis-168) genomic DNA (GenBank Accession Number:NC-000964.3) as a template and the primers alsS-M93-up/alsS-tdcDE-down, under the same conditions and in the same manner as described in (1).
In a second step, a 160bp DNA fragment III was amplified using the primers M93-tdcDE-up/M93-alsS-down using genomic DNA of M1-93 (Lu, et al, appl Microbiol Biotechnol,2012, 93:2455-2462) as template, the amplification conditions and system being as described in (1).
And thirdly, performing fusion PCR by using the same amplification conditions and system as those in (1), wherein the DNA template in (1) is replaced by 20ng of fragment II and 20ng of fragment III which are recovered by simultaneous addition of cutting gel, the primer is M93-tdcDE-up/alsS-tdcDE-down, the band 1914bp is amplified, and the DNA fragment for the second step of homologous recombination is obtained after cutting gel recovery. The fusion DNA fragment I was electrotransferred into the S HMBA 001 strain containing pKD 46. The electric conversion conditions are as follows: firstly, preparing an electrotransformation competent cell of S HMBA 001 with a pKD46 plasmid; mu.l of competent cells were placed on ice, 50ng of DNA fragment was added, and the mixture was left on ice for 2 minutes and transferred to a 0.2cm Bio-Rad cuvette. An electroporation apparatus (Bio-Rad Co.) was used, and the electric shock parameter was 2.5kv. 1ml of LB medium was immediately transferred to a cuvette after electric shock, 5 times of shaking, transferred to a test tube, and incubated at 30℃for 4 hours at 75 revolutions. The bacterial liquid was transferred to LB liquid medium (50 ml medium in a 250ml flask) containing 10% sucrose and no sodium chloride, and after culturing for 24 hours, streaked culture was performed on LB solid medium containing 6% sucrose and no sodium chloride. Through PCR verification, the used primer is XZ-tdcDE-up/XZ-tdcDE-down, the correct colony amplification product is 2810bp fragment, and a correct single colony is selected and named as S HMBA 002.
Example 2: regulation of acetolactate synthase gene ilvBN
The expression of the E.coli self acetolactate synthase gene ilvBN is regulated by a two-step homologous recombination method using artificial regulatory elements M1-93 (SEQ ID NO: 12), and the specific steps are as follows:
(1) The primer CS-ilvB-up/CS-ilvB-down was used to amplify a DNA fragment I of 2719bp using pXZ-CS plasmid DNA as template for the first step of homologous recombination. The amplification system and amplification conditions were as described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 002 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 002 harboring pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were selected for PCR verification, and primers ilvB-YZ-up/ilvB-YZ-down were used for verification, the correct PCR product should be 2996bp, and one correct single colony was selected and named S HMBA 003.
(2) A188 bp DNA fragment II was amplified using the genomic DNA of M1-93 (Lu, et al, appl Microbiol Biotechnol,2012, 93:2455-2462) as template and the primer M93-ilvB-up\M 93-ilvB-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 003 under the same electrotransfer conditions and procedures as described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using primers ilvB-YZ-up/ilvB-YZ-down and the correct colony amplified product was a 465bp fragment, and one correct single colony was selected and designated as S HMBA 004.
Example 3: regulation and control of acetolactate synthase gene ilvGM
The expression of the escherichia coli self acetolactate synthase gene ilvGM is regulated by using an artificial regulatory element M1-93 (SEQ ID NO: 12) through a two-step homologous recombination method, and the specific steps are as follows:
(1) The primer CS-ilvG-up/CS-ilvG-down was used to amplify a DNA fragment I of 2719bp using pXZ-CS plasmid DNA as template for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 004 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 004 harboring pKD46, under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were selected for PCR verification, and primers ilvG-YZ-up/ilvG-YZ-down were used for verification, the correct PCR product should be 2993bp, and one correct single colony was selected and named S HMBA 005.
(2) A188 bp DNA fragment II was amplified using the primers M93-ilvG-up/M93-ilvG-down using the genomic DNA plasmid DNA of M1-93 (Lu, et al, appl Microbiol Biotechnol,2012, 93:2455-2462) as template. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA, and the electrotransfer conditions and procedures were identical to those described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using primers ilvG-YZ-up/ilvG-YZ-down and the correct colony amplification product was a 462bp fragment, and a correct single colony was selected and designated as S HMBA 006.
Example 4: mutation of acetolactate synthase Gene ilvH
The feedback inhibition of L-valine is relieved by introducing mutation (SEQ ID NO: 7) into ilvH gene by a two-step homologous recombination method, and the specific steps are as follows:
(1) The primer CS-ilvH-up/CS-ilvH-down was used to amplify a DNA fragment I of 2719bp using pXZ-CS plasmid DNA as template for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 006 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 006 harboring pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were picked for PCR verification, and primers ilvH-mutYZ-up/ilvH-mut-down were used for verification, the correct PCR product should be 3165bp, and one correct single colony was selected and designated as S HMBA 007.
(2) Using the DNA of wild-type E.coli ATCC 8739 as a template, a 467bp DNA fragment II was amplified with the primers ilvH-mut-up/ilvH-mut-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 009, and the electrotransfer conditions and procedures were identical to those described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using primers ilvH-mutYZ-up/ilvH-mut-down and the correct colony amplified product was a 619bp fragment, and one correct single colony was selected and designated as S HMBA 008.
Example 5: integration of the coding Gene kari for Acetylhydroxy acid reductase at the adhE site of the alcohol dehydrogenase Gene
(1) Obtaining the acetylhydroxy acid reductase isomerase. The coding gene kari sequence of the acetyl hydroxy acid reductase (SEQ ID NO: 9) from Thermacetogenium phaeum according to the report (Brinkmann-Chen,S.,Cahn,J.K.B.&Arnold.F.H.,Uncovering rare NADH-preferring ketol-acid reductoisomerases,Metab Eng,2014,26:17-22,doi:10.1016/j.ymben.2014.08.003) of the literature is subjected to codon optimization and chemical synthesis by Nanjing Jinsri Biotechnology Co., ltd. To obtain kari gene, and meanwhile, an artificial regulatory element RBSL5 (SEQ ID NO: 13) is added to kari gene, and RBSL5-kari is synthesized and then inserted into pUC-57 plasmid provided by Nanjing Jinsri Biotechnology Co., ltd. To obtain pUC57-RBSL5-kari. Then, RBSL-kari expression cassette was integrated into the adhE locus of the alcohol dehydrogenase encoding gene in the S HMBA 008 strain by two-step homologous recombination. (2) The primer CS-adhE-up/CS-adhE-down was used to amplify the 2719bp DNA fragment I using pXZ-CS plasmid DNA as template for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 008 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 008 harboring pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were picked for PCR verification, and primers XZ-adhE-up/XZ-adhE-down were used for verification, and the correct PCR product should be 3167bp, and one correct single colony was selected and designated as S HMBA 009.
(3) Using pUC 57-RBSL-kari plasmid DNA from Gene synthesis company as template, 1188bp of DNA fragment II was amplified with primer RBSL 5-adhE-up/kari-adhE-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 009, and the electrotransfer conditions and procedures were identical to those described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using XZ-adhE-up/XZ-adhE-down and the correct colony amplification product was 1636bp fragment, and a correct single colony was selected and designated as S HMBA 010.
Example 6: integration of the ilvD gene encoding dihydroxyacid dehydratase at the pflB site of the gene encoding pyruvate formate lyase
Starting from S HMBA 010, the ilvD expression cassette of the encoding gene ilvD of the dihydroxy-acid dehydratase (SEQ ID NO: 10) from Escherichia coli is integrated into the pflB locus of the encoding gene of pyruvate formate lyase by a two-step homologous recombination method, and the specific steps are as follows:
(1) The primer CS-pflB-up/CS-pflB-down was used to amplify the 2719bp DNA fragment I for the first step of homologous recombination using the pXZ-CS plasmid DNA as a template. The amplification system and amplification conditions were identical to those described in example 1. The DNA fragment I was electrotransferred to S HMBA 010,010.
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 010 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 010 harboring pKD46, under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were selected for PCR verification, and primers XZ-pflB-up600/XZ-pflB-down were used for verification, and the correct PCR product should be 3675bp, and one correct single colony was selected and designated as S HMBA 011.
(2) Using the genomic DNA of E.coli MG1655 (from ATCC, no. 700926) as a template, a 1922bp DNA fragment II was amplified with the primers ilvD-up/ilvD-pflB-down.
Using genomic DNA of M1-93 (Lu, et al, appl Microbiol Biotechnol,2012, 93:2455-2462) as template, a 159bp DNA fragment III was amplified with primer RBSL-pflB-up/RBSL-ilvD-down.
Fusion PCR was performed using the method of fusion PCR described in example 1 (2) and fragments II and III of this example and a fused DNA fragment containing the pflB upstream and downstream homology arm, artificial promoter RBSL4 and ilvD gene was obtained, the fusion PCR primer being RBSL-pflB-up\ilvD-pflB-down, which fragment was used for electrotransformation to S HMBA 011. Electrotransformation conditions and procedures were identical to those described in example 1 for alsS integration at tdcDE position (2). Colony PCR was used to verify the clones using XZ-pflB-up600/XZ-pflB-down and the correct colony amplification product was a 2996bp fragment, and one correct single colony was selected and designated as S HMBA 012.
Example 7: novel hydroxy acid dehydrogenase and integration of lactate dehydrogenase gene ldhA locus on chromosome
The new panE8 gene (coding SEQ ID NO: 11) which can be used for 2-hydroxyisovalerate synthesis is subjected to codon optimization so as to be suitable for expression in escherichia coli, and the codon optimization and gene synthesis are completed by Nanjing Jinsri biotechnology Co. Simultaneously with the synthesis of panE8, an artificial promoter element RBSL was synthesized upstream thereof, and RBSL and panE8 were simultaneously constructed into pUC57-kan plasmid (Kirschner Co.). The RBSL4-panE8 expression cassette was integrated together into the ldhA site on the chromosome by two-step homologous recombination.
PanE8 gene sequence:
ATGCAGATTGCGATTCTGGGTGCGGGTGCGATGGGTAGCTTCTTTGGTGGCCGTCTGGCGCTGGCGGGTCACAGCGTGAGCCTGCTGGACATCGATGAAGCGCACCTGGCGAGCATTCGTGCGCACGGTCTGCGTCTGAGCACCGACAGCGGCGAGCAAGTGGTTCGTAACCTGGTGGCGCTGCGTCCGGAAGATGCGGGCAAGCCGGTTGATCTGGTGATCGTTTTCACCAAAACCATGCACACCACCGCGGCGCTGGCGGCGGCGAGCGCGGTGCTGGGTAGCGATACCGTTATCCTGAGCCTGCAGAACGGTCTGGGTAACGCGGAACGTCTGGCGCGTAGCGTGAGCAGCGACCGTATTATGGTGGGCGTTACCACCTGGCCGGCGGATAAGAGCGAACCGGGTGCGGTTCGTAGCCACGGTCAAGGCACCATCCGTCTGATGAGCGTGAACGGTGCGCACACCAGCGCGCTGGAGCAGACCGTTCAAGCGCTGAACGATGCGGGTCTGAGCTGCCATGTGGACCCGGATGTTTGGGCGGCGATTTGGGAAAAGGTTGCGTTTAACGCGGCGCTGAACAGCCTGTGCGCGGTGACCCAGTGCATGGTTGGCGAGCTGACCAACACCCCGGATGGCGAGGAACTGGCGCTGAAAATCGTTGCGGAAGTGATGGCGGTTGCGCGTGCGCTGGGCATTAGCGCGACCGAGGAACACGTGGTTAGCAACGTGCGTGATGCGCTGGCGCACCACCGTACCCACCGTCCGAGCATGCTGCAGGATGTTCTGGCGGGTCGTCGTACCGAGATCGAAGCGATTAACGGCGCGGTGGTTGAGGCGGCGCGTAAAGTGGGTGTTGAAGTGCCGTACACCAACAGCCTGGCGTGCCTGGTGCGTCTGGTTGACGCGCGTGCGCGTCAAAGCGATGGTGCGACCGCGCGTCACTAA(SEQ ID NO：15)
(1) The primer CS-ldhA-up/CS-ldhA-down was used to amplify the 2719bp DNA fragment I using pXZ-CS plasmid DNA as template for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1). DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 012 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 012 harboring pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were picked for PCR verification, and primers XZ-ldhA-up/XZ-ldhA-down were used for verification, and the correct PCR product should be 3402bp, and one correct single colony was selected and designated as S HMBA 013.
(2) A1137 bp DNA fragment II was amplified using pUC57-kan-RBSL4-panE plasmid DNA supplied by Gene synthesis as a template and primer RBSL-ldhA-up/panE 8-ldhA-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 013 under the same electrotransfer conditions and procedures as described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using XZ-ldhA-up/XZ-ldhA-down and the correct colony amplification product was a 1820bp fragment, and a correct single colony was selected and designated as S HMBA 014.
Example 8: knockout of phosphoacetyltransferase-encoding gene pta and acetate kinase-encoding gene ackA
Starting from S HMBA 014, the coding gene pta of the self phosphoacetyl transferase of the escherichia coli and the coding gene ackA of the acetate kinase are knocked out by a two-step homologous recombination method, and the specific steps are as follows:
(1) A DNA fragment I of 2719bp was amplified using the pXZ-CS plasmid DNA as a template and the primer CS-ackA-up/CS-pta-down for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 006 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 006 harboring pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were picked for PCR verification, and primers XZ-ackA-up/XZ-pta-down were used for verification, the correct PCR product should be 3351bp, and one correct single colony was selected and designated as S HMBA 015.
(2) Using the DNA of wild-type E.coli ATCC 8739 as a template, a 371bp DNA fragment II was amplified with the primer XZ-ackA-up/ackA-del-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 015 under the same electrotransfer conditions and procedures as described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using XZ-ackA-up/XZ-pta-down and the correct colony amplification product was a 732bp fragment, and a correct single colony was selected and designated S HMBA 016.
Example 9: knockout of mgsA of methylglyoxal synthase-encoding gene
Starting from S HMBA 016, the escherichia coli self methylglyoxal synthase gene mgsA is knocked out by a two-step homologous recombination method, and the specific steps are as follows:
(1) The plasmid DNA pXZ-CS is used as a template, and a primer CS-mgsA-up/CS-mgsA-down is used for amplifying a DNA fragment I of 2719bp for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 016 by electrotransformation and then the DNA fragment I was electrotransformed into E.coli S HMBA 016 with pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were selected for PCR verification, primers XZ-mgsA-up/XZ-mgsA-down were used for verification, the correct PCR product should be 3646bp, and one correct single colony was selected and named S HMBA 017.
(2) Using the DNA of wild-type E.coli ATCC 8739 as a template, a 566bp DNA fragment II was amplified with the primers XZ-mgsA-up/mgsA-del-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 017 under the same electrotransfer conditions and procedures as described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using XZ-mgsA-up/XZ-mgsA-down primers and a 1027bp fragment of the correct colony amplification product, and a correct single colony was selected and designated as S HMBA 018.
Example 10: knock-out of the fumaric acid reductase-encoding gene frd
Starting from S HMBA 018, the escherichia coli self fumaric acid reductase gene frd is knocked out by a two-step homologous recombination method, and the specific steps are as follows:
(1) The plasmid DNA pXZ-CS was used as a template, and a DNA fragment I of 2719bp was amplified using the primer CS-frd-up/CS-frd-down for the first step of homologous recombination. The amplification system and amplification conditions were identical to those described in example 1 (1).
DNA fragment I was used for the first homologous recombination: the pKD46 plasmid was first transformed into E.coli S HMBA 018 by electrotransformation, and then the DNA fragment I was electrotransformed into E.coli S HMBA 018 harboring pKD46 under the same electrotransformation conditions and procedures as described in example 1 for alsS integration at position tdcDE (1). Single colonies were selected for PCR verification, and primers XZ-frd-up/XZ-frd-down were used for verification, and the correct PCR product should be 3234bp, and one correct single colony was selected and designated as S HMBA 019.
(2) Using the DNA of the wild-type E.coli ATCC 8739 as a template, a 270bp DNA fragment II was amplified with the primers XZ-frd-up/frd-del-down. The DNA fragment II was used for the second homologous recombination. The DNA fragment II was electrotransferred to strain S HMBA 019 under the same electrotransfer conditions and procedures as described in example 1 for alsS integration at tdcDE (2). Clones were verified by colony PCR using XZ-frd-up/XZ-frd-down and the correct colony amplified product was a 615bp fragment, and a correct single colony was selected and designated as S HMBA 020.
Example 11: fermentative production of 2-hydroxyisovalerate using recombinant strain S HMBA 020
The seed culture medium consisted of the following components (solvent water):
macroelements: glucose 20g/L,NH4H2PO4 0.87g/L、(NH4)2HPO4 2.63g/L、MgSO4·7H2O 0.18g/L、 betaine-HCl 0.15g/L.
Microelements ：FeCl3·6H2O 1.5μg/L、CoCl2·6H2O 0.1μg/L、CuCl2·2H2O 0.1μg/L、ZnCl2 0.1μg/L、Na2MoO4·2H2O 0.1μg/L、MnCl2·4H2O 0.2μg/L,H3BO3 0.05μg/L.
The fermentation medium is mostly identical to the seed medium, except that the glucose concentration is 50g/L.
Anaerobic fermentation of S HMBA 020 comprises the following steps:
(1) Seed culture: fresh clones on LB plates were inoculated into tubes containing 4ml of seed medium and incubated overnight at 37℃with shaking at 250 rpm. Then, the culture was transferred to a 250ml Erlenmeyer flask containing 30ml of the seed medium in an inoculum size of 2% (V/V), and the culture was shake-cultured at 37℃and 250rpm for 12 hours to obtain a seed culture solution for fermentation medium inoculation.
(2) Fermentation culture: the volume of the fermentation medium in the 500ml anaerobic tank is 250ml, the seed culture solution is inoculated to the fermentation medium according to the inoculation amount with the final concentration of OD550 = 0.1, and the fermentation medium is obtained after fermentation for 6 days at 37 ℃ and 150 rpm. The neutralizing agent is 5M sodium hydroxide, so that the pH of the fermentation tank is controlled at 7.0. The fermentation liquor is all substances in the fermentation tank. No gas was introduced during the culture.
The analysis method comprises the following steps: the components of the fermentation broth were determined using an Agilent-1260 high performance liquid chromatograph for 6 days of fermentation. Glucose and organic acid concentrations in the fermentation broth were measured using an Aminex HPX-87H organic acid analytical column from Berle (Biorad).
The result shows that: the S HMBA strain is fermented for 6 days under anaerobic condition, 4.5g/l 2-hydroxyisovalerate can be produced, and the sugar acid conversion rate is 0.65mol/mol. As shown in FIG. 1, FIG. A shows a standard of 2-hydroxyisovalerate and FIG. B shows a fermentation broth of S HMBA.
Example 12: construction of recombinant Strain S HMBA 023
Starting from S HMBA 020, the cell growth and the productivity of 2-hydroxyisovalerate were increased simultaneously by evolutionary metabolism.
The evolutionary metabolic process used a 500ml fermenter with a fermentation medium of 250ml. The pH of the fermenter was controlled at 7.0 using 5M sodium hydroxide as a neutralizing agent. The composition and formulation of the fermentation medium used for the evolutionary metabolism were as described for the fermentation medium in example 12. Every 24 hours, the broth was transferred to a new fermenter to an initial OD550 of 0.1. Through 150 generations of evolution, the strain S HMBA 023 (figure 2) (preserved in China general microbiological culture Collection center (CGMCC) of Beijing, china) with the preservation number of CGMCC No.25185 is obtained.
Example 13: production of 2-hydroxyisovalerate by fermentation of recombinant Strain S HMBA 023 in 500mL fermenters
The composition and formulation of the seed medium were the same as described in example 12.
The fermentation was carried out in 500mL fermentors with 250mL fermentation medium. The fermentation medium is basically the same as the seed medium except that the glucose concentration is 60g/L and the neutralizing agent is 5M ammonia water to control the pH of the fermenter to 7.0.
The result shows that: after S HMBA 023 is fermented for 48 hours, the yield of the 2-hydroxy isovaleric acid reaches 20.5g/L, the yield reaches 0.7mol/mol, and no impurity such as mixed acid is generated.
Example 14: fermenting recombinant strain S HMBA 023 in 5L fermenter to produce 2-hydroxy isovaleric acid
The composition and formulation of the seed medium and the assay were the same as described in example 12. The fermentation medium is essentially the same as the seed medium, except that the glucose concentration is 70g/L.
The fermentation was performed anaerobically in a 5L fermenter (Shanghai Baoxing, BIOTECH-5 BG) comprising the steps of:
(1) Seed culture: seed culture medium in 500ml triangular flask is 150ml, and 115 ℃ sterilization 15min. After cooling, recombinant E.coli S HMBA 023,023 was inoculated in an inoculum size of 1% (V/V) to a seed medium, and cultured at 37℃and 100rpm for 12 hours to obtain a seed solution for fermentation medium inoculation.
(2) Fermentation culture: the volume of the fermentation medium in 5L is 3L, and the fermentation medium is sterilized at 115 ℃ for 25min. The seed solution was inoculated to a fermentation medium in an inoculum size of a final concentration of od550=0.2, anaerobic cultured at 37℃for 3 days, and stirred at 200rpm to obtain a fermentation broth. The fermentation liquor is all substances in the fermentation tank. The culture process did not have any gas.
The result shows that: after S HMBA and 023 are fermented for 60 hours, the yield of the 2-hydroxyisovaleric acid reaches 30g/L, the yield reaches 0.72mol/mol, and no impurity such as mixed acid is generated (about 1g/L of succinic acid is generated). As shown in FIG. 3, FIG. A shows a standard of 2-hydroxyisovalerate and FIG. B shows a fermentation broth of S HMBA 023.3.

Claims (11)

1. A genetically engineered 2-hydroxyisovalerate producing strain having enhanced acetolactate synthase, acetohydroxyacid reductase isomerase, dihydroxyacid dehydratase and hydroxyacid dehydrogenase activities,
Preferably, the acetolactate synthase is selected from one or more, preferably all, of bacillus subtilis (Bacillus subtilis) acetolactate synthase, escherichia coli (ESCHERICHIA COLI) acetolactate synthase I, escherichia coli acetolactate synthase II and L-valine feedback resistant escherichia coli acetolactate synthase III.
2. The genetically engineered 2-hydroxyisovalerate producing strain of claim 1 further having reduced activity or being inactivated:
(i) Propionic acid kinase, and/or
(Ii) Formate acetyltransferase, and/or
(Iii) Alcohol dehydrogenase, and/or
(Iv) Pyruvate formate lyase, and/or
(V) Lactate dehydrogenase, and/or
(Vi) Phosphoacetyltransferase, and/or
(Vii) Acetate kinase, and/or
(Viii) Methylglyoxal synthase, and/or
(Ix) Fumaric acid reductase.
3. The genetically engineered 2-hydroxyisovalerate producing strain of claim 1 or 2 having:
(i) An overexpressed nucleic acid sequence encoding a bacillus subtilis acetolactate synthase, preferably comprising the nucleic acid sequence of SEQ ID NO:8 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and acetolactate synthase activity, and/or
(Ii) The overexpressed nucleic acid sequence encoding E.coli acetolactate synthase I, preferably the ilvB gene sequence encoding said E.coli acetolactate synthase I comprises the sequence of SEQ ID NO:1 or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvN gene sequence comprising SEQ ID NO:2, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or
(Iii) The overexpressed nucleic acid sequence encoding E.coli acetolactate synthase II, preferably the ilvG gene sequence encoding said E.coli acetolactate synthase II comprises the sequence of SEQ ID NO:3 or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvM gene sequence comprising the nucleotide sequence set forth in SEQ ID NO:4, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or
(Iv) The nucleic acid sequence encoding L-valine feedback resistant E.coli acetolactate synthase III is overexpressed, preferably the ilvH gene sequence encoding said L-valine feedback resistant E.coli acetolactate synthase III comprises the sequence as set forth in SEQ ID NO:7, and/or
(V) The overexpressed nucleic acid sequence encoding an acetylhydroxy acid reductase isomerase, preferably comprising a nucleic acid sequence as set forth in SEQ ID NO:9 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having acetylhydroxy acid reductase activity, and/or
(Vi) The nucleic acid sequence encoding an overexpressed dihydroxy-acid dehydratase, preferably the dihydroxy-acid dehydratase comprises the nucleic acid sequence as set forth in SEQ ID NO:10 or an amino acid sequence thereof having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity and having dihydroxy-acid dehydratase activity, and/or
(Vii) The overexpressed nucleic acid sequence encoding a hydroxy acid dehydrogenase, preferably the hydroxy acid dehydrogenase comprises the nucleic acid sequence of SEQ ID NO:11 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity, and/or
(Viii) Endogenous propionic acid kinase-encoding genes are knocked out, and/or
(Ix) Endogenous genes encoding alcohol dehydrogenases are knocked out, and/or
(X) Endogenous formate acetyltransferase-encoding genes are knocked out, and/or
(Xi) Endogenous genes encoding pyruvate formate lyase are knocked out, and/or
(Xii) Endogenous lactate dehydrogenase-encoding genes are knocked out, and/or
(Xiii) Endogenous phosphoacetyl transferase-encoding genes are knocked out, and/or
(Xiv) Endogenous acetate kinase-encoding genes are knocked out, and/or
(Xv) Endogenous methylglyoxal synthase-encoding genes are knocked out, and/or
(Xvi) The endogenous gene encoding fumaric acid reductase was knocked out.
4. A genetically engineered 2-hydroxyisovalerate producing strain according to any one of claims 1 to 3, wherein the 2-hydroxyisovalerate producing strain is selected from the group consisting of Escherichia, enterobacter, corynebacterium glutamicum (Corynebacterium glutamicum) and yeast, preferably Escherichia coli, more preferably the genetically engineered 2-hydroxyisovalerate producing strain is Escherichia coli deposited at the chinese microbiological bacterial collection center (CGMCC) of beijing, china with accession number CGMCC No. 25185.
5. A method of producing a genetically engineered 2-hydroxyisovalerate producing strain comprising enhancing the activity of acetolactate synthase, acetohydroxy acid reductase, dihydroxy acid dehydratase and hydroxy acid dehydrogenase in said strain, preferably said acetolactate synthase is selected from one or more, preferably all, of bacillus subtilis acetolactate synthase, e.coli acetolactate synthase I, e.coli acetolactate synthase II and L-valine feedback resistant e.coli acetolactate synthase III.
6. The method of claim 5, further comprising weakening or inactivating the strain:
(i) Propionic acid kinase, and/or
(Ii) Alcohol dehydrogenase, and/or
(Iii) Formate acetyltransferase, and/or
(Iv) Pyruvate formate lyase, and/or
(V) Lactate dehydrogenase, and/or
(Vi) Phosphoacetyltransferase, and/or
(Vii) Acetate kinase, and/or
(Viii) Methylglyoxal synthase, and/or
(Ix) Fumaric acid reductase.
7. The method of claim 5 or 6, comprising: in the 2-hydroxyisovalerate producing strain,
(I) Overexpression of a nucleic acid sequence encoding a bacillus subtilis acetolactate synthase, preferably the bacillus subtilis acetolactate synthase comprises the nucleotide sequence of SEQ ID NO:8 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and acetolactate synthase activity, and/or
(Ii) Overexpression of a nucleic acid sequence encoding E.coli acetolactate synthase I, preferably an ilvBN gene sequence encoding E.coli acetolactate synthase I, wherein the ilvB gene sequence comprises the sequence of SEQ ID NO:1, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvN gene sequence comprising SEQ ID NO:2, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or
(Iii) Overexpression of a nucleic acid sequence encoding E.coli acetolactate synthase II, preferably an ilvGM gene sequence encoding E.coli acetolactate synthase II, wherein the ilvG gene sequence comprises the sequence of SEQ ID NO:3, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or an ilvM gene sequence comprising the nucleotide sequence set forth in SEQ ID NO:4, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto, and/or
(Iv) Overexpression of a nucleic acid sequence encoding L-valine feedback resistant E.coli acetolactate synthase III, preferably an ilvH gene sequence encoding L-valine feedback resistant E.coli acetolactate synthase III, wherein the ilvH gene sequence comprises the sequence of SEQ ID NO:7, and/or
(V) Overexpression of a nucleic acid sequence encoding an acetylhydroxy acid reductase isomerase, preferably the acetylhydroxy acid reductase isomerase comprises a nucleotide sequence as set forth in SEQ ID NO:9 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having acetylhydroxy acid reductase activity, and/or
(Vi) Overexpression of a nucleic acid sequence encoding a dihydroxy-acid dehydratase, preferably the dihydroxy-acid dehydratase comprises the nucleic acid sequence as set forth in SEQ ID NO:10 or an amino acid sequence thereof having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity and having dihydroxy-acid dehydratase activity, and/or
(Vii) Overexpression of a nucleic acid sequence encoding a hydroxy acid dehydrogenase, preferably the hydroxy acid dehydrogenase comprises the nucleic acid sequence of SEQ ID NO:11 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity, and/or
(Viii) Knocking out endogenous gene encoding propionic acid kinase, and/or
(Ix) Knocking out endogenous genes encoding alcohol dehydrogenases, and/or
(X) Knocking out endogenous genes encoding formate acetyltransferase, and/or
(Xi) Knocking out endogenous genes encoding pyruvate formate lyase, and/or
(Xii) Knocking out endogenous genes encoding lactate dehydrogenase, and/or
(Xiii) Knocking out endogenous genes encoding phosphoacetyl transferase, and/or
(Xiv) Knocking out endogenous acetate kinase-encoding genes, and/or
(Xv) Knocking out endogenous genes encoding methylglyoxal synthase, and/or
(Xvi) The endogenous gene encoding fumaric acid reductase is knocked out.
8. The method of any one of claims 5-7, wherein the 2-hydroxyisovalerate producing strain is selected from the group consisting of escherichia, enterobacter, corynebacterium glutamicum and yeast, preferably escherichia coli.
9. A method for producing 2-hydroxyisovalerate comprising culturing the genetically engineered 2-hydroxyisovalerate producing strain of any one of claims 1 to 4 or prepared according to the method of any one of claims 5to 8, optionally comprising isolating and purifying the produced 2-hydroxyisovalerate.
10. Use of a genetically engineered 2-hydroxyisovalerate producing strain according to any one of claims 1 to 4 or prepared according to the method of any one of claims 5 to 8 for the production of 2-hydroxyisovalerate.
11. Use of a hydroxy acid dehydrogenase for the production of 2-hydroxyisovalerate or for the preparation of a genetically engineered 2-hydroxyisovalerate producing strain for the production of 2-hydroxyisovalerate, wherein the hydroxy acid dehydrogenase comprises the amino acid sequence of SEQ ID NO:11 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity thereto and having hydroxy acid dehydrogenase activity.
CN202211328428.XA 2022-10-27 2022-10-27 Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria Pending CN117946950A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211328428.XA CN117946950A (en) 2022-10-27 2022-10-27 Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211328428.XA CN117946950A (en) 2022-10-27 2022-10-27 Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria

Publications (1)

Publication Number Publication Date
CN117946950A true CN117946950A (en) 2024-04-30

Family

ID=90798538

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211328428.XA Pending CN117946950A (en) 2022-10-27 2022-10-27 Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria

Country Status (1)

Country Link
CN (1) CN117946950A (en)

Similar Documents

Publication Publication Date Title
Zhang et al. Production of L-alanine by metabolically engineered Escherichia coli
Zhou et al. Functional replacement of the Escherichia coli D-(−)-lactate dehydrogenase gene (ldhA) with the L-(+)-lactate dehydrogenase gene (ldhL) from Pediococcus acidilactici
WO2007140816A1 (en) Glycolic acid production by fermentation from renewable resources
KR101616171B1 (en) Use of monascus in organic acid production
WO2013112939A2 (en) Methods for succinate production
CN113278568B (en) Recombinant escherichia coli for producing L-valine and application thereof
RU2422526C2 (en) METHOD OF PRODUCING SUCCINIC ACID WITH USING Yarrowia YEAST
CN114457123B (en) Recombinant microorganism for producing L-valine as well as construction method and application thereof
EP3020802B1 (en) Recombinant escherichia coli generated d-lactic acid, and use thereof
KR20130114079A (en) Use of inducible promoters in the production of glycolic acid
JP5698655B2 (en) Coryneform bacterial transformant and method for producing isobutanol using the same
CN113278641A (en) Recombinant escherichia coli for producing L-valine, construction method and application thereof
KR20150121789A (en) Recombinant microorganism having enhanced butanediol producing ability and method for producing butanediol using the same
WO2019159011A2 (en) Microorganisms and processes for lactic acid production
US11098381B2 (en) Materials and methods for controlling regulation in biosynthesis in species of the genera Ralstonia or Cupriavidus and organisms related thereto
JP2014023528A (en) Modified microorganism and method for producing 1,4-butanediol using it
CN116064352A (en) Construction method and application of Klebsiella engineering bacteria for high yield of 1, 3-propanediol
JP4927297B2 (en) Method for producing ethanol using recombinant coryneform bacteria
CN117946950A (en) Novel dehydrogenase for producing 2-hydroxyisovalerate and construction and application of 2-hydroxyisovalerate engineering bacteria
US10006008B2 (en) Recombinant microorganism having enhanced ability to produce 2,3-butanediol and method for producing 2,3-butanediol using same
CN114015634B (en) Recombinant escherichia coli for high yield of succinic acid and construction method and application thereof
WO2024124711A1 (en) Method for constructing l-valine-producing strain, l-valine-producing strain, and use thereof
US12031122B2 (en) Recombinant bacterial cells and methods for producing poly(3-hydroxybutyrate-co-3-hydroxyvalerate)
WO2023246071A1 (en) Mrec mutant and use thereof in l-valine fermentative production
US12031123B2 (en) Recombinant bacterial cells and methods for producing poly(3-hydroxybutyrate-co-3-hydroxyvalerate)

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication