CN117925556A

CN117925556A - Bulbil Ai Mazhong flavone glycoside glycosyltransferase LbUGT AE1 and encoding gene and application thereof

Info

Publication number: CN117925556A
Application number: CN202410179064.6A
Authority: CN
Inventors: 陈士林; 向丽; 王文婷; 高冉冉; 邬兰; 师玉华; 尹青岗; 王梦月; 万会花
Original assignee: Institute of Materia Medica of CAMS
Current assignee: Institute of Materia Medica of CAMS
Priority date: 2024-02-09
Filing date: 2024-02-09
Publication date: 2024-04-26

Abstract

The invention discloses a bulbifer Ai Mazhong flavone glycoside glycosyltransferase LbUGT AE1 and a coding gene and application thereof. The amino acid sequence of the flavonoid glycoside glycosyltransferase LbUGT AE1 is shown as SEQ ID NO. 2. The nucleotide sequence of the encoding gene of the flavonoid glycoside glycosyltransferase LbUGT AE1 is shown as SEQ ID NO. 1. Based on the related results of sequencing of the second generation transcriptome and the full-length third generation transcriptome of the bulbil Ai Ma, the invention uses a reverse genetics method to screen and identify the key enzyme LbUGT AE1 of the final step of the synthesis of the bulbil Ai Mazhong flavone glycoside, and fills the terminal blank of the biosynthesis path of the bulbil Ai Mazhong flavone glycoside.

Description

Bulbil Ai Mazhong flavone glycoside glycosyltransferase LbUGT AE1 and encoding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a bulbil Ai Mazhong flavone glycoside glycosyltransferase LbUGT AE1, and a coding gene and application thereof.

Background

Bulbil Ai Ma (Laportea bulbifera) is a plant of the genus Ai Ma of the family Urticaceae, and is mainly produced in Guizhou and other places, and fresh or dried whole herb (also called hong He Ma) is used for treating diseases such as rheumatalgia, limb numbness, traumatic injury and the like by local minority nationality and Brix. The dryness-moistening itching-relieving capsule taking the red-grass hemp as the main raw material has good curative effect, and is ranked third in the skin anorectal field of the wide variety of Chinese medicine technology competitive ranking list in 2018. The clinical application of the prior bulbil Ai Ma mainly depends on the excavation of wild resources, and along with the wide application of the safflower, the hemp and the preparation thereof, the wild resources are increasingly deficient, and the development of the bulbil Ai Ma industry is severely restricted.

The flavonoid components widely exist in plants, medicines and human diets, and modern researches show that the flavonoid has the biological activities of anti-inflammatory, antioxidant and the like, and plays an important role in resisting biotic and abiotic stress of plants. Bulbil Ai Masheng is longer than high-salt and arid karst regions, and flavone and its glycosides are one of the main chemical components in bulbil Ai Ma, however, its biosynthetic pathway and its key enzyme studies remain blank.

Glycosylation reactions in the biosynthetic pathway of flavonoid glycosides are accomplished by the uridine diphosphate activated glycosyltransferase (UDP-glycosyltransferase, UGT) family of enzymes. More UGT genes have been identified and reported to have flavonol glycosyltransferase activity, such as MrUGT R1 and MrUGT W1 in Myrica rubra (Morella rubra) which catalyze the addition of myricetin 3-O-rhamnose and 3-O-galactose, respectively. The strawberry (Fragaria x ananassa) can catalyze the 3-O-glucosylation of flavonols. However, the number and functional diversity of UGTs in angiosperm are also continuously changed due to the occurrence of tandem repetition, and the research on the functions and the catalytic mechanism of UGTs still needs to be further developed, thus laying a foundation for the metabolic engineering research of flavonoid components.

FIG. 1 is a molecular structural formula of kaempferol, myricetin, gossypin, quercitin, kaempferol-3-O-glucoside/galactoside, myricetin-3-O-glucoside/galactoside, gossypin-3-O-glucoside/galactoside, and quercitin-3-O-glucoside/galactoside.

Disclosure of Invention

In view of the above, the invention provides the bulbifer Ai Mazhong flavone glycoside glycosyltransferase LbUGT AE1, and the encoding gene and the application thereof, and fills the terminal blank of the biosynthesis path of the bulbifer Ai Mazhong flavone glycoside.

The technical scheme of the invention is as follows:

A protein has an amino acid sequence shown in SEQ ID NO. 2.

The invention also provides a coding gene of the protein, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

This gene was designated LbUGT AE1 and the protein encoded by it was designated LbUGT AE1. The specific information is as follows: the LbUGT AE1 gene sequence is shown as sequence 1 in a sequence table, the sequence 1 contains 1347 nucleotides, the coding sequence of the LbUGT AE1 gene is protein shown as sequence 2 in the sequence table, and the sequence 2 is composed of 448 amino acids.

The expression cassette, recombinant expression vector or recombinant bacteria containing the coding gene also belong to the protection scope of the invention.

The primer pair for amplifying the full length of the coding gene also belongs to the protection scope of the invention, wherein one primer sequence is shown as SEQ ID NO. 3, and the other primer sequence is shown as SEQ ID NO. 4.

The use of said proteins as glycosyltransferases is also within the scope of the invention.

The glycosyltransferase is an enzyme with any one of the following functions:

(1) Catalyzing substrate kaempferol to generate kaempferol-3-O-galactoside when UDP-galactose is used as a sugar donor;

(2) Catalyzing substrate kaempferol to generate kaempferol-3-O-glucoside when UDP-glucose is used as a sugar donor;

(3) Catalyzing substrate myricetin to generate myricetin-3-O-galactoside when UDP-galactose is used as a sugar donor;

(4) Catalyzing substrate myricetin to generate myricetin-3-O-glucoside when UDP-glucose is used as a sugar donor;

(5) Catalyzing substrate gossypin to generate gossypin-3-O-galactoside when UDP-galactose is used as a sugar donor;

(6) Catalyzing substrate gossypin to generate gossypin-3-O-glucoside when UDP-glucose is used as a sugar donor;

(7) Catalyzing substrate quercitin to generate quercitin-3-O-galactoside when UDP-galactose is used as sugar donor;

(8) When UDP-glucose is used as a sugar donor, a catalytic substrate of the quercitin is quercitin-3-O-glucoside.

The application of the protein in any one of the following also belongs to the protection scope of the invention:

The application of the coding gene in any one of the following also belongs to the protection scope of the invention:

Based on the relative results of sequencing of the second generation transcriptome and the third generation full-length transcriptome of the bulbil Ai Ma, the invention uses a reverse genetics method to identify kaempferol-3-O-glucoside/galactoside, myricetin-3-O-glucoside/galactoside, gossypin-3-O-glucoside/galactoside and final step key enzyme LbUGT AE1 for synthesizing the quercitin-3-O-glucoside/galactoside, fills the blank of the biosynthesis pathway of flavonoid glycoside components in the bulbil Ai Ma, and provides glycosyltransferase proteins and coding sequences thereof for further biosynthesis of kaempferol-3-O-glucoside/galactoside, myricetin-3-O-glucoside/galactoside and quercitin-3-O-glucoside/galactoside.

The invention excavates and identifies the key UGT of the bulbifera Ai Mazhong in the biosynthesis of the flavonoid glycoside active ingredient, has important significance for understanding the quality formation of the bulbifera Ai Ma, and provides a key element for the research of the synthesis biology of the flavonoid ingredient.

Drawings

For purposes of illustration and not limitation, the invention will now be described in accordance with its preferred embodiments, particularly with reference to the accompanying drawings, in which:

FIG. 2 shows the expression of LbUGT AE1 gene in different tissues of bulbil Ai Ma. B: bulbil; f: flower; l: leaves; r: root; s: stems.

FIG. 3 is a diagram showing agarose gel electrophoresis of LbUGT AE1 gene clone and vector construction, wherein the left side shows the result of LbUGT AE1 gene clone in lane 1, and the right side shows the result of pMAL-c2X-LbUGT AE1 vector construction in FIGS. 1-6. The remaining lanes are the results of other gene clones cloned in the same batch.

FIG. 4 shows agarose gel electrophoresis of recombinant plasmid results of LbUGT AE1 gene transferred into BL21 (DE 3) E.coli, wherein lanes 1 and 2 are LbUGT AE1. The remaining lanes are the results of other genes transformed simultaneously.

FIG. 5 is a diagram of a LbUGT AE1 recombinant purified protein SDS-Page gel in which lane 1 is LbUGT AE1. The remaining lanes are the results of other purified enzymes done simultaneously.

FIG. 6 shows the results of LC-Q-TOF-MS identification of the catalytic product of recombinant protein LbUGT AE1 on kaempferol.

FIG. 7 shows the results of LC-Q-TOF-MS identification of the catalytic product of recombinant protein LbUGT AE1 on myricetin.

FIG. 8 shows the results of LC-Q-TOF-MS identification of recombinant protein LbUGT AE1 on the catalytic product of gossypin.

FIG. 9 is a graph showing the identification of the catalytic product of recombinant protein LbUGT AE1 on quercus marigold by LC-Q-TOF-MS.

Detailed Description

The invention is described in detail below with reference to examples. The examples are provided for a better understanding of the present invention, but are not limited thereto. The experimental methods in the following implementation methods are all conventional methods, and the related experimental reagents are all conventional biochemical reagents.

Example 1 screening of UGTs genes based on the full-Length transcriptome of the third generation and the second generation of the transcriptome data of the bulbifera Ai Ma

1.1 Experimental methods

Bulbil Ai Ma (Laportea bulbifera) (non-patent document describing bulbil Ai Ma (Laportea bulbifera) is ：Wang,W.,Wang,X.,Shi,Y.et al.Identification of Laportea bulbifera using the complete chloroplast genome as a potentially effective super-barcode.J Appl Genetics 64,231–245(2023).https://doi.org/10.1007/s13353-022-00746-4) collected from Tripterygium wilfordii in southeast of Guizhou, and is divided into five parts of root, stem, leaf, flower and bulbil, and second and third generation sequencing is performed by means of Illumina platform and PacBio platform.

The UGT protein sequence of Arabidopsis was downloaded from Arabidopsis database (https:// www.arabidopsis.org /), blast homology analysis was performed on it with full length transcriptome database of bulbil Ai Ma, hidden Markov (HMM) model files of UGT protein were downloaded from Pfam (http:// Pfam-legacy. Xfam. Org /), and protein sequences containing UDT. HMM (PF 00201) domain were searched using HMMER (http:// HMMER. Janelia. Org/static/binaries/hmme r 3.0.0) software. Combining Blast homology alignment analysis results and HMMER domain search structure results, and screening sequences with similarity less than 30%, e value less than 10 ^-5 and length less than 300 amino acids. The transcripts described above were submitted to NCBI-CDD (https:// www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi) for validation of the UGT conserved domain, and the results were visualized using TBtools software, screening out protein sequences that did not contain the UGT conserved domain. The above transcripts were subjected to a conserved domain search using the Motif website (https:// meme-suite. Org/meme /) and only protein sequences with PSPG-box specific domains were retained. The protein sequence obtained by the above screening was determined as a UGT gene family member of bulbil Ai Ma (LbUGTs).

Using the third generation full length transcript as a reference, CLEAN READS obtained from the second generation transcript was aligned with the third generation transcript using HiSAT2 to obtain transcript position information. The transcript expression levels at different tissue sites were quantitatively analyzed by RSEM software to calculate the FPKM value. Differential expression analysis is carried out by adopting DESeq2 software, and LbUGTs genes with higher expression quantity are further screened out.

1.2 Results and analysis

Based on the full-length transcriptome data of the third generation of the bulbil Ai Ma, 114 conserved domains with PSPG-box of the UGTs sequence are screened out, and based on the differential expression analysis of the second generation of the transcriptome, the LbUGT78AE1 is found to be expressed higher at the bulbil part of the bulbil Ai Ma (figure 2), and the possible glycosyltransferase activity is presumed.

Example 2 cloning of candidate LbUGT78AE1 Gene in bulbil Ai Ma and construction of expression vector

2.1 Experimental methods

The pMAL-c2X-LbUGT AE1 expression vector was obtained by homologous recombination to design a primer sequence (as in Table 1), cloning LbUGT AE1 gene fragment (KOD Hi-Fi PCR system total volume 50. Mu.L: 25. Mu.L KOD One ^TM PCR MASTER Mix, 1.5. Mu.L primer (10 mM), 1. Mu.L template and 21. Mu.L water) using the bead site cDNA of bead Ai Ma as a template, and the procedure was as in Table 2.

TABLE 1 cloning LbUGT AE1 Gene primer sequences

TABLE 2KOD Hi-Fi enzyme PCR reaction procedure

The gene of interest was constructed into a pMAL-C2X vector (available from NEW ENGLAND Biolabs., product catalog number E8200S) with enzyme cleavage sites BamHI and SalI using ClonExpress II One Step Cloning Kit kit (available from Nanjinouzan Biotech Co., ltd., product catalog number C112). According to the instruction, the optimal cloning vector and the inserting fragment in the reaction system are used in a molar ratio of 1:2, and the optimal use amount is calculated by using the following formula:

Optimal cloning vector usage= [0.02×cloning vector base pair number ] ng (0.03 pmol)

Optimal amount of insert used= [0.04×base pair number of insert ] ng (0.06 pmol)

The composition of the reaction system is calculated as shown in Table 3:

TABLE 3 composition of homologous recombination reaction System

After all components are added, gently sucking and beating to mix the reaction liquid, then carrying out instantaneous centrifugation, and incubating at 37 ℃ for 30 minutes to obtain the pMAL-c2X-LbUGT AE1 recombinant product.

The conversion steps of the recombinant product were as follows: (1) Trans1-T1 competent cells (available from Beijing full gold Biotechnology Co., ltd., catalog number CD 501-02) were thawed on ice. 50. Mu.L of thawed Trans1-T1 competent cells were dispensed into pre-chilled 1.5mL centrifuge tubes. (2) To the centrifuge tube, 5. Mu.L of the reconstituted product was added, gently mixed, and ice-bathed for 30 minutes. (3) After heat shock in a 42 ℃ water bath for 30 seconds, the solution was quickly transferred to an ice bath for 2 minutes without shaking the centrifuge tube. (4) mu.L of transformed competent cells were aspirated, spread evenly on ampicillin-resistant LB agar medium, and incubated with the inverted plate in an incubator at 37℃for 12-16 hours.

The screening procedure for positive clones was as follows: (1) The grown monoclonal on 7 LbUGT recombinant plates was picked up and incubated in 200. Mu.L LB liquid medium (ampicillin resistance) in a shaker at 37℃for 2 hours (200 rpm). (2) Colony PCR was performed using 2 XTaq Mix DNA polymerase (available from Nanjinouzan Biotech Co., ltd., product catalog number P131-01). The amplification Primer sequences designed using Primer 6.0 were: pMAL-c2X-F GTCGTCAGACTGTCGATGAAG; pMAL-c2X-R GATGTGCTGCAAGGCGATT. The conventional PCR reaction system is shown in Table 4. The conventional PCR reaction procedure is shown in Table 5. (3) And 5 mu L of PCR products are taken for agarose gel electrophoresis detection, and bacterial liquid with reasonable strip positions is selected and sent to Beijing Nocel genome research center Co., ltd for detection by referring to DNA MARKER (purchased from Beijing full gold biotechnology Co., ltd., product catalog number BM 111-01) positions. Alignment with the RNAseq sequence to obtain final sequence information.

TABLE 4 composition of conventional PCR reaction System

TABLE 5 routine PCR reaction procedure

2.2 Experimental results

LbUGT78AE1 was cloned using the primers of Table 1 and the results of the agarose gel electrophoresis test are shown in FIG. 3. Sequencing to obtain the sequence, and Blast comparison to find 99% similarity between the nucleotide sequence and the original data, based on the actual sequencing result. The actual sequencing result is shown as a sequence 1, contains 1347 nucleotides, and the protein shown as a sequence 2 in the coding sequence table consists of 448 amino acids. This gene was designated LbUGT AE1 and the protein encoded by it was designated LbUGT AE1.

Example 3 functional verification of candidate LbUGT AE1 Gene

3.1 Experimental methods

The transformation procedure of the recombinant plasmid was as follows: (1) BL21 (DE 3) competent cells (available from Tiangen Biochemical technology (Beijing) Co., ltd., catalog number CB 105-02) were thawed on ice. 50. Mu.L of BL21 (DE 3) competent cells after thawing were dispensed into pre-chilled 1.5mL centrifuge tubes. (2) mu.L of pMAL-c2X-LbUGT AE1 recombinant plasmid was added to the centrifuge tube, gently mixed, and ice-bathed for 30 minutes. (3) After heat-shock in a 42 ℃ water bath for 90 seconds, the solution was quickly transferred to an ice bath for 2 minutes without shaking the centrifuge tube. (4) mu.L of transformed competent cells were aspirated, spread evenly on ampicillin-resistant LB agar medium, and incubated with the inverted plate in an incubator at 37℃for 12-16 hours.

The steps of induction expression are as follows: (1) And (3) picking the monoclonal on the transformed LB solid medium, and carrying out colony conventional PCR verification, wherein the method is the same as that described above. (2) mu.L of positive clone broth was aspirated and cultured overnight (37 ℃ C., 200 rpm) in 20mL of LB liquid medium (ampicillin resistance). (3) 2mL of the overnight cultured broth was transferred to 40mL of LB liquid medium (ampicillin resistance), and cultured at 37℃and 200rpm until the OD600 of the broth became 0.8 (about 2 hours). (4) 15. Mu.L of IPTG (1M, isopropyl-. Beta. -D-thiogalactoside) was added to the bacterial liquid, and the mixture was shaken well and subjected to induction culture at 16℃and 110rpm for 16-24 hours.

The protein purification steps are as follows: collecting the induced bacterial liquid, centrifuging at 4 ℃ and 7800rpm for 5 minutes, and discarding the supernatant; the bacterial pellet was washed with 3mL of pre-chilled Tris-HCl (pH 7.5), centrifuged at 7800rpm at 4℃for 3 min and the supernatant discarded. The cells were resuspended by adding 1.5mL Tris-HCl (pH 7.5) buffer and transferred to a 2mL centrifuge tube. The resuspended bacteria liquid was broken for 20 minutes using an ultrasonic cytobreaker (30 Hz, 5 seconds of operation, 5 seconds of stop) and the color changed from milky to translucent, the whole process was carried out on ice. The crushed resuspension bacterial liquid is centrifugated for 30 minutes at the temperature of 4 ℃ and the speed of 12000rpm, and the supernatant is the crude enzyme solution.

Protein purification procedure referring to PurKine ^TM maltose binding protein tag protein purification kit (available from subfamily biotechnology Co., ltd., catalog KTP 2020), the whole procedure was carried out in a refrigerator at 4℃as follows: (1) Fixing a gravity column, taking down plugs at two ends, and draining protective liquid; (2) Adding 2mL of washing solution (Binding buffer) to the column to balance the resin, and repeating the steps for 3 times after the resin is drained; (3) The crude enzyme solution and an equal volume of wash solution were mixed to make a protein sample. Adding a protein sample into a column for incubation, collecting a flow-through liquid, and repeating for 5 times; (4) 2mL of wash was added to the column to remove non-specific proteins, and the procedure was repeated 6 times, using Coomassie brilliant blue solution to detect the protein content. (5) 2mL of an eluent (Elution Buffer) was added to the column, and specific proteins (containing maltose label) were eluted, and the procedure was repeated 5 times, using coomassie brilliant blue solution to detect the protein content. The eluent collected in the step is the purified protein solution. (6) desalting and concentrating: the purified protein solution was added to an ultrafiltration tube (30 kDa), centrifuged at 3800 Xg at 4℃for 30 minutes, and then 10mL of protein substitution solution (50 mM Tris-HCl (pH 7.5), 10mM DTT) was added in batch to the tube, followed by centrifugation again. The remaining solution in the suction tube is the purified enzyme solution after desalination. (7) Protein concentration standard curves were established using Easy Protein Quantitative Kit (Bradford) protein concentration determination kit (available from the company, inc. Of holo gold, beijing, catalog DQ 101-01) and the concentration of the concentrated protein was determined by reference to the instructions for use. (8) SDS-PAGE protein gel detection: mu.L of purified enzyme solution was added to 20. Mu.L of 5 Xprotein loading buffer, and after mixing, the mixture was boiled for 5 minutes and centrifuged at 12000rpm for 5 minutes. And loading 40 mu L of supernatant, and ending electrophoresis under 150V for 40-50 minutes until a bromophenol blue indicator tape reaches the bottom of the silica gel. After 30 minutes of staining, the cells were placed in a decolorization solution for 1 hour, followed by replacement of the decolorization solution for overnight decolorization. The next day the protein gel was placed in a scanner for imaging.

The in vitro enzyme activity detection steps are as follows: 50. Mu.L of the reaction system contained 1. Mu.L of the flavone substrate (40 mM) (kaempferol or myricetin or gossypin or quercetin) 1. Mu.L of UDP-sugar donor (100 mM) (UDP-galactose or UDP-glucose) and 10. Mu.g of purified enzyme, tris-HCl (pH 7.5) buffer was used to supplement the system. The reaction system was placed at 37℃for 1 hour with the empty crude enzyme catalytic system containing pMAL-c2X as a negative control, and the reaction was terminated by adding an equal volume of methanol. The mixture was concentrated in vacuo and reconstituted by the addition of 100. Mu.L of methanol. Filtration was performed using a 0.22 μm microporous filter membrane and samples were transferred to liquid phase vials for detection analysis. The sample is detected by using Agilent 1290 Infinicity II-6430Q-TOF, and the specific liquid phase conditions are as follows: (1) chromatography column: ACQUITY UPLC BEH C18.1.7 μm 2.1X100 mm; (2) mobile phase: phase A is 0.1% pure water, and phase B is chromatographic acetonitrile; (3) flow rate: column temperature of 0.3 mL/min (4): 40 ℃; sample injection amount (5): 1.0. Mu.L; (6) elution conditions are shown in Table 6. The mass spectrum conditions are as follows: the ion mode is negative ion, and the scanning range is 100-3000; the mode is Automated MS/MS; ion fragment collision energy is 20V; the source temperature is 350 ℃; the atomizer pressure was set at 30psi.

TABLE 6 gradient of mobile phase elution during LC-Q-TOF detection

3.2 Experimental results

LbUGT78A recombinant protein of AE1 was successfully transferred into E.coli (FIG. 4) and expressed and further enzyme activity analysis was performed to identify their function. The donor of the enzymatic reaction is UDP-glucose or UDP-galactose, and the acceptor is kaempferol (C ₁₅H₁₀O₆, purchased from Shanghai Seikovia Biotechnology Co., ltd., catalog number: B21126) or myricetin (C ₁₅H₁₀O₈, purchased from Shanghai Seikovia Biotechnology Co., ltd., catalog number: B21458) or gossypin (C ₁₅H₁₀O₈, purchased from Shanghai Seikovia Biotechnology Co., ltd., catalog number: B29179) or quercetin (C ₁₅H₁₀O₈, purchased from Shanghai Seikovia Biotechnology Co., ltd., catalog number: B29299), respectively. The product of the enzyme activity was identified by mass spectrometry, and LbUGT AE1 was found to have product peaks (P1-P8) for the enzyme activity reactions of kaempferol, myricetin, gossypin and quercetin as the receptors.

Compared with the detection result of a crude enzyme catalytic system containing pMAL-c2X empty, when kaempferol is used as a substrate and UDP-galactose is used as a sugar donor, the product P1 has the same retention time and mass spectrum cleavage law as kaempferol-3-O-galactoside (K3 Gal) ([ M-H ] ^-:m/z＝447.0935、[M-H-Gal]^-:m/z= 284.0325); when kaempferol was used as a substrate and UDP-glucose was used as a sugar donor, the product P2 had the same retention time and mass spectrum cleavage law as kaempferol-3-O-glucoside (K3 Glu) ([ M-H ] ^-:m/z＝447.0920、[M-H-Glu]^-: M/z= 284.0315) (FIG. 6).

Compared with the detection result of a crude enzyme catalytic system containing pMAL-c2X empty, when myricetin is used as a substrate and UDP-galactose is used as a sugar donor, the product P3 has the same retention time and mass spectrum cleavage rule as myricetin-3-O-galactoside (M3 Gal) ([ M-H ] ^-:m/z＝479.0830、[M-H-Gal]^-:m/z= 316.0224); when myricetin was used as a substrate and UDP-glucose was used as a sugar donor, the product P4 was judged as myricetin-3-O-glucoside (M3 Glu) ([ M-H ] ^-:m/z＝479.0828、[M-H-Glu]^-:m/z= 316.0226) according to the cleavage rule (FIG. 7).

Compared with the detection result of a crude enzyme catalytic system containing pMAL-c2X empty, when gossypin is taken as a substrate and UDP-galactose is taken as a sugar donor, the product P5 is judged to be gossypin-3-O-galactoside (G3 Gal) according to a cleavage rule ([ M-H ] ^-:m/z＝479.0820、[M-H-Gal]^-:m/z= 316.0204); when gossypin was used as a substrate and UDP-glucose was used as a sugar donor, the product P6 was judged to be gossypin-3-O-glucoside (G3 Glu) ([ M-H ] ^-:m/z＝479.0868、[M-H-Glu]^-:m/z= 316.0243) according to the cleavage rule (FIG. 8).

Compared with the detection result of the crude enzyme catalytic system containing pMAL-c2X empty load, when quercetin is taken as a substrate and UDP-galactose is taken as a sugar donor, the product P7 is judged to be quercetin-3-O-galactoside (Q3 Gal) ([ M-H ] ^-:m/z＝479.0830、[M-H-Gal]^-:m/z= 316.0223) according to the cleavage rule, and when quercetin is taken as a substrate and UDP-glucose is taken as a sugar donor, the product P8 is judged to be quercetin-3-O-glucoside (Q3 Glu) ([ M-H ] ^-:m/z＝479.0823、[M-H-Glu]^-:m/z= 316.0226) according to the cleavage rule (FIG. 9).

In sum, based on mass spectrometry detection data, it is determined that glycosyltransferase LbUGT AE1 has the functions of catalyzing kaempferol to generate kaempferol-3-O-glucoside/galactoside, catalyzing myricetin to generate myricetin-3-O-glucoside/galactoside, catalyzing gossypin to generate gossypin-3-O-glucoside/galactoside, and catalyzing quercitin to generate quercitin-3-O-glucoside/galactoside.

The invention mainly obtains a sequence of the flavonoid glycosyltransferase of the bulbil Ai Mazhong through three-generation full-length transcriptome analysis, and confirms that when the recombinant protein LbUGT AE1 takes UDP-glucose as a donor, the invention can catalyze kaempferol to generate kaempferol-3-O-glucoside, myricetin to generate myricetin-3-O-glucoside, myricetin to generate gossypin-3-O-glucoside and quercitin to generate quercitin-3-O-glucoside; when UDP-galactose is used as a donor, kaempferol can be catalyzed to generate kaempferol-3-O-galactoside, myricetin can be catalyzed to generate myricetin-3-O-galactoside, gossypin can be catalyzed to generate gossypin-3-O-galactoside, and quercitin can be catalyzed to generate quercitin-3-O-galactoside.

The above embodiments do not limit the scope of the present invention. It will be apparent to those skilled in the art that various modifications, combinations, sub-combinations and alternatives can occur depending upon design requirements and other factors. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of the present invention.

Claims

1. A protein has an amino acid sequence shown in SEQ ID NO. 2.

2. The protein-encoding gene of claim 1, wherein: the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

3. An expression cassette, recombinant expression vector or recombinant bacterium comprising the coding gene of claim 2.

4. A primer pair for amplifying the full length of the coding gene as claimed in claim 2, wherein one primer sequence is shown in SEQ ID NO. 3, and the other primer sequence is shown in SEQ ID NO. 4.

5. Use of the protein of claim 1 as a glycosyltransferase.

6. The use according to claim 5, characterized in that: the glycosyltransferase is an enzyme with any one of the following functions:

7. Use of the protein of claim 1 in any of the following:

8. Use of the coding gene of claim 2 in any of the following: