CN117925698A - Improved method for shortening heading period in high-quality rice polishing - Google Patents
Improved method for shortening heading period in high-quality rice polishing Download PDFInfo
- Publication number
- CN117925698A CN117925698A CN202410126706.6A CN202410126706A CN117925698A CN 117925698 A CN117925698 A CN 117925698A CN 202410126706 A CN202410126706 A CN 202410126706A CN 117925698 A CN117925698 A CN 117925698A
- Authority
- CN
- China
- Prior art keywords
- sequence
- rice
- ghd7
- light
- agrobacterium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 82
- 235000009566 rice Nutrition 0.000 title claims abstract description 81
- 238000000034 method Methods 0.000 title claims abstract description 24
- 238000004904 shortening Methods 0.000 title claims abstract description 15
- 238000005498 polishing Methods 0.000 title claims description 4
- 240000007594 Oryza sativa Species 0.000 title description 2
- 241000209094 Oryza Species 0.000 claims abstract description 80
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 62
- 230000008569 process Effects 0.000 claims abstract description 4
- 239000000463 material Substances 0.000 claims description 32
- 241000589158 Agrobacterium Species 0.000 claims description 28
- 108091033409 CRISPR Proteins 0.000 claims description 27
- 206010020649 Hyperkeratosis Diseases 0.000 claims description 26
- 241000196324 Embryophyta Species 0.000 claims description 25
- 238000010354 CRISPR gene editing Methods 0.000 claims description 14
- 230000004069 differentiation Effects 0.000 claims description 12
- 239000013612 plasmid Substances 0.000 claims description 12
- 238000012216 screening Methods 0.000 claims description 12
- 238000012163 sequencing technique Methods 0.000 claims description 12
- 239000001963 growth medium Substances 0.000 claims description 11
- 241000233866 Fungi Species 0.000 claims description 9
- 238000002791 soaking Methods 0.000 claims description 9
- 239000002609 medium Substances 0.000 claims description 8
- 238000001890 transfection Methods 0.000 claims description 7
- 241000588724 Escherichia coli Species 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000010367 cloning Methods 0.000 claims description 6
- 230000006698 induction Effects 0.000 claims description 6
- 239000007788 liquid Substances 0.000 claims description 6
- 230000001954 sterilising effect Effects 0.000 claims description 6
- 238000012258 culturing Methods 0.000 claims description 5
- 238000005286 illumination Methods 0.000 claims description 4
- 239000000243 solution Substances 0.000 claims description 4
- 108091026890 Coding region Proteins 0.000 claims description 3
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 3
- 239000007853 buffer solution Substances 0.000 claims description 3
- 229960002523 mercuric chloride Drugs 0.000 claims description 3
- LWJROJCJINYWOX-UHFFFAOYSA-L mercury dichloride Chemical compound Cl[Hg]Cl LWJROJCJINYWOX-UHFFFAOYSA-L 0.000 claims description 3
- 238000007790 scraping Methods 0.000 claims description 3
- 239000002689 soil Substances 0.000 claims description 3
- 230000007480 spreading Effects 0.000 claims description 3
- 238000003892 spreading Methods 0.000 claims description 3
- 238000004114 suspension culture Methods 0.000 claims description 3
- 230000009466 transformation Effects 0.000 claims description 3
- 238000005406 washing Methods 0.000 claims description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 3
- 238000010257 thawing Methods 0.000 claims description 2
- 238000004140 cleaning Methods 0.000 claims 1
- 238000010362 genome editing Methods 0.000 abstract description 12
- 230000006872 improvement Effects 0.000 abstract description 6
- 238000005516 engineering process Methods 0.000 abstract description 5
- 230000033228 biological regulation Effects 0.000 abstract description 3
- 238000009395 breeding Methods 0.000 abstract description 2
- 230000001488 breeding effect Effects 0.000 abstract description 2
- 102000054766 genetic haplotypes Human genes 0.000 description 20
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 description 14
- 108700028369 Alleles Proteins 0.000 description 8
- 230000035772 mutation Effects 0.000 description 6
- 230000009418 agronomic effect Effects 0.000 description 4
- 235000013339 cereals Nutrition 0.000 description 4
- 239000002299 complementary DNA Substances 0.000 description 4
- 238000012217 deletion Methods 0.000 description 4
- 230000037430 deletion Effects 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 231100000221 frame shift mutation induction Toxicity 0.000 description 4
- 230000037433 frameshift Effects 0.000 description 4
- 102000004169 proteins and genes Human genes 0.000 description 4
- 101100177307 Oryza sativa subsp. japonica HD5 gene Proteins 0.000 description 3
- 241000746966 Zizania Species 0.000 description 3
- 235000002636 Zizania aquatica Nutrition 0.000 description 3
- 150000001413 amino acids Chemical class 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 230000002068 genetic effect Effects 0.000 description 3
- 230000001105 regulatory effect Effects 0.000 description 3
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 2
- 206010034960 Photophobia Diseases 0.000 description 2
- HCHKCACWOHOZIP-UHFFFAOYSA-N Zinc Chemical compound [Zn] HCHKCACWOHOZIP-UHFFFAOYSA-N 0.000 description 2
- 210000004027 cell Anatomy 0.000 description 2
- 230000001276 controlling effect Effects 0.000 description 2
- 238000011534 incubation Methods 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000011835 investigation Methods 0.000 description 2
- 208000013469 light sensitivity Diseases 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000001131 transforming effect Effects 0.000 description 2
- 239000011701 zinc Substances 0.000 description 2
- 229910052725 zinc Inorganic materials 0.000 description 2
- 241000219194 Arabidopsis Species 0.000 description 1
- 108700024394 Exon Proteins 0.000 description 1
- 206010064571 Gene mutation Diseases 0.000 description 1
- 101000988395 Homo sapiens PDZ and LIM domain protein 4 Proteins 0.000 description 1
- 108010061100 Nucleoproteins Proteins 0.000 description 1
- 102000011931 Nucleoproteins Human genes 0.000 description 1
- 244000118056 Oryza rufipogon Species 0.000 description 1
- 240000002582 Oryza sativa Indica Group Species 0.000 description 1
- 206010034972 Photosensitivity reaction Diseases 0.000 description 1
- 101710172711 Structural protein Proteins 0.000 description 1
- 108091027544 Subgenomic mRNA Proteins 0.000 description 1
- 108091023040 Transcription factor Proteins 0.000 description 1
- 102000040945 Transcription factor Human genes 0.000 description 1
- 101710138000 Two-component response regulator-like PRR37 Proteins 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 238000009355 double cropping Methods 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000002401 inhibitory effect Effects 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 230000003993 interaction Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000010899 nucleation Methods 0.000 description 1
- 230000036211 photosensitivity Effects 0.000 description 1
- 230000037039 plant physiology Effects 0.000 description 1
- 230000004983 pleiotropic effect Effects 0.000 description 1
- 229920001184 polypeptide Polymers 0.000 description 1
- 102000004196 processed proteins & peptides Human genes 0.000 description 1
- 108090000765 processed proteins & peptides Proteins 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 238000009331 sowing Methods 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention provides an improvement method for shortening the heading period in the process of the light crossing of high-quality rice, which belongs to the technical field of rice breeding, and aims at the problem that the light crossing variety is seriously longer in the northeast rice area and the growth period, and the WWF types of three genes Ghd7, ghd8 and Hd1 are converted into NWN type combinations by a gene editing technology, so that the regulation and control of the heading period of the light crossing rice are realized, the light crossing heading period is shortened, and the light crossing high-quality rice which can be introduced into the northeast Heilongjiang area in China is obtained; the improved method of the light-crossing heading period can provide support for creating a light-crossing new system suitable for planting in multiple places and can also provide reference for improving the properties of other crops.
Description
Technical Field
The invention belongs to the technical field of rice breeding, and particularly relates to an improved method for shortening the light-crossing heading period of high-quality rice by using a gene editing method.
Background
The more light is a high-quality japonica rice variety bred in the 1950-1960 s of japan, and has been worldwide accepted as top-quality rice for several decades. However, the introduction of the beyond-light variety into China is limited in the area suitable for planting, the growth period of the beyond-light variety is shortened sharply in the south Fang Dao area, and the growth period of the beyond-light variety is seriously longer in the northeast rice area. In order to fully exert the value of the high-quality variety in the rice production in China, especially to introduce the surging variety to the high-quality rice producing area in China, namely Heilongjiang zone, the surging variety must be improved, the heading period is shortened, and the surging variety can be aligned before 8 months.
Rice is a short-day plant, and can only undergo reproductive growth and then bloom when the sun length is shorter than the critical day length. A large number of scholars have found that Hd1, ghd7 and Ghd8 genes play important roles in regulating and controlling the heading stage of rice (Zhang et al .Genetic Interactions Among Ghd7,Ghd8,OsPRR37 and Hd1 Contribute to Large Variation in Heading Date in Rice.Rice,2019,12(1):1-13).
Most traits of plants are controlled by quantitative trait loci (Quantitative Trait Locus, QTL). The Hd4 locus of the rice QTL is Ghd7, and the Ghd7 is used for simultaneously controlling a plurality of characters of the rice, including heading period, plant height and grain number per ear, and is a main effect QTL. The cDNA of Ghd7 has full length of 1013bp, and its coded protein consists of 257 amino acids, and the protein is a nucleoprotein, and this protein is also a CCT structural protein. Ghd7 has multiple functions, can inhibit heading, increase plant height and increase grain number under long sunlight condition, and has multiple effects, and plays an important role in improving rice yield and character improvement (Xue, etc.) .Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice.Nature Genetics,2008,40(6):761-767).
Hd1 is a QTL gene obtained by Japanese scholars in 2000 by means of map-based cloning. Hd1 belongs to photoperiod sensitive gene, its cDNA is 1557bp in total length, hd1 gene contains two exons, protein coded by Hd1 contains 395 amino acids, contains zinc finger domain, and is homologous with CO family with zinc finger domain in Arabidopsis. The Hd1 gene has different heading date regulating functions under different conditions, and recent researches find that Hd1 promotes heading under long and short sunshine conditions in the background of Zhenshan 97, but Hd1 inhibits flowering under short sunshine conditions and promotes flowering under long sunshine conditions after Zhenshan 97 integrates Ghd7 (Xing Yongzhong. Ghd7, ghd8, ghd7.1 and Hd1 jointly determine the ecological adaptability and yield of rice varieties. The national academy of sciences of China crop society, the national academy of sciences of China, hebei's guard, 2017:9).
The Hd5 locus of the rice QTL is the Ghd8 gene and is positioned on the 8 th chromosome short arm. In 2006 Zhang et al found that one QTL corresponds to a plurality of rice traits simultaneously in Zhenshan 97/HR5 RILs, including plant height, heading period and grain number per ear. The locus is finely positioned by constructing a near isogenic line (Zhang et al .Quantitative trait loci for panicle,size,heading date and plant height co-segregating in trait-performance derived near-isogenic lines of rice(Oryza sativa).Theoretical and Applied Genetics,2006,113(2):361-368),Ghd8 codes HAP3H subunit containing a transcription factor combined with a CCAAT-box element, the cDNA length of Ghd8 reaches 1156bp, and the cDNA length of Ghd8 contains an exon and codes a polypeptide composed of 297 amino acids. Ghd8 is multiple-effect, and can simultaneously control the yield, plant height and heading stage of rice. Under the condition of short sunshine, the Ghd8 gene can promote the flowering of rice, and under the condition of long sunshine, the flowering of rice can be inhibited (Yan et al .AMajor QTL,Ghd8,Plays Pleiotropic Roles in Regulating Grain Productivity,Plant Height and Heading Date in Rice.Molecular Plant,2011,4(2):319-330;Wei, etc.) .DTH8Suppresses Flowering in Rice,Influencing Plant Height and Yield Potential Simultaneously.Plant Physiology,2010,153(4):1747-1758)..
The characteristic of the flowering phase of plants that is affected by the length of sunlight is called photosensitivity. The Liu Yaoguang institution team constructed various combinations (8 total) of single, double and triple mutant lines with the same genetic background: wild-type NHLD lines HGD-1, single mutant lines (hGD-2 (Hd 1 knockout line), hgD-3 (Ghd 7 knockout line) and HGd-4 (DTH 8 knockout line)), double mutant lines (hGd-5, hgD-6 and Hgd-7) and triple mutant lines (HGD-8). The heading stage phenotype under three conditions including Artificial Short Day (ASD), natural Short Day (NSD) and Artificial Long Day (ALD) was examined in the study and the Hd1, ghd7 and Ghd8 genes were found to be essential for strong rice light sensitivity, as loss of function of any of these genes would disrupt this light sensitivity. Hd1 promotes flowering regardless of sunshine length, and Ghd7 suppresses flowering. The Ghd7/DTH8 combination can enhance the inhibition of flowering under long-day conditions. Ghd8 has the function of promoting rice heading under short sunlight conditions, and can inhibit rice heading under long sunlight conditions. The combination of Hd1/Ghd8, hd1/Ghd7 and Hd1/Ghd7/Ghd8 has gradually enhanced inhibiting effect on flowering of rice under long-day conditions. (Zong et al .Strong photoperiod sensitivity is controlled by cooperation and competition among Hd1,Ghd7 and DTH8 in rice heading.New Phytologist.2021,229(3):1635-1649)
Furthermore, by re-sequencing of the flowering genes Ghd7, ghd8 and Hd1 for 328 parts of the rice core germplasm resource and 49 parts of the common wild rice resource from the International institute of rice, it was found that each gene contained a different haplotype in different rice varieties (Zhang Jia. Functional study of rice CCT family genes and re-cloning of Hd1 [ doctor's thesis ]. Wuhan: university of agriculture in China, 2017). The Ghd7 gene identified 21 haplotypes in wild rice and 11 in cultivated rice. Ghd8 identified 19 haplotypes in wild rice and 11 in cultivated rice. Haplotypes of the Ghd7 and Ghd8 genes are classified into three types, namely, a strong functional type (S), a weak functional type (W) and a non-functional type (N), according to the magnitude of genetic effects. Hd1 identified 20 haplotypes in wild rice and 29 in cultivated rice, and Hd1 haplotypes were only classified into functional (F) and nonfunctional (N) types. The research shows that the gene combination of Ghd7, ghd8 and Hd1 determines the heading period of rice to a great extent, and different combinations of the three genotypes provide possibility for the rice to adapt to the planting in different latitude areas. Ghd7 strong functional haplotypes are mainly distributed in China, south China and southwest, weak functional haplotypes are widely distributed in all places, and non-functional haplotypes are mainly distributed in early rice in northeast and double-cropping rice areas. Ghd8 strong functional haplotypes are mainly distributed in middle and low latitude areas, weak functional haplotypes are widely distributed in multi-latitude areas (including northern high latitude areas), and nonfunctional haplotypes are also widely distributed in multi-latitude areas. Hd1 functional haplotypes are mainly distributed in middle and low latitude areas, and nonfunctional haplotypes are widely distributed in all latitude areas.
On the basis, the combination of three genes Hd1, ghd7 and Ghd8 is classified, and the geographical distribution characteristics are compared and analyzed (Zhou Xiang spring. Directed improvement of the heading period of rice based on gene editing and creation of broad affinity materials [ doctor academy of science ]. Wuhan: university of agriculture in China, 2017). Analysis of the three gene combinations of 100 rice varieties revealed that NNF (Ghd 7 and Ghd8 are non-functional alleles, hd1 is functional allele), SSF and SSN (strong alleles of Ghd7 and Ghd8, hd1 is functional or non-functional respectively) combinations were mainly detected in indica rice planted in the middle and south of China. Whereas the heading period of japonica rice variety combination NWN from Heilongjiang (Ghd 7 and Hd1 are nonfunctional alleles and Ghd8 is a weak functional allele) is 60 days, and the single plant yield is 10.5 g. Therefore, the analysis result shows that the three-gene NWN has shorter combined growth period and is suitable for northeast areas, in particular to the Heilongjiang zone.
The invention sequences the alleles of three genes of the glaring varieties Ghd7, ghd8 and Hd1 to obtain the sequence affecting the glaring heading stage genes; wherein the sequence of the glaring Ghd7 (sequence 1) is consistent with the Hap4 haplotype in Ghd7, and the function is weak; the glaring Ghd8 sequence (sequence 2) is consistent with the Hap2 haplotype in Ghd8, and the function is weak; the sequence of the increasingly light Hd1 (sequence 3) is consistent with the Hap6 haplotype of Hd1, and the function is of a functional type, namely a WWF type. The gene editing technology provides possibility for realizing the NWN combination of three genes Ghd7, ghd8 and Hd1 which influence the flowering period from WWF to the more-light variety and obtaining the high-quality more-light rice variety with early heading period.
Disclosure of Invention
In order to adapt to sunlight and climatic environment in Heilongjiang area, change the light-crossing heading stage of super-optimal rice, realize influencing the bright-crossing flowering period Ghd7 of rice, ghd8 and NWN combination of Hd1 three genes, the invention provides a new improved method for shortening heading stage, sequencing the light-crossing rice to obtain heading stage gene sequence, then directionally knocking out Ghd7 and Hd1 genes by using CRISPR/Cas9 genome editing technology, obtaining NWN type combination of Ghd7, ghd8 and Hd1 three genes, realizing the regulation and control of the light-crossing heading stage of rice, shortening the light-crossing heading stage, and obtaining the light-crossing high-quality rice variety which can be introduced into northeast Heilongjiang area in China. The technical scheme adopted by the invention is as follows:
an improved method for shortening heading time in high-quality rice polishing, which comprises the following specific steps:
(1) CRISPR/Cas9 vector for constructing Ghd7-Hd1 knockout material
2 Knockout targets are designed for each gene in order to construct a CRISPR/Cas9 vector of Ghd7-Hd1 knockout material, and the targets are positioned in the coding region of the gene; wherein, the Ghd7 target spot sequence is shown in the sequence 4; the Ghd7 target second sequence is shown as a sequence 5; the Hd1 target point has a sequence shown as a sequence 6; the Hd1 target two sequences are shown as a sequence 7;
amplifying the target sequences by PCR, respectively selecting expression cassettes driven by OsU a and OsU b promoters, and connecting the expression cassettes to a binary vector PYLCRISPR/Cas9Pubi-H by a Golden Gate cloning method;
And then, transforming the recombinant plasmid into escherichia coli, and screening and sequencing positive clones to obtain a clone without error of a sequencing result, namely the CRISPR/Cas9 vector of the corresponding gene. Introducing recombinant plasmid into soil agrobacterium, and firstly treating the agrobacterium with Ca 2+ to convert the agrobacterium into competence; then, the recombinant plasmid and competent cells are mixed and cultured in a buffer solution, so that the agrobacterium absorbs the plasmid in the escherichia coli to complete the transformation process.
(3) Plant callus culture
Selecting rice seeds harvested in the current year, and removing hulls. Preparing a plurality of small conical flasks of 100ml, preparing a rice induction culture medium, and sterilizing at high temperature. Soaking the shelled seeds in 75% alcohol for 2-3min, soaking in mercuric chloride solution for 18min, and sterilizing. Spreading sterilized seeds on an induction culture medium, and culturing at about 25deg.C in dark for 40-60 days.
(4) Transfection, screening and differentiation
Thawing Agrobacterium strain stored at-80deg.C, and culturing in LB medium. After about 48 hours of incubation, agrobacterium transfection was performed when macroscopic, milky smooth colonies appeared on the medium. Scraping agrobacterium with a fungus inoculating ring onto a suspension culture medium, shaking for 20-30min, pouring the callus into the fungus liquid after the fungus liquid is turbid, and soaking for 10 min. Air-dried, and then placed into a constant temperature incubator at 20 ℃ for dark culture for 48 hours.
For the first screening, the callus infected by agrobacterium is washed 7-8 times with sterilized water. Washing off the agrobacterium on the surface, airing and continuing dark culture. And (3) screening the black hard resistant callus for the second time.
When the yellow new callus is regenerated from the resistant callus, differentiation can be carried out, the new callus is transferred to a differentiation medium, transferred to an illumination incubator for culture, and transplanted to a greenhouse after about Gao Yao cm of seedlings are reached.
Preferably, the primers for PCR amplification are as follows:
ghd7 target one primer: the sequence of forward primer gRT-g 7 is shown as sequence 24; the reverse primer OsU aT1-g7 sequence is shown as sequence 25;
Ghd7 target two primers: the sequence of forward primer gRT-g 7 is shown as sequence 26; the reverse primer OsU T6-g7 sequence is shown as sequence 27;
hd1 target-primer: the forward primer gRT-H1 sequence is shown as sequence 28; the reverse primer OsU bT2-H1 sequence is shown in SEQ ID NO. 29;
Hd1 target two primers: the forward primer gRT-H1 sequence is shown as sequence 30; the reverse primer OsU cT3-H1 sequence is shown in SEQ ID NO. 31;
The templates used for PCR amplification were:
The sequence of template U6a is shown as sequence 32; the sequence of U6b is shown as sequence 33; the sequence of U6c is shown as sequence 34.
The invention has the following advantages and effects:
(1) According to the invention, through a gene editing technology, NWN-type combinations of Ghd7, ghd8 and Hd1 genes are obtained, the regulation and control of the heading period of the light-crossing rice are realized, the heading period of the light-crossing rice is shortened, and therefore, the high-quality variety of the light-crossing rice which can be introduced into the northeast Heilongjiang area of China is obtained;
(2) The improved method of the light-crossing heading period can provide support for creating a light-crossing new system suitable for planting in multiple places and can also provide reference for improving the properties of other crops.
Drawings
In order to more clearly illustrate the technical solutions of the present invention, the drawings that are needed in the description of the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the present invention, and all other embodiments obtained without the inventive effort to a person skilled in the art are within the scope of protection of the present invention.
FIG. 1Ghd7-Hd1 knock-out of the variation of the light-beyond material Ghd7 gene at target one and target two;
FIG. 2Ghd7-Hd1 knockout highlight material variation at Hd1 gene at target one and target two;
FIG. 3 comparison of a more light knockout Ghd7-Hd1 material with a more light wild type individual; wherein (a) the more light knockout material 16-1 (b) the more light knockout material 34-4 (c) the more light knockout material 34-5 (d) the more light knockout material 31-1. The left side of the picture is the improved material, and the right side is the glaring wild type.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other implementations, which can be made by those skilled in the art without making any inventive effort, are intended to be within the scope of the present invention, based on the examples herein.
The technical scheme of the invention is a conventional scheme in the field unless specifically stated; the reagents or materials, unless otherwise specified, are commercially available.
The embodiment of the invention provides a novel improvement method for shortening heading time in high-quality rice light-crossing, which comprises the following specific steps:
Step 1: allele sequencing of the light-crossing rice, and determining a gene editing method.
Sequencing alleles of the Ghd7, ghd8 and Hd1 genes affecting the heading stage to obtain sequences affecting the light heading stage genes; wherein the sequence of the glaring Ghd7 (sequence 1) is consistent with the Hap4 haplotype in Ghd7, and the function is weak; the glaring Ghd8 sequence (sequence 2) is consistent with the Hap2 haplotype in Ghd8, and the function is weak; the sequence of the highlight Hd1 (sequence 3) is consistent with the Hap6 haplotype of Hd1, and the function is functional.
Since the Ghd7 and Ghd8 genes in the glaring are weak functional and Hd1 is functional (WWF type), in order to obtain NWN type (Ghd 7 and Hd1 are nonfunctional and Ghd8 weak function) suitable for northeast China, shortening the heading period of the glaring rice, the Ghd7 and Hd1 genes in the glaring rice need to be knocked out, the Ghd8 genes with weak functions are reserved, and the three gene types of the Ghd7, ghd8 and Hd1 of the glaring rice are converted from WWF to NWN type by utilizing a gene editing technology.
Step 2: CRISPR/Cas9 vector for constructing Ghd7-Hd1 knockout material
In order to construct a CRISPR/Cas9 vector of Ghd7-Hd1 knockout material, 2 knockout targets are designed for each gene, the targets are positioned in coding regions of the genes, and target sequences are obtained through on-line website http:// CRISPR. Specific CRISPR/Cas9 targets were designed on OsU aT1 (Ghd 7), osU T6 (Ghd 7), U6bT2 (Hd 1), U6cT3 (Hd 1), respectively.
Ghd7 target one sequence: CCGGAGAAGGATGTGGCCTGTGC (sequence 4)
Ghd7 target two sequences: CTCACGTTCGACGCGTCTCCCT (sequence 5)
Hd1 target one sequence: GGGTATAGTACCAGACAGCACGG (sequence 6)
Hd1 target two sequences: GCTCTATCTGACGGTAGCTATGG (sequence 7)
Amplifying a target sequence through PCR, and introducing the target sequence into an sgRNA expression cassette through two rounds of PCR when constructing a single-gene CRISPR vector, and selecting an expression cassette driven by a OsU a promoter;
When constructing a double-gene CRISPR vector, selecting OsU a and OsU b promoter-driven expression cassettes, and connecting the expression cassettes to a binary vector PYLCRISPR/Cas9Pubi-H by a Golden Gate cloning method;
The primers for PCR amplification were as follows:
ghd7 target one primer: the sequence of forward primer gRT-g 7 is shown as sequence 24; the reverse primer OsU aT1-g7 sequence is shown as sequence 25;
Ghd7 target two primers: the sequence of forward primer gRT-g 7 is shown as sequence 26; the reverse primer OsU T6-g7 sequence is shown as sequence 27;
hd1 target-primer: the forward primer gRT-H1 sequence is shown as sequence 28; the reverse primer OsU bT2-H1 sequence is shown in SEQ ID NO. 29;
Hd1 target two primers: the forward primer gRT-H1 sequence is shown as sequence 30; the reverse primer OsU cT3-H1 sequence is shown in SEQ ID NO. 31;
The templates used for PCR amplification were:
The sequence of template U6a is shown as sequence 32; the sequence of U6b is shown as sequence 33; the sequence of U6c is shown as sequence 34.
And then, transforming the recombinant plasmid into escherichia coli, and screening and sequencing positive clones to obtain a clone without error of a sequencing result, namely the CRISPR/Cas9 vector of the corresponding gene.
Introducing recombinant plasmid into soil agrobacterium, and firstly treating the agrobacterium with Ca 2+ to convert the agrobacterium into competence; then, the recombinant plasmid and competent cells are mixed and cultured in a buffer solution, so that the agrobacterium absorbs the plasmid in the escherichia coli to complete the transformation process.
Step 2: plant callus culture
Selecting rice seeds harvested in the current year, and removing hulls. Preparing a plurality of small conical flasks of 100ml, preparing a rice induction culture medium, and sterilizing at high temperature. Soaking the shelled seeds in 75% alcohol for 2-3min, soaking in mercuric chloride solution for 18min, and sterilizing. Spreading sterilized seeds on an induction culture medium, and culturing at about 25deg.C in dark for 40-60 days.
Step 3: transfection, screening and differentiation
The Agrobacterium (constructed vector) strain stored at-80℃was thawed and cultured in LB medium by streaking. After about 48 hours of incubation, agrobacterium transfection was performed when macroscopic, milky smooth colonies appeared on the medium. Scraping agrobacterium with a fungus inoculating ring onto a suspension culture medium, shaking for 20-30min, pouring the callus into the fungus liquid after the fungus liquid is turbid, and soaking for 10 min. Air-dried, and then placed into a constant temperature incubator at 20 ℃ for dark culture for 48 hours.
For the first screening, the callus infected by agrobacterium is washed 7-8 times with sterilized water. Washing off the agrobacterium on the surface, airing and continuing dark culture. And (3) screening the black hard resistant callus for the second time.
When the yellow new callus is regenerated from the resistant callus, differentiation can be carried out, the new callus is transferred to a differentiation medium, transferred to an illumination incubator for culture, and transplanted to a greenhouse after about Gao Yao cm of seedlings are reached.
Step 4: culturing in field
Transferring the rice transformed seedlings from a greenhouse to field culture, sowing the seedlings in the same period to be more light and the empty culture 131 which can grow and bear normally in the Heilongjiang area, and comparing the improved strain with the parent to be more light and the empty culture 131 respectively for agronomic character comparison.
In order to verify the improvement effect of the heading period of the polished rice, sequencing identification and agronomic trait investigation are carried out on the polished rice seeds after improvement.
Step 5, sequencing and identifying the glaring Ghd7-Hd1 knockout material
Step 5.1: ghd7 gene function identification
The materials No. 7-16, no. 7-21, no. 7-31 and No. 7-34 are Ghd7-Hd1 knockout light-crossing material T0 generation plants, the positive detection results of Cas9 are positive, and the gene function identification results are shown in Table 1. Gene editing exists in 7-16, 7-21 and 7-34, wherein 7-16 is subjected to frame shift mutation, 7-21 is subjected to frame shift mutation and deletion mutation, 7-34 is subjected to frame shift mutation, deletion mutation and insertion mutation, and Ghd7 gene is disabled. 7-31 no gene editing was found and Ghd7 was still functional.
TABLE 1 identification of Ghd7 Gene function of Ghd7-Hd1 knockout and beyond-gloss material
Step 5.2: hd1 gene function identification
The results of the gene function identification are shown in Table 2. Gene editing exists in 7-16, 7-21 and 7-34, wherein 7-21 is subjected to deletion mutation, 7-16 is subjected to frame shift mutation, 7-34 is subjected to deletion mutation and insertion mutation, and the Hd1 gene is not functional. 7-31 no gene editing was found and Hd1 was still functional.
TABLE 2 functional identification of Hd1 Gene of the knockout Ghd7-Hd1 Material
Finally, 3T 0 generation Ghd7-Hd1 double mutant single plants of 7-16,7-21 and 7-34 are obtained, the 7-31 single plant is a non-variant single plant, and the 7-31 single plant is used as a blank control with carrier transfer but without variation.
Step 5.3: analysis of the Properties of Ghd7-Hd1 knockout light-beyond Material
Step 5.3.1: agronomic trait investigation
The field shape study was performed on Ghd7-Hd1 knockout light-crossing material sown in Wuhan, as shown in Table 3. YG-1 and YG-2 in the table are the more polished parents, the others are T2 generation improved strains, 16-1 to 16-6, 21-1 to 21-2, 31-1 to 31-2, 34-1 to 34-5 are the offspring of 7-16, 7-21, 7-31 and 7-34 respectively, 31-1 to 31-2 are Cas9 positive, but the two genes are not edited. 31-1 was substantially identical to the wild-type, light-crossing phenotype, indicating that the knockout vector did not substantially affect the trait. 16-1, 34-4, 34-5, both genes were edited to become nonfunctional, the plant height being significantly shorter than the parent (FIG. 3). The heading period of the parent is 80 days, the mutant material is from 55 to 73 days earlier than the wild type, and the earliest material is 25 days earlier than the light of the synchronous seeding.
TABLE 3 agronomic trait statistics for Ghd7-Hd1 knockout light-beyond materials
Note that: in the column of the gene type, the first letter indicates the Ghd7 gene edit type, the second letter indicates the Hd1 gene edit type, the N nonfunctional type if there is a gene mutation, and the W weakly functional type if there is no gene edit. The phenotype of both genes of the more polished parent is a weak functional type.
Step 5.3.2: ghd7-Hd1 knockout and light-exceeding material and plant height character comparison of empty culture 131 heading stage
The Ghd7-Hd1 knockout light-crossing material was compared with the empty cultures 131 that were contemporaneously sown in Wuhan, as shown in Table 4. The light-emitting materials 16-1, 34-4 and 34-5 knocked out by the part Ghd7-Hd1 of the earliest heading are basically consistent with the average heading period of the empty culture 131, the height of the No. 16-1 material strain is about 14cm shorter than that of the empty culture 131, the height of the 34-4 strain is 3.3cm higher than that of the empty culture 131, and the height of the 34-5 strain is 5.7cm higher than that of the empty culture 131. The heading period of the empty culture 131 is shorter, and the plant can normally bloom and fruit in cold areas such as Heilongjiang areas, so that the early-flowering and light-crossing Ghd7-Hd1 knockout materials 16-1, 34-4 and 34-5 can be presumed to be introduced into northeast Heilongjiang areas of China.
TABLE 4 comparison of Ghd7-Hd1 knockout and beyond-light materials with heading time and plant height of empty bearing 131
Note that: KY131 data in the table are averages of optionally three individuals, 16-1, 34-4 and 34-5 being data for selected three very early flowering individuals.
Claims (6)
1. An improved method for shortening heading time in high-quality rice polishing is characterized by comprising the following specific steps:
(1) CRISPR/Cas9 vector for constructing Ghd7-Hd1 knockout material
2 Knockout targets are designed for each gene in order to construct a CRISPR/Cas9 vector of Ghd7-Hd1 knockout material, and the targets are positioned in the coding region of the gene; wherein, the Ghd7 target spot sequence is shown in the sequence 4; the Ghd7 target second sequence is shown as a sequence 5; the Hd1 target point has a sequence shown as a sequence 6; the Hd1 target two sequences are shown as a sequence 7;
amplifying the target sequences by PCR, respectively selecting expression cassettes driven by OsU a and OsU b promoters, and connecting the expression cassettes to a binary vector PYLCRISPR/Cas9Pubi-H by a Golden Gate cloning method;
Then the recombinant plasmid is transformed into escherichia coli, and the CRISPR/Cas9 vector of the corresponding gene is obtained by screening and sequencing positive clones, wherein the sequencing result is cloning without error; introducing recombinant plasmid into soil agrobacterium, and firstly treating the agrobacterium with Ca 2+ to convert the agrobacterium into competence; then, the recombinant plasmid and competent cells are mixed and cultured in a buffer solution, so that the agrobacterium absorbs the plasmid in the escherichia coli to complete the transformation process;
(3) Plant callus culture
Selecting rice seeds harvested in the current year for callus culture;
(4) Transfection, screening and differentiation
After being transfected and cultured by agrobacterium, the black hard resistant callus is screened out, when the yellow new callus is regenerated from the resistant callus, differentiation can be carried out and transferred to a differentiation culture medium, and the rice seedlings are cultivated by illumination until the seedling height is 10cm, so that the improved light-crossing rice seedlings with shortened heading period are obtained.
2. The improved method for shortening heading time in a high-quality rice with light as defined in claim 1, wherein the primers for PCR amplification in step (1) are as follows:
ghd7 target one primer: the sequence of forward primer gRT-g 7 is shown as sequence 24; the reverse primer OsU aT1-g7 sequence is shown as sequence 25;
Ghd7 target two primers: the sequence of forward primer gRT-g 7 is shown as sequence 26; the reverse primer OsU T6-g7 sequence is shown as sequence 27;
hd1 target-primer: the forward primer gRT-H1 sequence is shown as sequence 28; the reverse primer OsU bT2-H1 sequence is shown in SEQ ID NO. 29;
Hd1 target two primers: the forward primer gRT-H1 sequence is shown as sequence 30; the reverse primer OsU cT3-H1 sequence is shown in SEQ ID NO. 31;
The templates used for PCR amplification were:
The sequence of template U6a is shown as sequence 32; the sequence of U6b is shown as sequence 33; the sequence of U6c is shown as sequence 34.
3. The improved method for shortening heading time in a high-quality rice with light as defined in claim 1, wherein the specific steps of plant callus culture in step (3) are:
Selecting rice seeds harvested in the current year, and removing hulls; preparing a plurality of small conical flasks of 100ml, preparing a rice induction culture medium, and sterilizing at high temperature; soaking the shelled seeds in 75% alcohol for 2-3min, soaking in mercuric chloride solution for 18min, and sterilizing; spreading sterilized seeds on an induction culture medium, and culturing at 25deg.C in dark for 40-60 days.
4. The improved method for shortening heading time in a high-quality rice with light as defined in claim 1, wherein the specific steps of the transfection in the step (4) are as follows:
Thawing the agrobacterium strain stored at-80 ℃ and carrying out line drawing culture on an LB culture medium; after 48 hours of cultivation, agrobacterium transfection was performed when macroscopic, milky smooth colonies appeared on the medium; scraping agrobacterium with a fungus inoculating ring onto a suspension culture medium, shaking for 20-30min, pouring the callus into the fungus liquid after the fungus liquid is turbid, and soaking for 10 min; air-dried, and then placed into a constant temperature incubator at 20 ℃ for dark culture for 48 hours.
5. The improved method for shortening heading time in a high-quality rice with light as defined in claim 1, wherein the specific steps of the screening in the step (4) are as follows:
firstly, cleaning the calluses infected by the agrobacterium with sterilized water for 7-8 times; washing off the agrobacterium on the surface, airing and then continuing dark culture; and (3) screening the black hard resistant callus for the second time.
6. The improved method for shortening heading time in a high-quality rice with light as defined in claim 1, wherein the specific steps of the differentiation of the step (4) are as follows:
when the yellow new callus is regenerated from the resistant callus, differentiation is carried out, the new callus is transferred to a differentiation medium, transferred to an illumination incubator for culture, and transplanted to a greenhouse when the seedling reaches 10 cm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410126706.6A CN117925698A (en) | 2024-01-30 | 2024-01-30 | Improved method for shortening heading period in high-quality rice polishing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202410126706.6A CN117925698A (en) | 2024-01-30 | 2024-01-30 | Improved method for shortening heading period in high-quality rice polishing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117925698A true CN117925698A (en) | 2024-04-26 |
Family
ID=90757398
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202410126706.6A Pending CN117925698A (en) | 2024-01-30 | 2024-01-30 | Improved method for shortening heading period in high-quality rice polishing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117925698A (en) |
-
2024
- 2024-01-30 CN CN202410126706.6A patent/CN117925698A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108239647B (en) | Gene and molecular marker for controlling rape plant type and application | |
| CN111440804B (en) | Application of corn ZmBES1/BZR1-5 gene in cultivation of large-grain plants | |
| CN109234288B (en) | Application of rape BnA9-2 gene in improving pod shatter resistance of rape | |
| CN108503700B (en) | Rice grain type protein and coding gene and application thereof | |
| CN114990139B (en) | Application of CsHLS1 gene or protein encoded by same in regulation and control of organ size of cucumber plant | |
| CN115843674A (en) | Breeding method of corn haploid induction line and application thereof | |
| CN108085320B (en) | Dominant early maturing gene Ef-cd of rice and application thereof | |
| CN114277041B (en) | Application of soybean gibberellin 3 beta-hydroxylase encoding gene GmGA3ox1 | |
| CN113186200B (en) | A pair of genes ClTFL/Cltfl1 for controlling existence and lateral branch of watermelon tendril and application thereof | |
| CN112538486B (en) | Gene for controlling corn plant height, protein coded by gene and application of gene | |
| CN115820659A (en) | Application of C2H2 type zinc finger protein gene HSTL in regulation and control of rice heading time | |
| CN117925698A (en) | Improved method for shortening heading period in high-quality rice polishing | |
| CN111073896B (en) | Gene for controlling corn grain filling, encoding product, primer, carrier and application | |
| CN109371041B (en) | Rice gene OsHGN for increasing grain number per ear and application thereof | |
| US10750701B2 (en) | Vernalization independent lisianthus plants | |
| CN116790621B (en) | Application of rice OsZF gene in regulating seed size | |
| CN116640768B (en) | Wheat powdery mildew resistance gene PmTR1 and application thereof | |
| CN116515893B (en) | Application of OsbHLH6 gene and protein thereof in improving crop cold tolerance | |
| CN108575729B (en) | Method for creating ornamental rice germplasm by using three rice transcription factor genes | |
| CN112391403B (en) | Application of TGW10 gene in improvement of crop grain type traits | |
| CN115386585A (en) | Tobacco multi-branch and dwarf gene and application thereof | |
| CN116217684A (en) | ZmWRKY60 gene mutant and application thereof in regulation of corn plant height | |
| Zheng et al. | Human agricultural activities influence the flowering time of turnip in the Qinghai-Tibet Plateau | |
| CN116286955A (en) | Application of variable shear product in improving plant biomass, yield, salt resistance and shortening growth cycle | |
| CN117887729A (en) | Cloning and application of cauliflower main stem height regulating gene CauSH6.1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication |