CN117844778A

CN117844778A - Bulbil Ai Mazhong flavonoid glycoside glycosyltransferase LbUGT72CT1 and encoding gene and application thereof

Info

Publication number: CN117844778A
Application number: CN202410179082.4A
Authority: CN
Inventors: 向丽; 尹青岗; 王文婷; 高冉冉; 师玉华; 邬兰; 王梦月; 万会花
Original assignee: Institute of Materia Medica of CAMS
Current assignee: Institute of Materia Medica of CAMS
Priority date: 2024-02-09
Filing date: 2024-02-09
Publication date: 2024-04-09

Abstract

The invention discloses a bulbil Ai Mazhong flavonoid glycoside glycosyltransferase LbUGT72CT1 and a coding gene and application thereof. The amino acid sequence of the flavonoid glycoside glycosyltransferase LbUGT72CT1 is shown as SEQ ID NO. 2. The nucleotide sequence of the encoding gene of the flavonoid glycoside glycosyltransferase LbUGT72CT1 is shown as SEQ ID NO. 1. Based on the related results of sequencing of the second generation transcriptome and the full-length third generation transcriptome of the bulbil Ai Ma, the invention uses a reverse genetics method to screen and identify the key enzyme LbUGT72CT1 in the last step of the synthesis of the bulbil Ai Mazhong flavone glycoside, and fills the terminal blank of the biosynthesis path of the bulbil Ai Mazhong flavone glycoside.

Description

Bulbil Ai Mazhong flavonoid glycoside glycosyltransferase LbUGT72CT1 and encoding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a bulbil Ai Mazhong flavonoid glycoside glycosyltransferase LbUGT72CT1, and a coding gene and application thereof.

Background

Bulbil Ai Ma (Laportea bulbifera) is a plant of the genus Ai Ma of the family Urticaceae, and is mainly produced in Guizhou and other places, and fresh or dried whole herb (also called hong He Ma) is administered to local Miao nationality and Brix and other minority nationality, and is used for treating rheumatalgia, numbness of limbs, traumatic injury and other diseases. The dryness-moistening itching-relieving capsule taking the red-grass hemp as the main raw material has good curative effect, and is ranked third in the skin anorectal field of the wide variety of Chinese medicine technology competitive ranking list in 2018. The clinical application of the prior bulbil Ai Ma mainly depends on the excavation of wild resources, and along with the wide application of the hong He herb and the preparation thereof, the wild resources are increasingly deficient, and the development of the bulbil Ai Ma industry is severely restricted.

The flavonoid components widely exist in plants, medicines and human diets, and modern researches show that the flavonoid has the biological activities of anti-inflammatory, antioxidant and the like, and plays an important role in resisting biotic and abiotic stress of plants. Bulbil Ai Masheng is longer than high-salt and arid karst regions, and flavones and their glycosides are one of the main chemical components in bulbil Ai Ma, however, their biosynthetic pathways and their key enzyme studies remain blank.

Glycosylation reactions in the biosynthetic pathway of flavonoid glycosides are accomplished by the uridine diphosphate activated glycosyltransferase (UGT) family of enzymes. More UGT genes have been identified and reported to have flavonol glycosyltransferase activity, such as MrUGT78R1 and MrUGT78W1 in Myrica rubra (Morella rubra), which catalyze the addition of myricetin 3-O-rhamnose and 3-O-galactose, respectively. Strawberry (Fragaria x ananassa) may catalyze 3-O-glucosylation of flavonols. However, the number and functional diversity of UGTs in angiosperm are also continuously changed due to the occurrence of tandem repetition, and the research on the functions and the catalytic mechanism of UGTs still needs to be further developed, thus laying a foundation for the metabolic engineering research of flavonoid components.

FIG. 1 is a molecular structural formula of kaempferol, myricetin, gossypin, quercitin, kaempferol-3-O-glucoside/galactoside, myricetin-3-O-glucoside/galactoside, gossypin-3-O-glucoside/galactoside, and quercitin-3-O-glucoside/galactoside.

Disclosure of Invention

In view of the above, the invention provides the bulbil Ai Mazhong flavonoid glycoside glycosyltransferase LbUGT72CT1, and the encoding gene and application thereof, and fills the terminal blank of the biosynthesis path of the bulbil Ai Mazhong flavonoid glycoside.

The technical scheme of the invention is as follows:

a protein has an amino acid sequence shown in SEQ ID NO. 2.

The invention also provides a coding gene of the protein, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

This gene was designated as LbUGT72CT1 and the protein encoded by it was designated as LbUGT72CT1. The specific information is as follows: the LbUGT72CT1 gene sequence is shown as a sequence 1 in a sequence table, wherein the sequence 1 contains 1443 nucleotides, encodes a protein shown as a sequence 2 in the sequence table, and the sequence 2 consists of 480 amino acids.

The expression cassette, recombinant expression vector or recombinant bacteria containing the coding gene also belong to the protection scope of the invention.

The primer pair for amplifying the full length of the coding gene also belongs to the protection scope of the invention, wherein one primer sequence is shown as SEQ ID NO. 3, and the other primer sequence is shown as SEQ ID NO. 4.

The use of said proteins as glycosyltransferases is also within the scope of the invention.

The glycosyltransferase is an enzyme with any one of the following functions:

(1) Catalyzing substrate kaempferol to generate kaempferol-3-O-galactoside when UDP-galactose is used as a sugar donor;

(2) Catalyzing substrate kaempferol to generate kaempferol-3-O-glucoside when UDP-glucose is used as a sugar donor;

(3) Catalyzing substrate myricetin to generate myricetin-3-O-galactoside when UDP-galactose is used as a sugar donor;

(4) Catalyzing substrate myricetin to generate myricetin-3-O-glucoside when UDP-glucose is used as a sugar donor;

(5) Catalyzing substrate gossypin to generate gossypin-3-O-galactoside when UDP-galactose is used as a sugar donor;

(6) Catalyzing substrate gossypin to generate gossypin-3-O-glucoside when UDP-glucose is used as a sugar donor;

(7) Catalyzing substrate quercitin to generate quercitin-3-O-galactoside when UDP-galactose is used as sugar donor;

(8) When UDP-glucose is used as a sugar donor, a catalytic substrate of the quercitin is quercitin-3-O-glucoside.

The application of the protein in any one of the following also belongs to the protection scope of the invention:

The application of the coding gene in any one of the following also belongs to the protection scope of the invention:

Based on the relative results of sequencing of the second generation transcriptome and the third generation full-length transcriptome of the bulbil Ai Ma, the invention uses a reverse genetics method to identify kaempferol-3-O-glucoside/galactoside, myricetin-3-O-glucoside/galactoside, gossypin-3-O-glucoside/galactoside and the final step key enzyme LbUGT72CT1 for synthesizing the quercitin-3-O-glucoside/galactoside, fills the blank of the biosynthesis path of flavonoid glycoside components in the bulbil Ai Ma, and provides glycosyltransferase proteins and coding sequences thereof for further biosynthesis of kaempferol-3-O-glucoside/galactoside, myricetin-3-O-glucoside/galactoside and quercitin-3-O-glucoside/galactoside.

The invention excavates and identifies the key UGT of the bulbil Ai Mazhong involved in the biosynthesis of flavonoid glycoside active ingredients, has important significance for understanding the quality formation of the bulbil Ai Ma, and provides a key element for the research of the synthesis biology of flavonoid ingredients.

Drawings

For purposes of illustration and not limitation, the invention will now be described in accordance with its preferred embodiments, particularly with reference to the accompanying drawings, in which:

FIG. 2 shows the expression of the LbUGT72CT1 gene in different tissues of the bulbil Ai Ma. B: bulbil; f: flower; l: leaves; r: root; s: stems.

FIG. 3 is an agarose gel electrophoresis of LbUGT72CT1 gene clone and vector construction. Lane 2 on the left shows the results of LbUGT72CT1 gene cloning, and FIGS. 1-7 on the right show the results of pMAL-c2X-LbUGT72CT1 vector construction. The remaining lanes are the results of other gene clones cloned in the same batch.

FIG. 4 shows agarose gel electrophoresis of recombinant plasmid results of LbUGT72CT1 gene transferred into BL21 (DE 3) E.coli, wherein lanes 3 and 4 are LbUGT72CT1. The remaining lanes are the results of other genes transformed simultaneously.

FIG. 5 is a SDS-Page gel of the recombinant purified protein LbUGT72CT1, lane 2 being LbUGT72CT1. The remaining lanes are the results of other purified enzymes done simultaneously.

FIG. 6 shows the results of LC-Q-TOF-MS identification of the catalytic product of recombinant protein LbUGT72CT1 on kaempferol.

FIG. 7 shows the results of LC-Q-TOF-MS identification of the catalytic product of myricetin by recombinant protein LbUGT72CT1.

FIG. 8 shows the results of LC-Q-TOF-MS identification of the catalytic product of recombinant protein LbUGT72CT1 on gossypin.

FIG. 9 shows the identification result of LC-Q-TOF-MS to identify the catalytic product of recombinant protein LbUGT72CT1 on quercitin.

Detailed Description

The invention is described in detail below with reference to examples. The examples are provided for a better understanding of the present invention, but are not limited thereto. The experimental methods in the following implementation methods are all conventional methods, and the related experimental reagents are all conventional biochemical reagents.

Example 1 screening and phylogenetic analysis of UGTs genes based on the full-length transcriptome of third generation and the transcriptome data of second generation of bulbil Ai Ma

1.1 Experimental methods

Bulbil Ai Ma (Laportea bulbifera) (non-patent literature describing bulbil Ai Ma (Laportea bulbifera) is Wang, W., wang, X., shi, Y.et al identification of Laportea bulbifera using the complete chloroplast genome as a potentially effective super-barcode.J Appl Genetics 64,231-245 (2023): https:// doi.org/10.1007/s 13353-022-00746-4) was collected from Tripterygium wilfordii, guizhou, and divided into five parts of root, stem, leaf, flower, and bulbil, and subjected to second and third generation sequencing by means of an Illumina platform and a PacBio platform.

The UGT protein sequence of Arabidopsis was downloaded from the Arabidopsis database (https:// www.arabidopsis.org /), blast homology analysis was performed with the full length transcriptome database of the bead Ai Ma, the hidden Markov (HMM) model file of UGT protein was downloaded from Pfam (http:// Pfam-legacy. Xfam. Org /), and the HMMER (http:// HMMER. Janelia. Org/static/binaries/hmme r 3.0) software was used to search for protein sequences containing the UDPGT. HMM (PF 00201) domain. Combining Blast homology alignment analysis results and HMMER structural domain search structure results, screening out similarity less than 30%, and e value less than 10 ^-5 Sequences less than 300 amino acids in length. Submitting the transcript toNCBI-CDD (https:// www.ncbi.nlm.nih.gov/Structure/bwrpsb. Cgi) was used to verify the conserved domain of UGT, and results were visualized using TBtools software to screen out protein sequences that did not contain the conserved domain of UGT. The transcripts described above were subjected to a conserved domain search using the Motif website (https:// me-suite. Org/me /) and only protein sequences with PSPG-box specific domains were retained. The protein sequence obtained by the screening in the above steps was determined as UGT gene family member (LbUGTs) of bulbil Ai Ma.

And using the third generation full-length transcript as a reference, and utilizing HiSAT2 to carry out sequence alignment on clear Reads obtained from the second generation transcriptome and the third generation transcript to obtain transcript position information. Quantitative analysis of transcript expression levels at different tissue sites was performed using RSEM software to calculate FPKM values. Differential expression analysis is carried out by adopting DESeq2 software, and LbUGT genes with higher expression quantity are further screened out.

1.2 results and analysis

Based on the full-length transcriptome data of the third generation of the bulbil Ai Ma, 114 conserved domains with PSPG-box of the UGT sequence are screened out, and based on the differential expression analysis of the second generation of the transcriptome, the higher expression of the LbUGT72CT1 at the bulbil position of the bulbil Ai Ma is found (figure 2), and the possible glycosyltransferase activity is presumed.

EXAMPLE 2 cloning of candidate LbUGT72CT1 Gene in bulbil Ai Ma and construction of expression vector

2.1 Experimental methods

Obtaining pMAL-c2X-LbUGT72CT1 expression vector by homologous recombination method, designing primer sequence (as shown in Table 1), cloning LbUGT72CT1 gene fragment by KOD high-fidelity enzyme with cDNA of bulbil part of bulbil Ai Ma as template (KOD high-fidelity enzyme PCR system total volume is 50 μL:25 μL KOD One) ^TM PCR Master Mix, 1.5. Mu.L primer (10 mM), 1. Mu.L template and 21. Mu.L water, procedure as in Table 2).

TABLE 1 primer sequences for cloning of the LbUGT72CT1 Gene

TABLE 2KOD Hi-Fi enzyme PCR reaction procedure

The gene of interest was constructed into the pMAL-C2X vector (available from New England Biolabs, catalog number E8200S) using the ClonExpII One Step Cloning Kit kit (available from Nanjinouzan Biotech Co., ltd., catalog number C112) with enzyme cleavage sites BamHI and SalI. According to the instruction, the optimal cloning vector and the inserting fragment in the reaction system are used in a molar ratio of 1:2, and the optimal use amount is calculated by using the following formula:

optimal cloning vector usage= [0.02×cloning vector base pair number ] ng (0.03 pmol)

Optimal amount of insert used= [0.04×base pair number of insert ] ng (0.06 pmol)

The composition of the reaction system is calculated as shown in Table 3:

TABLE 3 composition of homologous recombination reaction System

After all components are added, gently sucking and beating to mix the reaction liquid, then carrying out instantaneous centrifugation, and incubating at 37 ℃ for 30 minutes to obtain the pMAL-c2X-LbUGT72CT1 recombinant product.

The conversion steps of the recombinant product were as follows: (1) Trans1-T1 competent cells (available from Beijing full gold Biotechnology Co., ltd., catalog number CD 501-02) were thawed on ice. 50. Mu.L of thawed Trans1-T1 competent cells were dispensed into pre-chilled 1.5mL centrifuge tubes. (2) To the centrifuge tube, 5. Mu.L of the reconstituted product was added, gently mixed, and ice-bathed for 30 minutes. (3) After heat shock in a 42 ℃ water bath for 30 seconds, the solution was quickly transferred to an ice bath for 2 minutes without shaking the centrifuge tube. (4) mu.L of transformed competent cells were aspirated, spread evenly on ampicillin-resistant LB agar medium, and incubated with the inverted plate in an incubator at 37℃for 12-16 hours.

The screening procedure for positive clones was as follows: (1) The 7 LbUGT recombinant plate on growth of monoclonal in 200 u L LB liquid medium (ampicillin resistance), 37 degrees C in a shaker for 2 hours (200 rpm). (2) Colony PCR was performed using 2 XTaq Mix DNA polymerase (available from Nanjinouzan Biotech Co., ltd., product catalog number P131-01). The amplification Primer sequences designed using Primer 6.0 were: pMAL-c2X-F GTCGTCAGACTGTCGATGAAG; pMAL-c2X-R GATGTGCTGCAAGGCGATT. The conventional PCR reaction system is shown in Table 4. The conventional PCR reaction procedure is shown in Table 5. (3) And (3) taking 5 mu L of PCR products for agarose gel electrophoresis detection, and referring to the position of a DNA Marker (purchased from Beijing full gold biotechnology Co., ltd., product catalog number BM 111-01), picking bacterial liquid with reasonable strip positions, and sending the bacterial liquid to Beijing nuoxel genome research center Co., ltd. Alignment with the RNAseq sequence to obtain final sequence information.

TABLE 4 composition of conventional PCR reaction System

TABLE 5 routine PCR reaction procedure

2.2 experimental results

LbUGT72CT1 was obtained by cloning the primers shown in Table 1, and the detection results by agarose gel electrophoresis are shown in FIG. 3. Sequencing to obtain the sequence, and Blast comparison to find 99% similarity between the nucleotide sequence and the original data, based on the actual sequencing result. The actual sequencing result is shown as a sequence 1, and contains 1443 nucleotides, and the protein shown as a sequence 2 in the coding sequence table consists of 480 amino acids. This gene was designated as LbUGT72CT1 and the protein encoded by it was designated as LbUGT72CT1.

Example 3 functional verification of candidate LbUGT72CT1 Gene

3.1 Experimental methods

The transformation procedure of the recombinant plasmid was as follows: (1) BL21 (DE 3) competent cells (available from Tiangen Biochemical technology (Beijing) Co., ltd., catalog number CB 105-02) were thawed on ice. 50. Mu.L of BL21 (DE 3) competent cells after thawing were dispensed into pre-chilled 1.5mL centrifuge tubes. (2) mu.L of pMAL-c2X-LbUGT72CT1 recombinant plasmid was added to the centrifuge tube, gently mixed, and ice-bathed for 30 minutes. (3) After heat-shock in a 42 ℃ water bath for 90 seconds, the solution was quickly transferred to an ice bath for 2 minutes without shaking the centrifuge tube. (4) mu.L of transformed competent cells were aspirated, spread evenly on ampicillin-resistant LB agar medium, and incubated with the inverted plate in an incubator at 37℃for 12-16 hours.

The steps of induction expression are as follows: (1) And (3) picking the monoclonal on the transformed LB solid medium, and carrying out colony conventional PCR verification, wherein the method is the same as that described above. (2) mu.L of positive clone broth was aspirated and cultured overnight (37 ℃ C., 200 rpm) in 20mL of LB liquid medium (ampicillin resistance). (3) 2mL of the overnight cultured broth was transferred to 40mL of LB liquid medium (ampicillin resistance), and cultured at 37℃and 200rpm until the OD600 of the broth became 0.8 (about 2 hours). (4) 15. Mu.L of IPTG (1M, isopropyl-. Beta. -D-thiogalactoside) was added to the bacterial liquid, and the mixture was shaken well and subjected to induction culture at 16℃and 110rpm for 16-24 hours.

The protein purification steps are as follows: collecting the induced bacterial liquid, centrifuging at 4 ℃ and 7800rpm for 5 minutes, and discarding the supernatant; the bacterial pellet was washed with 3mL of pre-chilled Tris-HCl (pH 7.5), centrifuged at 7800rpm at 4℃for 3 min and the supernatant discarded. The cells were resuspended by adding 1.5mL Tris-HCl (pH 7.5) buffer and transferred to a 2mL centrifuge tube. The resuspended bacteria liquid was broken for 20 minutes using an ultrasonic cytobreaker (30 Hz, 5 seconds of operation, 5 seconds of stop) and the color changed from milky to translucent, the whole process was carried out on ice. The crushed resuspension bacterial liquid is centrifugated for 30 minutes at the temperature of 4 ℃ and the speed of 12000rpm, and the supernatant is the crude enzyme solution.

Reference to PurKine for protein purification procedures ^TM Maltose binding protein tag protein purification kit (available from subfamily Biotechnology Co., ltd., product catalog KTP 2020) instruction, the whole process is setThe refrigerator is operated at 4 ℃ and the specific process is as follows: (1) Fixing a gravity column, taking down plugs at two ends, and draining protective liquid; (2) Adding 2mL of washing solution (Binding buffer) to the column to balance the resin, and repeating the steps for 3 times after the resin is drained; (3) The crude enzyme solution and an equal volume of wash solution were mixed to make a protein sample. Adding a protein sample into a column for incubation, collecting a flow-through liquid, and repeating for 5 times; (4) 2mL of wash was added to the column to remove non-specific proteins, and the procedure was repeated 6 times, using Coomassie brilliant blue solution to detect the protein content. (5) 2mL of an eluent (Elution Buffer) was added to the column, and specific proteins (containing maltose label) were eluted, and the procedure was repeated 5 times, using coomassie brilliant blue solution to detect the protein content. The eluent collected in the step is the purified protein solution. (6) desalting and concentrating: the purified protein solution was added to an ultrafiltration tube (30 kDa), centrifuged at 3800 Xg at 4℃for 30 minutes, and then 10mL of protein substitution solution (50 mM Tris-HCl (pH 7.5), 10mM DTT) was added in batch to the tube, followed by centrifugation again. The remaining solution in the suction tube is the purified enzyme solution after desalination. (7) Protein concentration standard curves were established using a Easy Protein Quantitative Kit (Bradford) protein concentration measurement kit (available from the company, inc. Of holo gold, beijing, catalog DQ 101-01) and the concentration of the concentrated protein was measured with reference to the instructions for use. (8) SDS-PAGE protein gel detection: mu.L of purified enzyme solution was added to 20. Mu.L of 5 Xprotein loading buffer, and after mixing, the mixture was boiled for 5 minutes and centrifuged at 12000rpm for 5 minutes. And loading 40 mu L of supernatant, and ending electrophoresis under 150V for 40-50 minutes until a bromophenol blue indicator tape reaches the bottom of the silica gel. After 30 minutes of staining, the cells were placed in a decolorization solution for 1 hour, followed by replacement of the decolorization solution for overnight decolorization. The next day the protein gel was placed in a scanner for imaging.

The in vitro enzyme activity detection steps are as follows: 50. Mu.L of the reaction system contained 1. Mu.L of the flavone substrate (40 mM) (kaempferol or myricetin or gossypin or quercetin) 1. Mu.L of UDP-sugar donor (100 mM) (UDP-galactose or UDP-glucose) and 10. Mu.g of purified enzyme, tris-HCl (pH 7.5) buffer was used to supplement the system. The reaction system was placed at 37℃for 1 hour with the empty crude enzyme catalytic system containing pMAL-c2X as a negative control, and the reaction was terminated by adding an equal volume of methanol. The mixture was concentrated in vacuo and reconstituted by the addition of 100. Mu.L of methanol. Filtration was performed using a 0.22 μm microporous filter membrane and samples were transferred to liquid phase vials for detection analysis. The sample is detected by using Agilent 1290 Infinicity II-6430Q-TOF, and the specific liquid phase conditions are as follows: (1) chromatography column: ACQUITY UPLC BEH C18.1.7.mu.m2.1X100 mm; (2) mobile phase: phase A is 0.1% pure water, and phase B is chromatographic acetonitrile; (3) flow rate: column temperature of 0.3mL/min (4): 40 ℃; sample injection amount (5): 1.0. Mu.L; (6) elution conditions are shown in Table 6. The mass spectrum conditions are as follows: the ion mode is negative ion, and the scanning range is 100-3000; the mode is Automated MS/MS; ion fragment collision energy is 20V; the source temperature is 350 ℃; the atomizer pressure was set at 30psi.

TABLE 6 gradient of mobile phase elution during LC-Q-TOF detection

3.2 experimental results

The recombinant protein of LbUGT72CT1 was successfully transferred into Escherichia coli (FIG. 4), and the recombinant protein was expressed (FIG. 5), and the function was identified by further enzyme activity analysis. The donor of enzyme activity reaction is UDP-glucose or UDP-galactose, and the acceptor is kaempferol (C ₁₅ H ₁₀ O ₆ Product catalog number from Shanghai Source leaf Biotechnology Co., ltd: b21126 Myricetin (C) ₁₅ H ₁₀ O ₈ Product catalog number from Shanghai Source leaf Biotechnology Co., ltd: b21458 Either gossypin (C) ₁₅ H ₁₀ O ₈ Product catalog number from Shanghai Source leaf Biotechnology Co., ltd: b29179 Or querceting marigold (C) ₁₅ H ₁₀ O ₈ Product catalog number from Shanghai Source leaf Biotechnology Co., ltd: b29299 A kind of electronic device. The product of the enzyme activity was identified by mass spectrometry, and LbUGT72CT1 was found to have product peaks (P1-P8) for the enzyme activity reactions of kaempferol, myricetin, gossypin and quercitin as the receptors.

Compared with the detection result of the empty crude enzyme catalytic system containing pMAL-c2X, when kaempferol is used as a substrate and UDP-galactose is used as a sugar donor, the product P1 has the following formulaThe same retention time and mass spectrum cleavage law ([ M-H) of nephenol-3-O-galactoside (K3 Gal)] ^- :m/z＝447.0935、[M-H-Gal] ^- M/z= 284.0325); when Kaempferol is used as a substrate and UDP-glucose is used as a sugar donor, the product P2 has the same retention time and mass spectrum cleavage law ([ M-H) as Kaempferol-3-O-glucoside (K3 Glu)] ^- :m/z＝447.0920、[M-H-Glu] ^- M/z= 284.0315) (fig. 6).

Compared with the detection result of a crude enzyme catalytic system containing pMAL-c2X empty, when myricetin is used as a substrate and UDP-galactose is used as a sugar donor, the product P3 has the same retention time and mass spectrum cleavage rule ([ M-H ] as myricetin-3-O-galactoside (M3 Gal)] ^- :m/z＝479.0830、[M-H-Gal] ^- M/z= 316.0224); when myricetin is used as a substrate and UDP-glucose is used as a sugar donor, the product P4 is judged to be myricetin-3-O-glucoside (M3 Glu) ([ M-H) according to the cleavage rule] ^- :m/z＝479.0828、[M-H-Glu] ^- M/z= 316.0226) (fig. 7).

Compared with the detection result of the empty crude enzyme catalytic system containing pMAL-c2X, when gossypin is used as a substrate and UDP-galactose is used as a sugar donor, the product P5 is judged to be gossypin-3-O-galactoside (G3 Gal) ([ M-H) according to the cleavage rule] ^- :m/z＝479.0820、[M-H-Gal] ^- M/z= 316.0204); when gossypin is used as a substrate and UDP-glucose is used as a sugar donor, the product P6 is judged to be gossypin-3-O-glucoside (G3 Glu) ([ M-H) according to the cleavage rule] ^- :m/z＝479.0868、[M-H-Glu] ^- M/z= 316.0243) (fig. 8).

Compared with the detection result of the crude enzyme catalysis system containing pMAL-c2X empty load, when quercetin is taken as a substrate and UDP-galactose is taken as a sugar donor, the product P7 is judged to be quercetin-3-O-galactoside (Q3 Gal) ([ M-H) according to the cleavage rule] ^- :m/z＝479.0830、[M-H-Gal] ^- M/z= 316.0223), when quercetin is used as a substrate and UDP-glucose is used as a sugar donor, the product P8 is judged to be quercetin-3-O-glucoside (Q3 Glu) ([ M-H) according to the cleavage law] ^- :m/z＝479.0823、[M-H-Glu] ^- M/z= 316.0226) (fig. 9).

In conclusion, based on mass spectrometry detection data, it is determined that glycosyltransferase LbUGT72CT1 has the functions of catalyzing kaempferol to generate kaempferol-3-O-glucoside/galactoside, catalyzing myricetin to generate myricetin-3-O-glucoside/galactoside, catalyzing gossypin to generate gossypin-3-O-glucoside/galactoside and catalyzing quercitin to generate quercitin-3-O-glucoside/galactoside.

The invention mainly obtains a sequence of the bulbil Ai Mazhong flavonoid glycosyltransferase through three-generation full-length transcriptome analysis, and confirms that when recombinant protein LbUGT72CT1 takes UDP-glucose as a donor, the invention can catalyze kaempferol to generate kaempferol-3-O-glucoside, myricetin to generate myricetin-3-O-glucoside, myricetin to generate gossypin-3-O-glucoside and quercitin to generate quercitin-3-O-glucoside; when UDP-galactose is used as a donor, kaempferol can be catalyzed to generate kaempferol-3-O-galactoside, myricetin can be catalyzed to generate myricetin-3-O-galactoside, gossypin can be catalyzed to generate gossypin-3-O-galactoside, and quercitin can be catalyzed to generate quercitin-3-O-galactoside.

The above embodiments do not limit the scope of the present invention. It will be apparent to those skilled in the art that various modifications, combinations, sub-combinations and alternatives can occur depending upon design requirements and other factors. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of the present invention.

Claims

1. A protein has an amino acid sequence shown in SEQ ID NO. 2.

2. The protein-encoding gene of claim 1, wherein: the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1.

3. An expression cassette, recombinant expression vector or recombinant bacterium comprising the coding gene of claim 2.

4. A primer pair for amplifying the full length of the coding gene as claimed in claim 2, wherein one primer sequence is shown in SEQ ID NO. 3, and the other primer sequence is shown in SEQ ID NO. 4.

5. Use of the protein of claim 1 as a glycosyltransferase.

6. The use according to claim 5, characterized in that: the glycosyltransferase is an enzyme with any one of the following functions:

7. Use of the protein of claim 1 in any of the following:

8. Use of the coding gene of claim 2 in any of the following: