CN117925840A - Use of SLFN11 in prediction of CGT-ODN therapeutic effect on cancer - Google Patents

Abstract

The invention discloses an application of SLFN11 in predicting the curative effect of CGT-ODN treatment on cancers, provides an application of a reagent for detecting SLFN11 in a sample in preparing a product for predicting the curative effect of CGT-ODN treatment on cancers, also provides a product corresponding to the application, further provides an application of SLFN11 in preparing a system for parting cancers and a corresponding system, provides a construction method of the system for parting cancers, further provides a pharmaceutical composition for enhancing the curative effect of CGT-ODN treatment on cancers and an application of SLFN in preparing a product for diagnosing the degree of CGT-ODN cutting tRNA, and an application of a reagent for detecting tRNA in a sample in preparing a product for predicting the curative effect of CGT-ODN treatment on cancers depending on SLFN 11.

Description

Use of SLFN11 in prediction of CGT-ODN therapeutic effect on cancer

Technical Field

The invention belongs to the technical field of biology, and relates to an application of SLFN to the prediction of the curative effect of CGT-ODN on cancer.

Background

Nucleic acids are the major conserved pathogen determinants detected by Pattern Recognition Receptors (PRRs) that initiate the innate immune response. The CpG motif-containing extracellular bacterial single-stranded DNA (ssDNA) and its synthetic mimetic CpG Oligonucleotides (ODNs) can be internalized by immune cells and recognized by Toll like receptor 9 (TLR 9) in the endosome. CpG ODNs have shown great potential against cancer, infection and allergic diseases. However, the immunostimulatory activity of intracellular ssDNA and its PRR is not yet clear.

SLFN11 as schlafen family members, have enabling tRNA binding activity. SLFN11 are involved in a number of processes including defensive responses to viruses, negative regulation of the mitotic cell cycle G1/S transition, and replication fork arrest. SLFN11 is located in the cytoplasm, at the nuclear, and DNA damage site.

Disclosure of Invention

In order to solve the technical problems in the prior art, the invention provides the following technical scheme:

the invention provides application of a SLFN11 reagent in a detection sample in preparing a product for predicting the curative effect of CGT-ODN on cancer;

further, the CGT-ODN is a nucleotide sequence specifically shown as follows:

5’-(X)nCGT/A(X)m(G)a(X)b(G)c(X)d-3’，

Wherein X is any nucleotide base, n represents any integer number not less than 0, m represents any integer number not less than 0, a represents any integer number not less than 0, b represents any integer number not less than 0, C represents any integer number not less than 0, d represents any integer number not less than 0, C is selected from cytosine, 5-methylcytosine, G represents guanine, T represents thymine, A represents adenine, and at least one of a and C is an integer not less than 1;

Further, at least one of the values a and c is an integer more than or equal to 2;

further, the CGT-ODN nucleotide sequence flanking sequences are rich in consecutive G nucleotides;

further, the CGT-ODN nucleotide sequence has a phosphodiester linkage;

Further, the CGT-ODN nucleotide sequence has at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99% identity to the nucleotide sequence set forth in any of SEQ ID NOs 1-15;

Further, the nucleotide sequence of the CGT-ODN is shown as any one of SEQ ID NO. 1-15;

Further, the nucleotide sequence of the CGT-ODN is shown as any one of SEQ ID NO. 1-9;

Further, the nucleotide sequence of the CGT-ODN is shown as any one of SEQ ID NO 1,3, 4, 6 and 8;

further, the CGT-ODN nucleotide sequence may be of natural origin or synthetic;

further, the CGT-ODN nucleotide sequence has a CGT motif, a CGA motif and a CGT+CGA motif.

In the present invention, the term "ODN" refers to an oligodeoxynucleotide capable of activating an immune response, and the "ODN" is not particularly limited in nucleotide length in the present invention. In particular, the term "CGT-ODN" refers to an oligodeoxynucleotide having a CGT/A motif and a downstream continuous G nucleotide sequence, which exhibits an immune activation function. The term "continuous G nucleotide sequence" refers to a form in which at least 2 guanine deoxyribonucleotides are continuously coupled via phosphodiester bonds to a CGT-ODN, where the cytosine deoxyribonucleotides in the "CGT" may or may not be methylated, and where the CGT-ODN nucleotide sequence may or may not have a palindromic sequence.

Further, the reagents include probes that specifically recognize SLFN gene, primers that specifically amplify SLFN gene, or binding agents that specifically bind to the protein encoded by SLFN gene;

The term "probe" as used herein refers to a synthetic or biological nucleic acid that contains a specific nucleotide sequence that hybridizes to a target nucleic acid sequence under stringent conditions. One probe may be connected to a plurality of tag portions. Preferred moieties are identifying labels, such as fluorophores. The labeled probe may also comprise a plurality of different nucleic acid sequences, each labeled with one or more marker moieties. Each flag portion may be the same or different. It may be beneficial to label different probes (e.g., nucleic acid sequences) each having a different tag moiety. This can be achieved by having a single distinguishable portion on each probe.

The term "agent" as used herein refers to any small protein or other compound, antibody, nucleic acid molecule or polypeptide, or fragment thereof.

The term "primer" as used herein refers to an initial nucleic acid fragment, typically an RNA oligonucleotide, DNA oligonucleotide or chimeric sequence that is complementary to all or part of the primer binding site of a target nucleic acid molecule. The primer strand may comprise natural, synthetic or modified nucleotides. The lower limit of primer length is the minimum length required to form a stable duplex under the conditions of the nucleic acid amplification reaction.

Further, the sample includes blood, plasma, serum, peripheral blood, cerebral spinal fluid, synovial fluid, urine, sweat, semen, stool, sputum, tears, mucus, amniotic fluid, exudates, bone marrow, ascites, pelvic rinse, pleural fluid, spinal fluid, lymph fluid, ocular fluid, extracts of nasal, laryngeal or genital swabs, cell suspensions of digestive tissue, or extracts of fecal matter, and tissue and organ samples, tumor tissue or cell samples, and processed samples derived therefrom from humans, animals (e.g., non-human mammals);

Further, the SLFN gene includes a SLFN family gene or fragment of a C-terminal helicase domain;

Further, the C-terminal helicase domain has a nucleotide sequence with at least 90% sequence identity, preferably at least 95% sequence identity, preferably at least 96% sequence identity, preferably at least 97% sequence identity, preferably at least 98% sequence identity, preferably at least 99% sequence identity to SEQ ID NO. 16.

Further, the nucleotide sequence of SEQ ID NO. 16 is as follows:

ggcatgatgacagacacagatccagatcttctacagttgtctgaagattttgaatgtcagctgagtctatctagtgggcctccccttagcagaccagtgtactccaagaaaggcctggaacataaaaaggaactccagcaacttttattttcagtcccaccaggatatttgcgatatactccagagtcactctggagggacctgatctcagagcacagaggactagaggagttaataaataagcaaatgcaacctttctttcggggaattttgatcttctctagaagttgggctgtggacctgaacttgcaggagaagccaggagtcatctgtgatgctctgctgatagcacagaacagcacccccattctctacaccattctcagggagcaagatgcagagggccaggactactgcactcgcaccgcctttactttgaagcagaagctagtgaacatggggggctacaccgggaaggtgtgtgtcagggccaaggtcctctgcctgagtcctgagagcagcgcagaggccttggaggctgcagtgtctccgatggattaccctgcgtcctatagccttgcaggcacccagcacatggaagccctgctgcagtccctcgtgattgtcttactcggcttcaggtctctcttgagtgaccagctcggctgtgaggttttaaatctgctcacagcccagcagtatgagatattctccagaagcctccgcaagaacagagagttgtttgtccacggcttacctggctcagggaagaccatcatggccatgaagatcatggagaagatcaggaatgtgtttcactgtgaggcacacagaattctctacgtttgtgaaaaccagcctctgaggaactttatcagtgatagaaatatctgccgagcagagacccggaaaactttcctaagagaaaactttgaacacattcaacacatcgtcattgacgaagctcagaatttccgtactgaagatggggactggtatgggaaggcaaaaagcatcactcggagagcaaagggtggcccaggaattctctggatctttctggattactttcagaccagccacttggattgcagtggcctccctcctctctcagaccaatatccaagagaagagctcaccagaatagttcgcaatgcagatccaatagccaagtacttacaaaaagaaatgcaagtaattagaagtaatccttcatttaacatccccactgggtgcctcgaggtatttcctgaagccgaatggtcccagggtgttcagggaaccttacgaattaagaaatacttgactgtggagcaaataatgacctgtgtggcagacacgtgcaggcgcttctttgataggggctattctccaaaggatgttgctgtgcttgtcagcaccgcaaaagaagtggagcactataagtatgagctcttgaaagcaatgaggaagaaaagggtggtgcagctcagtgatgcatgtgatatgttgggtgatcacattgtgttggacagtgttcggcgattctcaggcctggaaaggagcatagtgtttgggatccatccaaggacagctgacccagctatcttacccaatgttctgatctgtctggcttccagggcaaaacaacacctgtatatttttccgtggggtggccattag.

The term "sample" as used herein refers to any sample obtained from an individual suffering from a disease to be treated by the methods of the present invention, including tissue samples (such as tissue slices and tissue needle biopsies); a cell sample (e.g., a cytological smear (such as a Pap or blood smear) or a cell sample obtained by microdissection); bone marrow samples (whole, whole cells, or a sub-population of cells therein); or a cell, fragment or organelle (such as obtained by lysing the cell and separating its components by centrifugation or other means). Other examples of biological samples include blood, serum, urine, semen, fecal matter, cerebrospinal fluid, interstitial fluid, mucus, tears, sweat, pus, biopsy tissue (e.g., obtained by surgical biopsy or needle punch biopsy), nipple aspirate, vaginal fluid, saliva, swabs (such as oral swabs), or any material containing biomolecules derived from a first biological sample.

The invention provides a product for predicting the curative effect of CGT-ODN on cancer in vitro, which comprises a chip, a kit, test paper or a nucleic acid membrane strip;

Further, the chip comprises a gene or protein chip comprising an oligonucleotide probe specific for SLFN gene, the protein chip comprising an antibody or ligand specific for SLFN protein;

Further, the kit includes reagents for detecting SLFN gene or protein expression levels by western blotting, ELISA, radioimmunoassay, oxter-lonib immunodiffusion, rocket electrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip assay.

Further, the cancers include solid tumors and non-solid tumors.

The term "solid tumor" as used herein refers to an abnormal mass of tissue that does not typically contain cysts or areas of fluid. Solid tumors may be benign or malignant. The term solid tumor cancer refers to malignant, neoplastic or cancerous solid tumors. Solid tumor cancers include, but are not limited to, sarcomas, malignant epithelial tumors, and lymphomas, such as lung cancer, breast cancer, prostate cancer, colon cancer, rectal cancer, and bladder cancer. The tissue structure of solid tumors includes interdependent tissue compartments, including parenchyma (cancer cells) and supporting stromal cells (microenvironment in which the cancer cells are dispersed and may provide support).

The term "non-solid tumor" as used herein generally refers to tumors that are not visible or accessible by X-ray film, CT scan, B-mode, and palpation. For example, the non-solid tumor may include leukemia. For example, the non-solid tumor may include a lymphoma. For example, the non-solid tumor may include multiple myeloma.

Further, the cancers include prostate cancer, ductal breast cancer, glioma, lung cancer.

The invention provides an application of SLFN11 in preparing a system for parting cancers, wherein the parting cancers are SLFN11 high-expression cancers and SLFN low-expression cancers;

furthermore, the SLFN high-expression type cancer has excellent CGT-ODN treatment effect, and the SLFN low-expression type cancer has poor CGT-ODN treatment effect.

The term "system" as used herein encompasses not only the construction in which a plurality of computers, hardware, or devices are connected by a communication medium such as a network (including connections supporting one-to-one communication), but also the construction in which a single computer, hardware, or device is employed. It is obvious that the term "system" includes not only manually arranged social constructions (social systems).

The invention provides a system for parting cancers, which is characterized in that a biomarker SLFN11 is utilized for parting, and the cancer parting comprises SLFN11 high-expression cancers and SLFN11 low-expression cancers;

further, the system includes a detection module for detection of the expression level of SLFN;

Further, the system includes a judgment module for classifying different subjects into different types of cancer according to SLFN expression level detection values;

further, the system comprises an output module, a judging module and a control module, wherein the output module is used for outputting the judging result of the judging module;

further, the expression level includes a gene expression level and/or a protein expression level.

The term "module" as used in this disclosure refers to a functioning software or hardware component such as a Field Programmable Gate Array (FPGA), application Specific Integrated Circuit (ASIC), an operational medical component, a visualization component, or the like. However, the term "module" is not limited to software or hardware. The term "module" may be configured in an addressable storage medium or may be configured to reproduce one or more processors. A "module" may also refer to components such as software components, object-oriented software components, class components, and task components, and may include processes, functions, attributes, procedures, subroutines, segments of program code, drivers, firmware, microcode, circuitry, data, databases, data structures, tables, arrays, and variables.

The terms "biomarker" or "biomarker" as used in the present invention are used interchangeably to refer to a gene or gene product that is used to modulate one or more phenotypes of interest. In some embodiments, the term also encompasses a measurable entity that has been determined to be indicative of a target outcome, e.g., one or more diagnostic, prognostic, and/or therapeutic outcome (e.g., for modulating an inflammatory phenotype, cancer status, etc.).

The term "subject" as used herein refers to an animal, vertebrate, non-human mammal or human, especially a person administering an agent, e.g., for experimental, diagnostic and/or therapeutic purposes or obtaining a sample or performing a procedure. In some embodiments, the subject is a mammal, such as a human, a non-human primate, a rodent (e.g., a mouse or a rat), a domestic animal (e.g., a cow, sheep, cat, dog, and horse), or other animal (e.g., a camel and a camel). In some embodiments, the subject is a human. The term "subject" is interchangeable with "patient".

The invention provides a construction method of a cancer parting system, which comprises the following steps:

1) Collecting a sample from a cancer patient;

2) Detecting the expression level of SLFN a in a sample of a cancer patient;

3) The detection result is compared with the normal level SLFN to distinguish patients into SLFN high-expression type cancer patients and SLFN low-expression type cancer patients.

The invention provides the use of SLFN a in any of the following:

1) The application of the CGT-ODN in preparing a pharmaceutical composition for assisting in preventing or treating cancers.

Further, the SLFN includes the gene or protein of SLFN 11.

Further, the auxiliary prevention or treatment comprises enhancing the curative effect of the CGT-ODN for treating cancers, and particularly comprises the steps of increasing the signal transduction function of the CGT-ODN by increasing the gene or protein level of SLFN11, increasing the endocytic capacity by increasing the gene or protein level of SLFN11, and increasing the cytokine level and immune response activation of the CGT-ODN depending on SLFN.

2) Use in screening ODN nucleotide sequences for immunomodulation.

Further, the SLFN includes the gene or protein of SLFN 11.

Further, the SLFN gene or protein includes the full length gene or protein of SLFN11, the C-terminal gene or protein fragment containing residues 349-901 of SLFN.

Further, the SLFN proteins include proteins with or without expression purification.

Further, the screening includes affinity screening.

Further, the immunomodulation includes activation of immune response, immunostimulatory activity, modulation of cytokine expression.

Further, the cytokines include cytokines of JNK, p38, nfkb signaling pathways.

Further, the cytokines include TNF、IFNB1、CXCL8、IL-11、IL-12A、IL-32、CCL2、CCL4、ANKRD1、TNFAIP3、JUN、FOS、FOSL1、FOSL2、NFKB1、NFKB2、CASP3、MAP3K14.

The invention provides a pharmaceutical composition for enhancing the therapeutic effect of CGT-ODN on cancer, which comprises an effective amount of SLFN gene or protein.

Further, the nucleotide sequence of the SLFN gene has at least 90% sequence identity, preferably at least 95% sequence identity, preferably at least 96% sequence identity, preferably at least 97% sequence identity, preferably at least 98% sequence identity, preferably at least 99% sequence identity to SEQ ID NO 17.

Further, the nucleotide sequence shown in SEQ ID NO. 17 is shown as follows:

atggaggcaaatcagtgccccctggttgtggaaccatcttacccagacctggtcatcaatgtaggagaagtgactcttggagaagaaaacagaaaaaagctgcagaaaattcagagagaccaagagaaggagagagttatgcgggctgcatgtgctttattaaactcaggaggaggagtgattcgaatggccaagaaggttgagcatcccgtggagatgggactggatttagaacagtctttgagagagcttattcagtcttcagatctgcaggctttctttgagaccaagcaacaaggaaggtgtttttacatttttgttaaatcttggagcagtggccctttccctgaagatcgctctgtcaagccccgcctttgcagcctcagttcttcattataccgtagatctgagacctctgtgcgttccatggactcaagagaggcattctgtttcctgaagaccaaaaggaagccaaaaatcttggaagaaggaccttttcacaaaattcacaagggtgtataccaagagctccctaactcggatcctgctgacccaaactcggatcctgctgacctaattttccaaaaagactatcttgaatatggtgaaatcctgccttttcctgagtctcagttagtagagtttaaacagttctctacaaaacacttccaagaatatgtaaaaaggacaattccagaatacgtccctgcatttgcaaacactggaggaggctatctttttattggagtggatgataagagtagggaagtcctgggatgtgcaaaagaaaatgttgaccctgactctttgagaaggaaaatagaacaagccatatacaaactaccttgtgttcatttttgccaaccccaacgcccgataaccttcacactcaaaattgtgaatgtgttaaaaaggggagagctctatggctatgcttgcatgatcagagtaaatcccttctgctgtgcagtgttctcagaagctcccaattcatggatagtggaggacaagtacgtctgcagcctgacaaccgagaaatgggtaggcatgatgacagacacagatccagatcttctacagttgtctgaagattttgaatgtcagctgagtctatctagtgggcctccccttagcagaccagtgtactccaagaaaggcctggaacataaaaaggaactccagcaacttttattttcagtcccaccaggatatttgcgatatactccagagtcactctggagggacctgatctcagagcacagaggactagaggagttaataaataagcaaatgcaacctttctttcggggaattttgatcttctctagaagttgggctgtggacctgaacttgcaggagaagccaggagtcatctgtgatgctctgctgatagcacagaacagcacccccattctctacaccattctcagggagcaagatgcagagggccaggactactgcactcgcaccgcctttactttgaagcagaagctagtgaacatggggggctacaccgggaaggtgtgtgtcagggccaaggtcctctgcctgagtcctgagagcagcgcagaggccttggaggctgcagtgtctccgatggattaccctgcgtcctatagccttgcaggcacccagcacatggaagccctgctgcagtccctcgtgattgtcttactcggcttcaggtctctcttgagtgaccagctcggctgtgaggttttaaatctgctcacagcccagcagtatgagatattctccagaagcctccgcaagaacagagagttgtttgtccacggcttacctggctcagggaagaccatcatggccatgaagatcatggagaagatcaggaatgtgtttcactgtgaggcacacagaattctctacgtttgtgaaaaccagcctctgaggaactttatcagtgatagaaatatctgccgagcagagacccggaaaactttcctaagagaaaactttgaacacattcaacacatcgtcattgacgaagctcagaatttccgtactgaagatggggactggtatgggaaggcaaaaagcatcactcggagagcaaagggtggcccaggaattctctggatctttctggattactttcagaccagccacttggattgcagtggcctccctcctctctcagaccaatatccaagagaagagctcaccagaatagttcgcaatgcagatccaatagccaagtacttacaaaaagaaatgcaagtaattagaagtaatccttcatttaacatccccactgggtgcctcgaggtatttcctgaagccgaatggtcccagggtgttcagggaaccttacgaattaagaaatacttgactgtggagcaaataatgacctgtgtggcagacacgtgcaggcgcttctttgataggggctattctccaaaggatgttgctgtgcttgtcagcaccgcaaaagaagtggagcactataagtatgagctcttgaaagcaatgaggaagaaaagggtggtgcagctcagtgatgcatgtgatatgttgggtgatcacattgtgttggacagtgttcggcgattctcaggcctggaaaggagcatagtgtttgggatccatccaaggacagctgacccagctatcttacccaatgttctgatctgtctggcttccagggcaaaacaacacctgtatatttttccgtggggtggccattag.

Further, the SLFN gene or protein includes the full length gene or protein of SLFN11, the C-terminal gene or protein fragment containing residues 349-901 of SLFN.

Further, the pharmaceutical composition further comprises the CGT-ODN nucleotide sequence;

Further, the pharmaceutical composition also comprises pharmaceutically acceptable auxiliary materials;

further, the auxiliary materials comprise preservative, emulsifying agent, suspending agent, diluent, sweetener, thickener, thawing agent and colorant.

In some embodiments, the pharmaceutical composition refers to a mixture of one or more compounds or physiologically acceptable salts thereof with other chemical ingredients, such as physiologically acceptable carriers and excipients. In certain embodiments, the purpose of the pharmaceutical composition is to facilitate administration of the compound to an organism. In an embodiment of the invention, the pharmaceutical composition further comprises pharmaceutically acceptable excipients. In some embodiments, the pharmaceutically acceptable adjuvant refers to a carrier that does not cause significant irritation to the organism and does not abrogate the biological activity and properties of the administered compound.

In some specific embodiments, the pharmaceutically acceptable excipients include diluents, such as water and the like; fillers such as starch, sucrose, etc.; binders, such as cellulose derivatives, alginates, gelatin, polyvinylpyrrolidone; humectants, such as glycerol; disintegrants such as agar-agar, calcium carbonate and sodium bicarbonate; absorption promoters, such as quaternary ammonium compounds; surfactants such as cetyl alcohol; adsorption carriers such as kaolin and soap clay; lubricants such as talc, calcium stearate and magnesium stearate, polyethylene glycol, and the like. In some specific embodiments, the adjunct can also include flavoring and sweetening agents.

The invention provides an application of SLFN11 in preparing a product for diagnosing the degree of CGT-ODN cutting tRNA;

further, the tRNA comprises TYPE II TRNA.

The invention provides application of a reagent for detecting tRNA in a sample in preparation of SLFN < 11 > -dependent CGT-ODN (cyclic shift-ODN) treatment effect prediction product, wherein the CGT-ODN is the CGT-ODN nucleotide sequence;

further, the tRNA comprises TYPE II TRNA;

Further, the sample includes blood, plasma, serum, peripheral blood, cerebral spinal fluid, synovial fluid, urine, sweat, semen, stool, sputum, tears, mucus, amniotic fluid, exudates, bone marrow, ascites, pelvic rinse, pleural fluid, spinal fluid, lymph fluid, ocular fluid, extracts of nasal, laryngeal or genital swabs, cell suspensions of digestive tissue, or extracts of fecal matter, and tissue and organ samples, tumor tissue or cell samples from humans, animals (e.g., non-human mammals), and processed samples derived therefrom.

The invention provides a product for predicting SLFN 11-dependent CGT-ODN curative effect on cancer in vitro, which comprises a reagent for detecting tRNA in the detection sample;

further, the tRNA comprises TYPE II TRNA.

Further, the therapeutic effect includes the degree of induction of immune response.

Drawings

FIG. 1 is a graph of Ethidium Bromide (EB) staining and SYBR melting curve results for ssDNA;

FIG. 2 is a graph of TLR9 independent immunostimulatory activity results of ssDNA;

FIG. 3 is a graph of cell viability versus cytokine expression results for bacterial ssDNA and human ssDNA;

FIG. 4 is a flow chart of a human whole genome ssDNA screen;

FIG. 5 is a graph of gel detection results of an optimization method for ODN transfection of HEK293 and 293A cells;

FIG. 6 is a graph of absorbance detection results after ODN transfection of HEK293 and 293A cells;

FIG. 7 is a graph showing the results of crystal violet staining and cell morphology for detecting the dose-effect relationship of ODN-HEK 293;

FIG. 8 is a graph showing the results of time course analysis of cell morphology changes after transfection of 293A cells with ODN 60;

FIG. 9 is a graph showing the results of the immunostimulatory effect of ODNs on different cell types;

FIG. 10 is a graph of morphological changes and ATP-based cell viability results of HEK293 cells transfected with different forms of ODN or ORN; wherein ODNrc, reverse complement ODN; ORN, oligoribonucleotides identical to ODN sequence; dsODN, double-stranded ODN obtained by annealing ODN and ODNrc;

FIG. 11 is a graph showing the effect of ODN sequence length on HEK293 cell viability;

FIG. 12 is a graph showing morphological results of 12h of ODN60 and ODN60rc electrotransformed 293A cells, and cell viability analysis results of 48h of direct extracellular incubation of HEK293 transfected with different ODNs or ODNs;

FIG. 13 is a diagram of Wen graph and KEGG Orthology database analysis after transfection of ODN60 or ODN60rc in 293A cells;

FIG. 14 is a thermal graph of cytokine expression profile after 293A cell treatment versus upregulated cytokine qPCR validation results;

FIG. 15 is a graph showing the results of qPCR detection of ODNs transfected DU145 cells for 24 h;

FIG. 16 is a DEGs analysis result graph of IPA database analysis results related to TNFR pathway;

FIG. 17 is a graph showing time and dose effect results of immunoblot analysis of pathway activation following transfection of HEK293 with ODN60 and ODN60 rc;

FIG. 18 is a graph showing the results of antibody immunoblotting analysis after DU145 cell transfection with designated top and bottom ODNs for 24 h; wherein UT represents untreated cells;

FIG. 19 is a graph showing the results of antibody immunoblotting analysis of the nuclear fraction of 293A cells transfected with ODNs;

FIG. 20 is a graph showing the results of qPCR detection of IFNB1, CXCL8 expression of HEK293 cells transfected with different siRNAs after 12h stimulation with ODN 60;

FIG. 21 is a graph showing the results of transfection efficiency assays for different ODNs;

FIG. 22 is a graph showing the effect of exchange of adjacent nucleotides indicated in ODN60 on stimulatory activity;

FIG. 23 is a graph showing the effect of truncation at the 3' end of ODN60 on stimulatory activity;

FIG. 24 is a graph showing the results of the immunostimulatory activity assays after various mutations in the CGT motif of ODN60 and transfection of HEK293 cells;

FIG. 25 is a graph of the percent partitioning results for CGT/A with ODNs within the sequencing horizon shown in FIG. 6;

FIG. 26 is a graph showing the results of ATP cell viability assay, cell morphology and cytokine activation in HEK293 cells transfected with top ODNs harboring CGT/A motif mutations; wherein, CGT, wild type sequence; AGT, CGT→AGT mutation; CCG, cgt→ccg mutation; CGG, CGT (CGA for ODN 86) mutation to CGG mutation;

FIG. 27 is a statistical plot of the position of CGT/A motifs in the highest and lowest ODNs;

FIG. 28 is a graph of CGT motif flanking sequence characterization results versus different base percentage statistics for top and middle ODNs;

FIG. 29 is a graph showing specific sequences of ODN-H and ODN-L synthesized according to the sequence characteristics of ODN and cytokine activation results after HEK293 transfection;

FIG. 30 is a graph showing the effect of consecutive G or T base distributions of CGT/A motif flanking sequences in ODN sequences on cytokine activation potency in cells;

FIG. 31 is a graph of percent statistics for CGT/A and CGT/A flanking sequences comprising more than 3 Gs in ODN sequences;

FIG. 32 is a graph of statistics for more stimulatory ODNs of a viral genome;

FIG. 33 is a graph of the effect of 2' -O methylation modification, RNA base substitution, phosphorothioate (PS) linkage, and cytidine methylation on stimulatory activity in CGT/AODN compared to CGT/AODN with classical CpG ODN, wherein the capital letters, phosphodiester linkage; lowercase, phosphorothioate linkages; underline, palindromic sequence;

FIG. 34 is a graph showing the results of qPCR detection of IFNB1 expression levels after transfection of WT and TLR9 knockout mouse lung fibroblasts with typical CpG-ODN and ODN-H, respectively;

FIG. 35 is a schematic of genome-wide CRISPR screening of ODN60 response essential genes;

FIG. 36 is a graph showing the gene abundance ranking of multiple gRNA average hits, fold change in abundance between ODN60 and ODN60rc treated cells, and gRNA enrichment ranking of ODN60 treated cells;

FIG. 37 is a graph of post-deletion ODN60 and other top-ranked ODN triggered cytokines, cell viability statistics of SLFN 11;

FIG. 38 is a graph showing the effect of immunoblotting detection SLFN on ODN 60-induced activation of p38 and JNK by complementary expression;

FIG. 39 is a graph showing the results of qPCR detection of TNF and CXCL8 expression after transfection of different ODNs into WT and SLFN11 ^-/- HEK293 cells;

FIG. 40 is a graph showing the results of immunoblot analysis of SLFN11 expression levels in cells;

FIG. 41 is a graph showing statistics of different types of nucleotide-induced cytokine expression in SLFN knockout DU145 cells;

FIG. 42 is a schematic of luminescent ODN immunoprecipitation (ODIP) and biotin-ODN pulldown assays;

FIG. 43 is a graph showing the results of ODIP determination of endogenous and re-expressed SLFN11 binding activity to ODN60 and ODN60 rc;

FIG. 44 is a graph showing the results of a ODIP and biotin-ODN pulldown assay for detecting the binding of SLFN and ODN in cells;

FIG. 45 is a graph showing the effect of "CGT" motifs obtained in biotin pull-down detection ODN60rc in HEK293 cells on binding to SLFN 11;

FIG. 46 is a schematic diagram of structure prediction of three subgroups of SLFN family;

FIG. 47 is a graph of the results of ODIP analysis of full length and truncated SLFN11 and ODN60 following ODN60 transfection using a schematic representation of full length and truncated SLFN11 and SLFN11 ^-/- HEK293 cells expressing full length and truncated SLFN 11;

FIG. 48 is a graph showing the results of in vitro experiments on ODN binding activity of SLFN 11; the method comprises coomassie blue staining, an electrophoresis mobility change experiment, a fluorescence ODN GST pull-down experiment and a BLI experiment;

FIG. 49 is a graph of immunoblot analysis results of truncated SLFN11 versus ODN-induced activation of the MAPK pathway;

FIG. 50 is a distribution diagram of SLFN subgroups of NCBI database among clusters;

FIG. 51 is a graph of comparison of gene trees for the third subgroup SLFN, AIM2 and cGAS in TreeFam database;

FIG. 52 is a graph showing the results of protein expression levels of the SLFN family and the SLFN homologous proteins from NCBI human and mouse redundant protein sequence databases and GTEx databases;

FIG. 53 is a graph of the results of biotin-ODN 60 experiments with SLFN members of subgroup III;

FIG. 54 is a graph showing the result of staining SLFN for copolymerization of ODN60 with SLFN in the nucleus;

FIG. 55 is a graph of immunoblot analysis of SLFN11 distributions in HEK293 cytoplasm and nucleus;

FIG. 56 is a graph of immunoblotting detection results of SLFN of the distribution of SLFN in cytoplasm, perinucleus, and nucleus before and after stimulation of HEK293 cells with ODN 60;

FIG. 57 is a graph of ESMA measurements of subcellular localization of SLFN11 bound by ODN versus SLFN cytoplasmic-perinuclear-nuclear fraction bound by ODN;

FIG. 58 is a graph of co-localization results between SLFN and the highest ranked ODNs in DU145 cytoplasma;

FIG. 59 is a graph showing the results of screening SLFN for the homolog of 11 in mice;

FIG. 60 is a schematic diagram of the construction of SLFN-KO mice;

FIG. 61 is a graph showing the results of cytokine qPCR detection in WT and SLFN-KO mice;

FIG. 62 is a graph showing the results of qPCR assay Ifnb1mRNA expression levels and ELISA assay IFNα secretion after transfection of WT, SLFN9 ^-/- and tr19 ^-/- mouse primary cells with HIV6441 and classical TLR9 CpG ODN, respectively;

FIG. 63 is a graph showing the results of SLFN mice immune responses induced in CGT-ODN, wherein a-f, CGT-ODN induced immune responses in neonatal (b, c) and adult (d-f) mice; schematic of intravenous injection of CpG ODNs encapsulated in LNPs and luciferase mRNA-LNPs in liver (a); qPCR and immunoblotting to detect activation of cytokine (b) and immune pathway (c), respectively; qPCR and HE staining detected the expression level of cytokine 6h (d) after injection and the histological changes of 3d (e) after injection, respectively, and monitored 4-day survival; g-i, respectively inoculating WT or SLFN9-/-B16-F10 cells under the skin of a WT C57BL/6 mouse, then injecting HIV6441 wrapped by a transfection reagent into the tumor, and measuring the average tumor volume (h) of each group and the tumor volume (i) of a single mouse at each time point according to the treatment scheme shown as g;

FIG. 64 is a graph showing the results of SLFN and TRL9 expression in the livers of B16-F10 and WT mice;

FIG. 65 is a graph showing the results of cell morphology changes, ATP-based cell viability, and cytokine expression in SLFN-/-and Trl9-/-B16-F10 mice;

FIG. 66 is a graph showing the results of reduced tRNA cleavage by CGT ODN and pathogenic ssDNA such as bacteria or AAV; wherein A is electrophoresis staining of a PAGE gel, B is analysis of a dose-effect relationship, C-D is influence of knockdown of SLFN11 on tRNA cutting caused by CGT-ODN stimulation, E-F is a cell survival result, G is a cytokine expression result, H is influence of other sources of ssDNA on tRNA degradation of SLFN11, I is a cell survival result of other sources of ssDNA, J is degradation of tRNA of wild type SLFN HeLa cells when receiving CGT ODN stimulation, K is a cell survival result of exogenous SLFN when expressed by HeLa cells, L is an inflammatory response result of exogenous SLFN when expressed by HeLa cells.

Detailed Description

EXAMPLE 1 intracellular ssDNA decreases cell viability in a sequence-specific manner

1. Acquisition of human and bacterial ssDNA and preliminary analysis of ssDNA to reduce cell viability

To obtain ssDNA, human and bacterial genomic DNA was heat denatured and identified using dsDNA-preferred ethidium bromide staining and SYBR green melting curves, the results are shown in fig. 1. To test TLR 9-independent immunostimulatory activity of ssDNA, ssDNA and dsDNA were transfected into HEK293 cells deficient in TLR9 pathway, the results are shown in fig. 2, which shows that bacterial ssDNA reduced cell viability to a greater extent than bacterial dsDNA or human ssDNA. Bacterial ssDNA activates greater expression of TNF and CXCL8 than bacterial dsDNA or human ssDNA, as shown in fig. 3, indicating that intracellular ssDNA can also activate TLR 9-independent immune responses in a sequence-dependent manner.

2. Screening of human and bacterial ssDNA and detailed analysis of ssDNA to reduce cell viability

To further investigate the stimulatory activity of ssDNA on the human genome, the stimulatory sequences were screened by preparing a full genome 24 nucleotide (nt) ODN library, the results of which are shown in fig. 4. Libraries were transfected into HEK293 and 293A cells using the optimized ODN transfection method as shown in fig. 5. The results are shown in fig. 6, which shows that 14 ODNs out of 200 were observed to reduce the average cell viability of these cells to below 40%. The first 11 active high ODNs were validated in concentration gradients and as shown in fig. 7, ODN60 was found to exhibit the highest immunostimulatory potency. Therefore, in the subsequent study, ODN60 was used as a representative of ODN. In addition, the immunostimulatory potency of ODN60 was as low as 24nM, while its reverse complement ODN (ODN 60 rc) did not decrease cell viability even at 120nM, as shown in fig. 8, indicating that immunostimulatory activity was determined by the sequence and not its targeted genomic position. The ODN sequences used in the experiments are shown in table 1.

TABLE 1

To explore whether the response to ssDNA was cell-type limiting, the top-ranked ODNs were transfected into various types of human cells, and as shown in fig. 9, ODN-responsive cell types were found to include DU145, T47D, U, 251 and a549 cells, and HUVECs, but not 293T cells. By observing the morphological features exhibited by these reactive cells, cell death after stimulation is clearly indicated. Furthermore, by the results shown in fig. 10, only ODN, not Oligonucleotide (ORN) or double-stranded ODN (dsODN), reduced cell viability. This immunological activity is not limited to a length of 24nt, since 96nt ODN containing the highest sequence also reduced cell viability, as shown in fig. 11. Finally, both electroporation and transfection (rather than incubation) made the top-ranked ODN active, and the results are shown in fig. 12, indicating that the presence of ssDNA in the cell is essential for its immunostimulatory activity.

Example 2 intracellular ssDNA activates cytokine expression and immune-related Signal pathway

In view of the fact that cell viability is not a specific indicator for assessing immune responses, to further determine the immunostimulatory activity of ODN, RNAseq assays were performed on 293A cells 10 and 24 hours after stimulation of the cells with ODN60 or ODN60 rc. As a result, as shown in fig. 13, only ODN60 triggered their expression, ODN60rc did not trigger expression, compared to the expression of immune-related genes in the untreated control group. Importantly, ODN60 stimulated the expression of a number of cytokines and chemokines (hereinafter "cytokines"), the specific cytokine results shown in fig. 14, further indicating the immunostimulatory activity of ssDNA, as activation of transcription of cytokines is a major component of the pathogen-associated molecular pattern (PAMP) induced innate immune response. Similarly, experiments were performed in DU145 cells, with all top-ranked ODNs activating cytokine expression, as shown in fig. 15, and also including IFNB1 that was not triggered in HEK293 cells, with specific results shown in fig. 14.

In addition, most of the apical enriched signaling pathways in ODN60 treated cells were associated with immune responses, except for the innate immune response revealed by cytokine activation, and the results are shown in fig. 16, which show that these genes contribute to the enrichment of TNFR1 and TNFR2 pathways. ODN60 also activated JNK, p38 and nuclear factor- κb (nfkb) signaling pathways, the results of which are shown in fig. 17. Consistently, all top-ranked ODNs activated JNK, p38 and nfkb pathways in DU145 cell lines, the results are shown in fig. 18. Whereas a decrease in iκbα levels indicates activation of the nfkb pathway, for which nuclear translocation of nfκb was further assessed, it was found that p65 and NF- κb1 translocation to the nucleus was significantly increased following top-ranked ODN stimulation, and the results are shown in fig. 19. Knocking down p65 and NF- κb1 partially reduced ODN 60-induced activation of IFNB1 and CXCL8 in DU145 cells, as shown in figure 20. In summary, decreased cell viability, increased cytokine expression and activation of immune pathways revealed immunostimulatory activity of intracellular ODNs.

Example 3 CGT/A with continuous G is the core motif of intracellular ODN immunostimulatory Activity

Before studying the immunostimulatory sequence pattern in the top-ranked ODN, we excluded the possibility that the difference in immune activity between the top-ranked and bottom-ranked ODNs was caused by different transfection efficiencies, the results being shown in fig. 21. Next, we designed a series of ODN60 mutant and truncated constructs. The use of position switches for three pairs of adjacent bases from the 5 'end region instead of the 3' end region deactivates the ODN60 as shown in FIG. 22. Consistently, the 3' -end truncation of about 8nt had little effect on ODN60 immunocompetence, and the results are shown in fig. 23. Importantly, switching of only the first pair of adjacent nucleotides was sufficient to significantly reduce the immune activity of ODN60, as shown in figure 22. These results indicate that the immune activity of ODN60 is primarily determined by its 5' end sequence and is sensitive to single nucleotide changes.

Next, the 1 st to 7 th nucleotides of the 5' end of ODN60 were systematically substituted with the other three types of nucleotides, and the resulting activities were evaluated by evaluating cell viability and activation of TNF cytokines and JNK pathways, and the results are shown in fig. 24. These results consistently indicate that nucleotides 2 and 3 are highly restricted to C and G, respectively, and that nucleotide 4, T, exhibits a certain tolerance to a for the immunostimulatory activity of ODN60, indicating that the CGT/a motif is not only extracellular ssDNA, but also is unexpectedly required for intracellular ssDNA to activate an immune response. Then, we further analyzed the presence of CGT/a motifs in the 200 screened ODNs, and found that the presence of CGT and CGA (CGT/a) motifs determines the stimulation level of the ODN, as shown in fig. 25. Any single nucleotide mutation in the CGT/a motif disrupted the immunostimulatory activity of the top-ranked ODN, as shown in figure 26. Thus, the presence of CGT/A is necessary for an immunostimulatory ODN.

We found that not all ODNs containing the CGT/A motif have strong immunostimulatory effects in the screening experiments of example 1. Thus, we speculate that flanking sequences, which are CGT/A motifs, cooperate with CGT/A to determine the immunostimulatory effect of intracellular ODNs. To determine the flanking sequence patterns that distinguish the efficacy of CGT/a motifs, we first analyzed the base composition of all ODNs and aligned the CGT/a flanking motifs of top-ranked (high-lived) and middle-ranked (mid-lived) ODNs. As shown in FIG. 27, most ranking underlayments (low viability) CGT/AODN were excluded from this alignment because they lack downstream flanking sequences. We observed that the CGT/a flanking sequences in the top-ranked ODNs are G-rich, while the flanking sequences in the other ODNs are T-rich, and the results are shown in fig. 28. We then synthesized ODN-H and ODN-L with CGT/A motifs surrounded by high-and medium-activity flanking sequences, respectively. As expected, only ODN-H triggered TNF expression, whereas ODN-L did not, as shown in FIG. 29. Furthermore, substitution of G by T and disruption of G continuity downstream of the CGT/A motif impair the immunostimulatory activity of ODN-H, as shown in FIG. 30, indicating that the highly active CGT/A motif requires assistance from a continuous G downstream of CGT/A. This also explains why the CGT/a motif in the underlying ODN tends to lie within the last 10nt of the 3' end, see in particular fig. 28.

To verify the universality of this sequence law in predicting the potential immunostimulatory capacity of single-stranded DNA, we analyzed the proportion of such immunostimulatory sequences present in the genomes of multiple species. We found that the proportion of this motif in the bacterial genome is much higher than in the human genome, and the results are shown in FIG. 31, which explains why bacterial ssDNA is more immunostimulatory than human ssDNA. Cas9 protein is a protein of bacterial origin that is widely used in gene editing, and therefore its coding sequence also contains a very high proportion of immunostimulatory sequences. Most single stranded DNA viruses and retroviruses contained fewer immunostimulatory sequences than double stranded DNA viruses, but the genomes of adeno-associated viruses were the exception, and according to this motif rule we tested the immunostimulatory capacity of single stranded DNA derived from bacterial, aids and type 2 adeno-associated virus genomes, respectively, while we also searched for, pooled and tested ODNs from other viral genomes, the test results being shown in figure 32. In summary, our results indicate that CGT/A with downstream continuous G is a stimulatory motif of intracellular ssDNA, independent of the species source of the ssDNA.

Although intracellular active ODNs share some sequence similarity with TLR 9-sensed a class CpG ODNs, TLR9 is not able to be activated by 5-methylation modified CpG ODNs, whereas ODNs with Phosphorothioate (PS) backbones would enhance activation of TLR 9. As shown in FIG. 33, we found that the deoxyribose backbone of CGT-ODN was only natural, and that replacement with Phosphorothioate (PS) backbone, 2' -O methylated backbone and Ribonucleotide (RNA) backbone all destroyed the immunostimulatory activity of intracellular ODNs, while 5-methylated cytosine modification in the CGT/A motif had little effect on the efficacy of intracellular ODNs. Thus, we have found that such ODNs are not a class of ODNs that recognize CpG with TLR 9. These elements define a class of intracellular active ODNs: the CGT/A motif with natural Phosphodiester (PO) linkage and methylation tolerance is poly G3' downstream and palindromic sequence is optional. For brevity, we will refer to ODNs with these elements as CGT ODNs. Thus, a typical CpG-ODN is not as active as ODN-H when delivered into cells. Meanwhile, the lack of TLR9 did not affect the stimulatory activity of ODN-H, as shown in FIG. 34. These results further demonstrate that intracellular CGT-ODNs are not activated by TLR9 to activate immune responses, and further suggest the existence of a novel intracellular CGT-ODNs receptor.

Example 4SLFN11 is critical to ODN-induced immune response

To identify potential receptors for intracellular ssDNA, we performed a whole genome CRISPR-Cas9 screen, a schematic diagram as shown in figure 35. We focused on knockout of genes to eliminate ODN 60-induced cell depletion related genes. Interestingly, SLFN protein family member SLFN was most significantly enriched in single and three rounds of screening, whereas other identified DNA genes, such as TLR9, AIM2 and cGAS, were not highly enriched, and the results are shown in figure 36. SLFN11 has been previously identified as an interferon-stimulated gene (ISG) that plays a role in inhibiting HIV translation and tumor response to DNA damaging agents. To verify the role of SLFN11 in intracellular CGT-ODN-induced immune responses, we generated SLFN knockout clones from HEK293, 293A and DU145 cells. The deletion of SLFN11 completely blocked all previously defined immune responses, including cytokine activation, cell viability decline triggered by ODN60 and other top-ranked ODNs, as shown in figure 37. We failed to establish stable SLFN re-expression in SLFN11 ^-/- HEK293 cells using lentivirus, as overexpression SLFN11 from the vector strongly inhibited lentivirus production. Transient SLFN complementary expression made SLFN11 ^-/- HEK293 cells responsive to ODN60, although this re-expression of SLFN itself also triggered partially an immune response, as shown in figure 38. In addition, the virus-derived CGT/A ODN and bacterial ssDNA activated TNF and CXCL8 expression only in WT 293A cells and not in SLFN-/-293A cells, and the results are shown in FIGS. 32 and 39. Consistent with FIG. 9, only cells carrying SLFN expression reacted to the top-ranked ODN, and the results are shown in FIG. 40. Finally, SLFN11 was necessary for CGT-ODNs to activate IFNB1 and CXCL8 in DU145 cells, and the results are shown in FIG. 41.

Example 5SLFN A sequence-specific ssDNA binding protein

To determine whether SLFN11 was able to bind and recognize ssDNA in the form of ODN, we developed a biotin pull-down complementation method called luminescent ODN immunoprecipitation (ODIP) to quantify the intracellular ODN binding activity of SLFNs, a schematic of ODIP is shown in fig. 42. ODN60 and SLFN11 were specifically immunoprecipitated, while ODN60rc was unable, and the ODIP signal of ODN60 was SLFN dependent, and the results are shown in fig. 43. Furthermore, binding of ODN to SLFN11 is CGT motif dependent, since any single mutation in the CGT motif of ODN60 reduces its binding to SLFN11 (fig. 44), whereas the availability of CGT motif in ODN60rc enhances its binding to SLFN11 (fig. 45). As expected, SLFN11 specifically bound the top-ranked ODN, but not the bottom-ranked ODN (fig. 44), indicating that high affinity for SLFN11 is necessary for the immunostimulatory activity of ODN.

SLFN11 belongs to subgroup III of the SLFN family, the members of which comprise three predicted domains: the N-terminal AAA domain, SWADL domain and C-terminal helicase domain are schematically shown in FIG. 46. Truncated analysis showed that what was able to bind to ssDNA was the SLFN C-terminal fragment containing residues 349 to 901, and any indication deletion between residues 349 to 901 reduced the ssDNA binding activity of SLFN11 (fig. 47). The direct ssDNA binding activity of SLFN11 was also determined with purified GST-and His-fused C-terminal SLFN11 (fig. 48). Notably, in SLFN11-/-HEK293 cells, only full length SLFN11 was able to restore reactivity to ODN60 (fig. 49). This suggests that the C-terminal helicase domain is responsible for ssDNA binding, while the N-terminal domain is necessary for signaling of the presence of ssDNA within the cell. In summary, the need for a CGT-DNA induced immune response and the specific binding activity for CGT/A motif-containing cells suggests that SLFN is an intracellular CGT-DNA immunosensor.

In contrast to the other SLFN subgroups, only SLFN in subgroup III contained the entire C-terminal ssDNA binding domain and was conserved from trunk fish to humans (fig. 50). In addition, subgroup III SLFNs showed a similar evolutionary distribution in the taxa with dsDNA sensors (fig. 51), indicating that full length subgroup III, SLFNs, was under potential selection pressure. However, of all subgroups III SLFNs expressed in humans (fig. 52), only SLFN11 had detectable ssDNA binding activity (fig. 53).

Example 6SLFN Co-localization and binding to CGT-ODNs in the cytoplasm

SLFN11 was exported out of the nucleus under stimulation of ODN60 and accumulated in spots co-localized with ODN60 in the cytoplasm. This is in contrast to the diffuse distribution of SLFN11 in the nucleus observed under basal conditions (fig. 54). When we analyzed cytoplasmic and nuclear extracts by immunoblotting, we found that the distribution of endogenous SLFN11 was sensitive to different extraction protocols (fig. 55). To further investigate this observation, we divided cells into nucleus, perinucleus and cytosol, and found SLFN that was predominantly stable in perinuclear fraction under basal conditions, but transferred into the cytoplasm under ODN60 stimulation (fig. 56). Consistent with immunofluorescence results, biotin pulldown experiments and EMSAs assays showed that ODNs-bound SLFN was predominantly distributed in the cytoplasmic portion (fig. 57). Finally, we confirmed co-localization between SLFN and the highest ranked ODN in DU145 cytoplasm (fig. 58).

Example 7SLFN (SLFN 11 homolog) is critical to CGT-ODN-induced mouse immune response

Since mice do not have SLFN a 11, we screened a mouse SLFN that could functionally complement human SLFN in order to further investigate the role of SLFNs in the in vivo response to CGT-ODNs. In all mouse subgroups III SLFNs, which were highly homologous to human SLFN11, only SLFN9 was found to be able to bind ssDNA and resume ssDNA signaling in SLFN11 ^-/- HEK293 cells (fig. 59). Thus, we established Slfn knockout mice (fig. 60). Preliminary evaluation of Slfn9 ^-/- mice showed that they were healthy and fertile in our population under specific pathogen-free conditions.

We first analyzed Slfn in primary cells after CGT-ODNs stimulation. The lack of Slfn in primary Bone Marrow Derived Macrophages (BMDMs) blocked activation of Ifnb, il6 and Cxcl2 by ODN-H and HIV6441, a CGT ODN from HIV, but did not block poly (dA: dT), poly (I: C) or LPS (fig. 61), indicating that Slfn9 is specifically required for intracellular CGT-ODNs induction. HIV6441 was found to be more active than ODN-H in mouse cells; thus, we used HIV6441 to represent intracellular ODN for the following mouse experiments. To explore the role of SLFN and TLR9 in response to different types of ODN, we delivered HIV6441 and all three types of typical CpG ODN, ODN1585 (class a), ODN1826 (class B) and ODN2395 (class C) into primary mouse fibroblasts (MAFs), lung Fibroblasts (LFs), primary BMDM and plasmacytoid dendritic cells (pDC), respectively.

TLR9 is reported to play a major role in pDCs and B cells. In agreement, all types of ODNs stimulated ifnα production in WT and Slfn9-/-pDCs, but not in tlir 9-/-pDCs, suggesting that transfected ODNs could also activate tlir 9 in endosomes due to endocytosis when tlir 9 is highly expressed. However, only the Slfn knockout, but not the tlir 9 knockout blocked Ifnb1 expression induced by HIV6441 and ODN1585 in MAFs, LFs and BMDM (fig. 62). Thus, the intracellular stimulatory activity of both typical CpG ODN and CGT ODN is dependent on SLFN9, and SLNF9 functions in a wider tissue type than TLR9.

We extended our findings to primary mouse cells by stimulating WT and Slfn9 ^-/- mice with intracellular delivered ODN of the Lipid Nanoparticle (LNP) system, which is also used for severe acute respiratory syndrome coronavirus type 2 mrna vaccine. Since intravenous injection of LNP resulted mainly in accumulation of nucleotides in the liver (fig. 63 a), we mainly evaluated the role of Slfn in liver response to ODNs. HIV6441 activated expression of Ifnb1, tnf, il6, cxcl2 and Cxcl10 in the liver, as well as STAT1, JNK and nfkb pathways (fig. 63B, c). Slfn9 lack almost completely abrogated HIV 6441-induced response. Similarly, slfn was also necessary for HIV 6441-induced cytokine expression in adult mouse livers (fig. 63 d), except Ifnb1. Consistent with the morphological features of cell death in human cells of example 1, HIV6441 even triggered histological necrosis of the liver and acute hepatitis (fig. 63e, f), which is also SLFN dependent. Notably, cpG-ODNs induced fatal toxic shock was reported only in D-galactosamine sensitized mice, and only injection of CpG-DNA into mice was reported to be nontoxic even at relatively high doses. However, we found that intravenous injection of 60 μg of LNP-packaged HIV6441 was sufficient to cause WT mice to die (fig. 63 f). In contrast, all Slfn ^-/- mice survived the same challenge. In addition, we encapsulated single-stranded DNA genome of adenovirus type 2 (AAV 2) into LNP for intravenous injection into mice, which stimulated SLFN dependent immune responses. Taken together, these in vivo results confirm previous cellular studies, indicating that SLFN and SLFN are critical for intracellular ODN-induced immune responses in humans and mice, respectively.

Previous basic and clinical studies have shown intratumoral single agent therapeutic activity of classical CpG-ODNs, which are generally regarded as TLR9 agonists. And we speculate that CGT ODN should also have good tumor therapeutic effect by activating SLFN. To elucidate the role of SLFN and TLR9 in ODN anti-tumor monotherapy we produced SLFN9 ^-/- and TLR9 ^-/- B16-F10 cells, respectively, although WT B16-F10 cells hardly expressed TLR9 (fig. 64). We found Slfn cells ^-/-, but not Tlr9 ^-/-, were completely resistant to ODN-induced decrease in cell viability and increase in cytokine activation (fig. 65). To further confirm these findings, WT and Slfn ^-/- B16-F10 cells were subcutaneously transplanted into mice (FIG. 63 g). Consistently, intratumoral delivery of HIV6441 significantly reduced the growth of WT tumors, but had no effect on the growth of Slfn9 ^-/- tumors (fig. 63h, i), suggesting that Slfn9 is a key target for ODN monotherapy in tumor cells.

Example 8CGT ODN and pathogenic ssDNA such as bacterial or AAV resulted in reduced tRNA cleavage

After 293A cells were stimulated with CGT ODN, RNA was extracted from the cells, and analyzed by PAGE gel electrophoresis staining, it was found that TYPE II TRNA was significantly decreased in abundance (FIG. 66A), and that the amount of CGT ODN used and the degree of tRNA degradation had a dose-response relationship (FIG. 66B). In HUVEC cells, CGT ODNs can also lead to tRNA cleavage. To verify whether the TYPE II TRNA decrease in CGT ODN was SLFN11 tRNA cleavage activity dependent, we mutated the tRNA cleavage active site E209 of endogenous SLFN in HEK293 cells in situ to 209A, disabling tRNA cleavage of endogenous SLFN expressed by HEK 293. When we stimulated HEK293 cells with CGT ODN, only WT cells and E209A heterozygous cells (one allele expressed WT SLFN11 and the other allele expressed E209A SLFN) were able to produce tRNA cleavage in response to CGT ODN stimulation, whereas SLFN11 knockdown cells and cells expressing only E209A SLFN11 were completely resistant to CGT ODN stimulation-induced tRNA cleavage (fig. 66C-D). And E209ASLFN11 was also unable to mediate downstream cell death (FIGS. 66E-F) and cytokine expression (FIG. 66G), suggesting that tRNA cleavage activity of SLFN11 is necessary to elicit a downstream natural immune response. In addition to CGT ODN, we also demonstrated that bacterial, AAV, HIV genome-derived ssDNA, bacterial and AAV-derived ssDNA were able to cause SLFN-dependent tRNA degradation (fig. 66H), as well as tRNA cleavage activity of SLFN11 was necessary for cell death by these pathogenic ssDNA (fig. 66I). HeLa cells hardly expressed endogenous SLFN11 and were also insensitive to CGT ODN stimulation. Thus, we artificially constructed cell lines stably expressed by exogenous wild-type SLFN11 and cleavage activity mutant SLFN11 (E209A, E214A, E209/214A) in HeLa cells. When HeLa cells expressing wild-type SLFN11 were stimulated with CGT ODN, we could see significant tRNA degradation (fig. 66J), whereas HeLa cells expressing SLFN with lost tRNA cleavage activity were unable to respond to stimulation with CGT ODN. As a result of the endogenous SLFN tRNA activity point mutation in HEK293 cells, exogenous SLFN11 was also required for the tRNA cleavage activity of SLFN in response to stimulation of CGT ODN to cause downstream cell death (FIG. 66K) and inflammatory response (FIG. 66L) upon HeLa cell expression. In combination with our work SLFN that can directly recognize data binding to CGT ODN, we identified SLFN as an RNase activated by ssDNA. This is also the first ssDNA-activated RNA nucleic acid hydrolase found in eukaryotic cells. The TYPE II TRNA level is directly predicted to be used as a clinical detection and diagnosis index of ssDNA induced immune response.

The above description of the embodiments is only for the understanding of the method of the present invention and its core ideas. It should be noted that it will be apparent to those skilled in the art that several improvements and modifications can be made to the present invention without departing from the principle of the invention, and these improvements and modifications will fall within the scope of the claims of the invention.

Claims (10)

1. Application of SLFN reagent in detection sample in preparing CGT-ODN product for treating cancer;

Preferably, the CGT-ODN is a nucleotide sequence specifically shown as follows:

5’-(X)_nCGT/A(X)_m(G)_a(X)_b(G)_c(X)_d-3’，

Wherein X is any nucleotide base, n represents any integer number not less than 0, m represents any integer number not less than 0, a represents any integer number not less than 0, b represents any integer number not less than 0, C represents any integer number not less than 0, d represents any integer number not less than 0, C is selected from cytosine, 5-methylcytosine, G represents guanine, T represents thymine, A represents adenine, and at least one of a and C is an integer not less than 1;

preferably, at least one of the values a and c is an integer not less than 2;

Preferably, the CGT-ODN nucleotide sequence flanking sequences are enriched in contiguous G nucleotides;

preferably, the CGT-ODN nucleotide sequence has a phosphodiester linkage;

Preferably, the CGT-ODN nucleotide sequence has at least 90%, preferably at least 95%, preferably at least 96%, preferably at least 97%, preferably at least 98%, preferably at least 99% identity to the nucleotide sequence set forth in any of SEQ ID NOs 1-15;

preferably, the nucleotide sequence of the CGT-ODN is shown in any one of SEQ ID NOs 1-15;

preferably, the nucleotide sequence of the CGT-ODN is shown in any one of SEQ ID NOs 1-9;

Preferably, the nucleotide sequence of the CGT-ODN is shown as any one of SEQ ID NOs 1, 3, 4, 6 and 8;

preferably, the CGT-ODN nucleotide sequence may be of natural origin or synthetic;

preferably, the CGT-ODN nucleotide sequence is provided with a CGT motif, a CGA motif and a CGT+CGA motif;

Preferably, the reagent comprises a probe that specifically recognizes SLFN gene, a primer that specifically amplifies SLFN gene, or a binding agent that specifically binds to a protein encoded by SLFN gene;

Preferably, the sample comprises blood, plasma, serum, peripheral blood, cerebral spinal fluid, synovial fluid, urine, sweat, semen, stool, sputum, tears, mucus, amniotic fluid, exudates, bone marrow, ascites, pelvic rinse, pleural fluid, spinal fluid, lymph fluid, ocular fluid, extracts of nasal, laryngeal or genital swabs, cell suspensions of digestive tissue, or extracts of fecal matter, and tissue and organ samples, tumor tissue or cell samples from humans, animals (e.g., non-human mammals), and processed samples derived therefrom;

Preferably, the SLFN gene comprises a SLFN family gene or fragment of a C-terminal helicase domain;

Preferably, the C-terminal helicase domain has a nucleotide sequence with at least 90% sequence identity, preferably at least 95% sequence identity, preferably at least 96% sequence identity, preferably at least 97% sequence identity, preferably at least 98% sequence identity, preferably at least 99% sequence identity to SEQ ID NO. 16.

2. A product for predicting the curative effect of CGT-ODN on cancer in vitro, which is characterized by comprising a chip, a kit, test paper or a nucleic acid membrane strip;

Preferably, the chip comprises a gene or protein chip comprising an oligonucleotide probe specific for SLFN gene and the protein chip comprises an antibody or ligand specific for SLFN protein;

Preferably, the kit comprises reagents for detecting SLFN gene or protein expression levels by western blotting, ELISA, radioimmunoassay, oxter lony immunodiffusion, rocket electrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, protein chip assay.

The use of slfn11 in the preparation of a system for the genotyping of cancer, wherein the genotyping of cancer is SLFN11 high-expressing cancer and SLFN low-expressing cancer;

Preferably, the SLFN high-expression cancer has excellent therapeutic effect on the CGT-ODN according to claim 1 or 2, and the SLFN low-expression cancer has poor therapeutic effect on the CGT-ODN according to claim 1 or 2.

4. A system for typing a cancer, wherein the system uses biomarker SLFN11 for typing, the cancer typing comprising SLFN11 high expression class cancer and SLFN11 low expression class cancer;

preferably, the system comprises a detection module for detection of the expression level of SLFN;

preferably, the system comprises a judgment module for classifying different subjects into different types of cancer according to SLFN expression level detection values;

preferably, the system comprises an output module, a judging module and a control module, wherein the output module is used for outputting the judging result of the judging module;

Preferably, the expression level comprises a gene expression level and/or a protein expression level.

5. A method of constructing a system for typing a cancer, the method comprising:

1) Collecting a sample from a cancer patient;

2) Detecting the expression level of SLFN a in a sample of a cancer patient;

3) The detection result is compared with the normal level SLFN to distinguish patients into SLFN high-expression type cancer patients and SLFN low-expression type cancer patients.

Use of slfn11 in any of the following:

1) The application of the CGT-ODN in preparing a pharmaceutical composition for auxiliary prevention or treatment of cancer;

2) Use in screening ODN nucleotide sequences for immunomodulation;

Preferably, the SLFN includes a gene or protein of SLFN 11;

preferably, the SLFN gene or protein comprises the full length gene or protein of SLFN11, a C-terminal gene or protein fragment containing residues 349-901 of SLFN;

preferably, the SLFN a protein comprises a protein with or without expression purification;

Preferably, the screening comprises affinity screening;

Preferably, the immunomodulation comprises activation of immune response, immunostimulatory activity, modulation of cytokine expression;

preferably, the cytokines include cytokines of JNK, p38, nfkb signaling pathways;

Preferably, the cytokine comprises TNF、IFNB1、CXCL8、IL-11、IL-12A、IL-32、CCL2、CCL4、ANKRD1、TNFAIP3、JUN、FOS、FOSL1、FOSL2、NFKB1、NFKB2、CASP3、MAP3K14.

7. A pharmaceutical composition for enhancing the therapeutic effect of CGT-ODN for treating cancer, comprising an effective amount of SLFN gene or protein;

preferably, the SLFN gene or protein comprises the full length gene or protein of SLFN11, a C-terminal gene or protein fragment containing residues 349-901 of SLFN;

Preferably, the pharmaceutical composition further comprises the CGT-ODN nucleotide sequence of claim 1 or 2;

preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients;

preferably, the auxiliary materials comprise preservative, emulsifying agent, suspending agent, diluent, sweetener, thickening agent, thawing agent and colorant.

Use of slfn11 in the preparation of a product for diagnosing the extent of CGT-ODN cleavage of trnas;

preferably, the tRNA comprises TYPE II TRNA.

9. Use of a reagent for detecting tRNA in a sample in preparation of SLFN a 11-dependent CGT-ODN product for predicting the therapeutic effect of cancer treatment, wherein the CGT-ODN is the CGT-ODN nucleotide sequence of claim 1;

Preferably, the tRNA comprises TYPE II TRNA;

Preferably, the sample comprises blood, plasma, serum, peripheral blood, cerebral spinal fluid, synovial fluid, urine, sweat, semen, stool, sputum, tears, mucus, amniotic fluid, exudates, bone marrow, ascites, pelvic rinse, pleural fluid, spinal fluid, lymph fluid, ocular fluid, extracts of nasal, laryngeal or genital swabs, cell suspensions of digestive tissue, or extracts of fecal matter, and tissue and organ samples, tumor tissue or cell samples from humans, animals (e.g., non-human mammals), and processed samples derived therefrom.

10. A product for in vitro prediction SLFN of the efficacy of 11-dependent CGT-ODN in the treatment of cancer, said product comprising the detection of an agent according to claim 9;

preferably, the therapeutic effect includes the degree of immune response induction.