CN117925436A - EF strain and application thereof in preventing and treating metabolic diseases - Google Patents

Abstract

The invention relates to the technical field of biology, in particular to enterococcus faecalis (Enterococcus faecalis) ibiome009, provides a pharmaceutical composition, a microbial inoculum composition and a food composition containing enterococcus faecalis (Enterococcus faecalis) ibiome009 strain, and discovers that the microbial inoculum can obviously activate target points GPR120 and MC4R for treating obesity diabetes, can inhibit weight gain, reduce fasting blood glucose, improve insulin resistance and improve lipid metabolism level, has better effect than metformin hydrochloride, has great clinical application value, and can be used for preventing, improving or treating metabolic diseases.

Description

EF strain and application thereof in preventing and treating metabolic diseases

Technical Field

The invention relates to the technical field of biology, in particular to an enterococcus faecalis (Enterococcus faecalis) ibiome009 strain and application thereof in metabolic diseases.

Background

Obesity has become a major public health concern worldwide, which has shifted from a high-rise disease in economically developed areas to a chronic disease worldwide, which can lead to various metabolic diseases such as chronic liver disease, atherosclerosis, diabetes, coronary heart disease, fatty liver, and hypertension, etc. The prevalence of obesity is about 13% in the adult world population. As the size of obese people increases, health problems caused by obesity become a focus of social concern. At present, in sharp contrast to the increasingly severe onset of obesity, the lack of effective means for controlling obesity is a major concern. Products for weight loss include chemical drugs, chinese patent drugs, health products, foods and the like for a long time, but many are forbidden or returned to the market due to serious adverse reactions. Therefore, there is an urgent need to develop more safe and effective weight-losing medicines.

Intestinal flora is a complex symbiotic microbial system that has an important effect on the health of the human body, and can metabolize substances that are indigestible by the body itself, producing various metabolites. In recent years, many studies have found that metabolites of the intestinal flora have important roles in cardiovascular and metabolic diseases. Intestinal microbiota can promote host insulin resistance, low-grade inflammation and fat deposition through a series of molecular interactions with the host, indirectly involved in the development of obesity and metabolic diseases. And probiotics such as bifidobacterium, faeces bacillus, lactobacillus and the like are implanted into the human body, so that the metabolic disorder of the human body can be relieved, and the further development of diabetes is inhibited. It follows that maintaining the balance of intestinal flora is of profound importance for the treatment of metabolic diseases.

Enterococcus faecalis (Enterococcus faecalis) is a species of the genus enterococcus of the family Streptococcaceae, and is a gram-positive coccus. Enterococcus faecalis is a normal flora component of the intestinal tract of humans and animals and exists in the upper respiratory tract, digestive tract and reproductive tract of humans and animals. Enterococcus faecalis has strong tolerance and colonization capacity. Can produce bacteriostasis substances such as bacteriocin, inhibit the growth of pathogenic bacteria such as escherichia coli and salmonella, and improve intestinal microenvironment. But currently there is less research on metabolic-related diseases.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provides enterococcus faecalis and application thereof in medicaments for preventing and treating metabolic diseases.

The invention is realized by the following technical scheme:

Enterococcus faecalis (Enterococcus faecalis) ibiome is preserved in China center for type culture collection, with the address being eight ways of China center for type culture collection of Wuhan university in Wuhan, hubei province, and the preservation date being 2023, 8, 14 days, and the preservation number being CCTCC M20231464.

The invention also protects a medicine, which comprises the enterococcus faecalis (Enterococcus faecalis) ibiome009 and pharmaceutically acceptable auxiliary materials.

The auxiliary materials can be classified into various modes in the preparation, such as sources, actions, purposes, administration routes and the like. The natural products, semisynthetic products and fully synthetic products can be classified by source. The auxiliary materials are classified into 65 types according to the functions and the purposes of the auxiliary materials in the preparation, namely, a pH regulator, a chelating agent, a coating agent, a protective agent, a humectant, a disintegrating agent, a surfactant, a virus inactivating agent, a supplement, a precipitating agent, a film forming material, a flavoring agent, an excipient for freeze drying, a carbon dioxide adsorbent, a foaming agent, a flavoring agent, a preservative, an excipient, a drying agent, a curing agent, a buffering agent, a sustained and controlled release material, an adhesive, a flavoring agent, an antioxidant synergistic agent, an anti-adhesive agent, an air replacement agent, a condensing agent, a paste base material, a gel material, a polishing agent, a propellant, a solvent, a softening agent, an emulsifying agent, an ointment base, a soft capsule material, a lubricant, a wetting agent, a penetration enhancer, an osmotic pressure regulator, a suppository base, a sweetener, a filler, a pellet core, a stabilizing agent, an adsorbent, a diluent, a defoaming agent, a flocculating agent, an ethanol modifier, a plaster base, an ink, a thickening agent, a solubilizer, a plasticizer, a binding agent, a Chinese medicinal auxiliary material, a cosolvent, a suspending agent and a coloring agent.

The pharmaceutically acceptable auxiliary materials comprise at least one of adjuvant, stabilizer or protective agent, bacteriostat, excipient, cosolvent, correctant, diluent and buffer.

Adjuvants: is a substance that is mixed with one or more components that bind to a vaccine antigen to enhance [ e.g., boost, accelerate, prolong, and/or potentially direct ] its specific immune response and clinical effects of the vaccine.

Stabilizers or protectants: a substance for stabilizing or protecting the active ingredient of biological products, preventing degradation or inactivation thereof.

Bacteriostat: a substance for inhibiting the growth of microorganisms and preventing microbial contamination.

Excipient: the material is used for forming medicines and playing a role of a bracket in freeze-dried products.

Cosolvent: a substance for increasing the solubility of a drug.

Flavoring agent: a substance for improving the taste of oral medicines.

Diluents, buffers: the solvent is used for dissolving and diluting products, and adjusting the pH value of the products, such as water for injection, sodium chloride injection, phosphate buffered physiological sodium chloride solution (PBS) and the like.

Exemplary excipients include, but are not limited to: butylated Hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrogen), calcium stearate, croscarmellose, crospovidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl p-hydroxybenzoate, microcrystalline cellulose, polyethylene glycol, povidone, pregelatinized starch, propyl p-hydroxybenzoate, retinol palmitate, shellac, silica, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin a, vitamin E, vitamin C, and xylitol.

The medicament can be prepared in the form of an injection preparation or an oral preparation. The injection preparation comprises liquid injection, powder for injection and tablets for injection according to the classification of physical states; the classification according to the injection part includes intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection, and spinal cavity injection; preferred solvents for the injectable preparation include injectable water or physiological saline.

Formulations for oral use include tablets containing the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients. These excipients may be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starches including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate, or sodium phosphate); granulating and disintegrating agents (e.g., cellulose derivatives including microcrystalline cellulose, starches including potato starch, croscarmellose sodium, alginates, or alginic acid); binders (e.g., sucrose, glucose, sorbitol, acacia, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, ethyl cellulose, polyvinylpyrrolidone, or polyethylene glycol); and lubricants, glidants, and anti-tackifiers (e.g., magnesium stearate, zinc stearate, stearic acid, silicon dioxide, hydrogenated vegetable oils, or talc). Formulations for oral use may also be presented as chewable tablets, or as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g. potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g. peanut oil, liquid paraffin, or olive oil). Powders, granules and pills can be prepared in a conventional manner using the ingredients mentioned above under tablets or capsules using, for example, mixers, fluidized bed equipment or spray drying equipment.

Other pharmaceutically acceptable excipients for oral formulations include, but are not limited to, coloring agents, flavoring agents, plasticizers, humectants, and buffers. Formulations for oral use may also be presented as chewable tablets, or as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g. potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g. peanut oil, liquid paraffin, or olive oil). Powders, granules and pills can be prepared in a conventional manner using the ingredients mentioned above under tablets or capsules using, for example, mixers, fluidized bed equipment or spray drying equipment.

In some embodiments, administering includes administering the medicament described herein intramuscularly, intravenously (e.g., in the form of a sterile solution and in a solvent system suitable for intravenous use), intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intra-articular, intra-prostatic, intrapleural, intratracheal, intranasal, intravitreal, intravaginally, intrarectal, topical, intratumoral, intraperitoneal, subcutaneous, subconjunctival, intracapsular, transmucosal, intrapericardiac, intraumbilical, intraocular, oral (e.g., tablet, capsule, caplet, or syrup), topical (e.g., in the form of a cream, gel, lotion, or ointment), topically, by inhalation, by injection, or by infusion (e.g., continuous infusion in the form of a cream or lipid composition, local infusion by direct infusion of the target cells, catheterization, lavage).

The invention also provides a pharmaceutical composition, which comprises the enterococcus faecalis (Enterococcus faecalis) ibiome009 and a combined drug, wherein the combined drug is other drugs which have synergistic effect with the enterococcus faecalis (Enterococcus faecalis) ibiome 009.

Preferably, the combination is other hypoglycemic and lipid-lowering pharmaceutical active ingredients, such as GLP-1 receptor agonists or GLP-1 mimics, GIP receptor agonists, dipeptidyl peptidase-4 inhibitors, metformin and the like, and is specifically selected from exenatide, liraglutide, cable Ma Lutai, oral dosage form cable Ma Lutai, benraglutide, liraglutide, exenatide weekly preparations and the like.

The formulation of the composition is granule, capsule, tablet, powder, oral liquid, suspension, emulsion or the like.

The effective dose of the invention is that the total viable count of the viable bacteria preparation prepared by taking enterococcus faecalis (Enterococcus faecalis) ibiome009 as a main medicinal active ingredient is 10 ⁶-10¹⁴ CFU.

The administration period is based on the effect that can be achieved, including but not limited to 1-3 times daily, 3-7 days per week, etc., and is dependent on the concentration of the particular formulation.

The invention also protects a fermentation agent, a functional microbial agent or a nutritional composition comprising the enterococcus faecalis (Enterococcus faecalis) ibiome 009.

A ferment or a functional bacterial agent, comprising bacterial liquid prepared by enterococcus faecalis (Enterococcus faecalis) ibiome009, or powder or granule obtained by further treatment; the ferment can further comprise more than one non-antagonistic microbial agent, which is selected from more than one of Krils Teng Senjun, paralopecuroides parahaemolyticus, acremodella muciniphila and Bacteroides thetaiotaomicron.

The concentration of the effective bacterial agent and the number of viable bacteria are 10 ⁶-10¹⁴ CFU.

The ferment or functional microbial inoculum can also be used as functional food and nutritional products.

A nutritional composition comprising enterococcus faecalis (Enterococcus faecalis) ibiome009, as described above, and a food, nutraceutical, supplement, probiotic or symbiotic.

The food products, including enterococcus faecalis (Enterococcus faecalis) ibiome009 described above and ancillary substances to perform food functions, are in forms including, but not limited to, "dietary supplements," "fermented foods," and the like.

The dietary supplement comprises bacterial liquid prepared from enterococcus faecalis (Enterococcus faecalis) ibiome009 or powder prepared by further processing, and further adding nutrients such as cellulose, vitamins, minerals, etc.

The fermented food comprises dairy products, bean products or fruit and vegetable products and the like. The dairy product is milk, sour cream or cheese, etc. The bean product is soybean milk, fermented soybean or soybean paste. The fruit and vegetable products are cucumber, carrot, beet, celery or cabbage products and the like.

By probiotic is meant a living microorganism which, when provided in a suitable amount, is beneficial for the health of the host organism.

Symbiotic bacteria refer to those foods that contain a mixture of probiotics and probiotics. They typically comprise a probiotic component that facilitates growth and/or metabolic activity, and generally a probiotic effect in combination with a fructo-oligosaccharide or galacto-oligosaccharide such as but not limited to enterococcus faecalis (Enterococcus faecalis) ibiome 009.

The invention also provides application of the enterococcus faecalis (Enterococcus faecalis) ibiome009 or the medicine composition in preparing medicines for treating, relieving and preventing metabolic diseases, such as diabetes, obesity and obesity related diseases and metabolic syndrome.

In the present specification, the term "diabetes" includes all forms of diabetes, which, as described above, is characterized by metabolic disorders and abnormal hyperglycemia (hyperglycemia) due to insufficient levels of insulin hormone. The term thus includes type 1 diabetes (T1D), type 2 diabetes (T2D), gestational Diabetes (GDM), and glucose Intolerance (IGT). Type 1 diabetes is caused by autoimmune damage or idiopathic causes, and is characterized by absolute destruction of islet function, and occurs in children and adolescents, where insulin therapy is necessary to achieve satisfactory efficacy, otherwise life threatening. Type 2 diabetes is a multifactorial syndrome characterized by abnormal carbohydrate/fat metabolism, and generally includes hyperglycemia, hypertension, and cholesterol abnormalities. Type 2 diabetes is caused by the fact that insulin cannot effectively act (has a small amount of binding to a receptor), and therefore, it is necessary to examine not only fasting blood glucose but also blood glucose 2 hours after meal, and it is particularly desirable to examine islet function. Diabetes during pregnancy has two conditions, one of which is a condition that has been diagnosed with diabetes before pregnancy, called "diabetes mellitus combined pregnancy"; another type is diabetes mellitus in which the metabolism of sugar before pregnancy is normal or potential sugar tolerance is reduced, and only occurs or is diagnosed in gestation, also called as "Gestational Diabetes Mellitus (GDM)", and more than 80% of pregnant women with diabetes mellitus are GDM. Glucose intolerance (IMPARIRED GLUCOSE TOLERANCE, IGT) is a pre-diabetic condition of the blood glucose metabolism disorder associated with increased insulin resistance and risk of cardiovascular disease. Glucose intolerance is defined as a glucose level of 140-199mg/dL (7.8 to 11.0 mmol) in 75 g hours of oral glucose tolerance test, according to the world health organization and American diabetes Association standards. When the patient had an immediately elevated glucose level after 2 hours, but was below type 2 diabetes criteria, it was considered to be in an IGT state. Fasting glucose may be normal or slightly elevated. IGT may be older than type 2 diabetes for many years. IGT is also a risk factor for death.

It should be noted that the application of the above pharmaceutical use to diabetes includes, but is not limited to, treatment or prevention of type1 diabetes (T1D), type 2 diabetes (T2D), gestational Diabetes (GDM), and glucose Intolerance (IGT).

In this specification, the term "obesity" is associated with Body Mass Index (BMI). Body Mass Index (BMI) (calculated as weight in kilograms divided by the square of height in meters) is the most commonly accepted calculation for overweight and/or obesity. BMI exceeding 25 is considered overweight. A BMI of 30 or higher is defined as obese, a BMI of 35 or higher is considered severe morbid (comorbidity) obesity, and a BMI of 40 or higher is considered morbid obesity.

As noted above, the term "obesity" as used herein includes overweight, obesity, homoobesity and morbid obesity. Thus, the term "obese" as used herein may be defined as a subject having a BMI greater than or equal to 25. In some embodiments, suitably, the BMI of an obese subject may be greater than or equal to 30, suitably 35, suitably 40.

While the compositions of the present invention are particularly useful for patients suffering from both diabetes and obesity, the compositions of the present invention are also suitable for patients suffering from diabetes but not obesity, and for obese patients having a risk factor for diabetes but not yet in a diabetic state. It is expected that obese persons (but not diabetes) may limit their metabolic consequences of obesity, i.e. develop diabetes or at least insulin resistance.

In addition, enterococcus faecalis (Enterococcus faecalis) ibiome009 for use in the present invention may be used to treat metabolic syndrome in mammals. Metabolic syndrome is a generic term for medical conditions that increase the risk of cardiovascular disease and diabetes. Metabolic syndrome is also known as metabolic syndrome X, insulin resistance syndrome, lei Wenzeng syndrome (Reaven's syndrome) or CHAOS syndrome (australia).

There is currently no individually accepted definition of metabolic syndrome. World health organization standards (1999) require the presence of diabetes, glucose intolerance, fasting glucose intolerance, or insulin resistance, as well as two of the following:

blood pressure: 140/90mmHg;

Dyslipidemia: triglyceride (TG): 1.695mmol/L, high density lipoprotein cholesterol (HDL-C) less than or equal to 0.9mmol/L (male), less than or equal to 1.0mmol/L (female);

Central obesity: waist to hip ratio > 0.90 (male), > 0.85 (female), and/or body mass index > 30kg/m ².

Microalbuminuria: the excretion rate of the urine albumin is more than or equal to 20mg/min, or the ratio of albumin to creatinine is more than or equal to 30mg/g.

The European insulin resistance research group (1999) requires that insulin resistance be defined as a fasting insulin value of 25% or more in non-diabetic individuals, and two or more of the following:

Central obesity: the waistline is more than or equal to 94cm (male), and more than or equal to 80cm (female);

Dyslipidemia: TG is more than or equal to 2.0mmol/L, and/or HDL-C is less than 1.0mg/dL, or is used for treating dyslipidemia;

hypertension: the blood pressure is more than or equal to 140/90mmHg, or antihypertensive drug treatment is carried out;

the fasting blood sugar is more than or equal to 6.1mmol/L.

The National Cholesterol Education Program (NCEP) adult treatment regimen III (2001) requires at least three of the following:

Central obesity: waistline is more than or equal to 102cm or 40 inches (male), and more than or equal to 88cm or 36 inches (female);

dyslipidemia: TG is more than or equal to 1.695mmol/L (150 mg/dl);

dyslipidemia: HDL-C < 40mg/dL (male) and <50 mg/dL (female);

Blood pressure: more than or equal to 130/85mmHg;

fasting blood glucose is more than or equal to 6.1mmol/L (110 mg/dl).

Preferably, the obesity-related diseases include at least one of the following: cardiovascular disease, hyperlipidemia, insulin resistance syndrome, and steatohepatitis.

Examples of cardiovascular diseases treatable in accordance with the present invention using enterococcus faecalis (Enterococcus faecalis) ibiome009 include aneurysms, angina pectoris, atherosclerosis, cerebrovascular accidents (stroke), cerebrovascular diseases, congestive Heart Failure (CHF), coronary heart disease, myocardial infarction (heart attack), and peripheral vascular disease.

Aneurysms are localized congestive distensions (balloon-like distensions) of the blood vessel caused by lesions or weakening of the vessel wall. Aneurysms are most commonly found in arteries and aorta (the main arteries out of the heart, the so-called aortic aneurysms) of the basal brain (the cerebral arterial annulus). As the aneurysm increases, the risk of rupture increases, which can lead to severe bleeding or other complications including sudden death.

Angina (angina pectoris, commonly referred to as angina) is caused by myocardial ischemia (lack of blood and hence oxygen supply), often severe chest pain due to obstruction or spasm of the coronary arteries (blood vessels of the heart). Coronary heart disease (the main cause of angina pectoris) is due to atherosclerosis of the heart arteries.

Atherosclerosis is a condition of thickening of the arterial wall due to accumulation of fatty substances (e.g., cholesterol). It is a syndrome affecting arterial blood vessels, a chronic inflammatory response of arterial walls, largely due to macrophage leukocyte accumulation, and is promoted by low density (especially small particle) lipoproteins (plasma proteins carrying cholesterol and triglycerides) that cannot properly remove fat and cholesterol from macrophages by functional High Density Lipoproteins (HDL). Atherosclerosis is commonly referred to as arteriosclerosis or "hair attachment (furring)", and is typically caused by the formation of multiple plaques within the artery.

Stroke is a rapidly occurring loss of brain function due to a brain blood supply disorder. This may be due to ischemia (lack of blood supply) caused by thrombosis or embolism or due to bleeding. Thus, the affected brain area cannot function, resulting in the inability of one or more limbs on one side of the body to function, lack of language understanding or description, or the inability of one side view to see and ultimately die.

Cerebrovascular disease is a group of brain dysfunctions associated with vascular disease that supplies the brain. Hypertension is the most important cause of damage to the inner vascular membrane endothelium in contact with underlying collagen, where platelets initiate a repair process that is not always complete and perfect as a result of underlying collagen accumulation. Persistent hypertension permanently alters the vascular structure, making it stenotic, stiff, deformed, and uneven, making it more susceptible to blood pressure fluctuations. Blood pressure decreases during sleep can result in a significant decrease in blood flow in narrowed blood vessels, resulting in a morning ischemic stroke, while sudden increases in blood pressure can cause vascular rupture, resulting in intracranial hemorrhage during diurnal excitation. Mainly the elderly, diabetes, smokers or people with ischemic heart disease suffer from cerebrovascular diseases. All diseases associated with arterial dysfunction can be categorized as diseases called macrovascular diseases. This is a simplistic study from which fat deposits or thrombi block the arteries. The outcome of cerebrovascular disease may include stroke, or even sometimes hemorrhagic stroke. During a cerebrovascular accident, ischemia or other vascular dysfunction may affect one.

Heart failure is a generic term for physiological conditions in which cardiac output is insufficient for the body to desire. This can occur in cases of low cardiac output (often referred to as "congestive heart failure"). Common causes of heart failure include myocardial infarction and other forms of ischemic heart disease, hypertension, valvular heart disease, and cardiomyopathy.

Coronary heart disease (or coronary heart disease) refers to the inability of the coronary circulation to supply the proper circulation to the heart muscle and surrounding tissue. It is generally equivalent to atherosclerotic coronary heart disease, but coronary artery disease can be attributed to other causes, such as coronary vasospasm. Stenosis may be due to spasticity.

Myocardial infarction (commonly known as heart attack) occurs when the blood supply to the heart portion is blocked, resulting in the death of certain heart cells. This is most often due to coronary occlusion (blockage) after rupture of vulnerable atherosclerotic plaques (unstable accumulation of lipids (such as cholesterol) and leukocytes (especially macrophages) in the arterial wall). The resulting ischemia (limited blood supply) and insufficient oxygen, if left untreated for a sufficient period of time, can lead to myocardial injury and/or necrosis (infarction).

Peripheral Vascular Disease (PVD), also known as Peripheral Arterial Disease (PAD) or Peripheral Arterial Occlusive Disease (PAOD), includes all diseases caused by occlusion of the aorta in the arms and legs. PVD can be attributed to atherosclerosis, resulting in a stenotic inflammatory process, embolism or thrombosis, which results in acute or chronic ischemia (lack of blood supply), typically occurring in the legs.

It is contemplated that embodiments of the invention may be combined within the scope of the invention such that any combination of the features described herein is also included within the scope of the invention. In particular, it is contemplated within the scope of the invention that any therapeutic effect of the bacteria may be simultaneously manifested.

Preferably, the medicament is for at least one of the following uses:

Preventing or treating diabetes caused by obesity;

preventing or treating type II diabetes;

Activating GPR120 and/or MC4R;

Reducing the weight of the mammal;

reducing the weight of adipose tissue of the mammal;

Lowering fasting blood glucose in the mammal;

improving impaired oral glucose tolerance in a mammal;

improving abnormal fasting insulin content in a mammal;

Reducing the glycosylated hemoglobin content;

decreasing the area under the insulin resistance curve;

Lowering the HOMA-IR index in the mammal;

Improving the level of at least one of the following in mammalian blood: total cholesterol, triglycerides, high density lipoprotein-cholesterol, low density lipoprotein-cholesterol, free fatty acids;

improving the level of at least one of the following in the liver of a mammal: total cholesterol, triglycerides, high density lipoprotein-cholesterol, low density lipoprotein-cholesterol, free fatty acids;

Increasing glucagon-like peptide-1 content.

The invention has the beneficial effects that:

The enterococcus faecalis (Enterococcus faecalis) ibiome009 strain can obviously activate target points GPR120 and MC4R for treating obesity and diabetes mellitus, and can inhibit weight gain; the fasting blood glucose and glucose tolerance can be reduced, namely the insulin resistance can be improved; further, it can lower triglyceride levels and increase high density lipoprotein-cholesterol levels, i.e., improve lipid metabolism. The enterococcus faecalis (Enterococcus faecalis) ibiome009 strain has better improvement capability on blood sugar and blood fat than the commercial blood sugar reducing drug-metformin hydrochloride, has great clinical application value, and can be used for preventing, improving or treating metabolic diseases such as hyperglycemia, insulin resistance, hypertriglyceridemia, hypercholesterolemia, diabetes, obesity and the like.

Preservation of organisms

Enterococcus faecalis (Enterococcus faecalis) ibiome is 009, the preservation date is 2023, 8 and 14, the preservation place is China center for type culture collection, the address is eight ways of China center for type culture collection of Wuhan university in Wuchang district of Wuhan, hubei province, and the preservation number is CCTCC M20231464.

Drawings

FIG. 1 shows the results of the detection of activation of GPR120 by E. FAECALIS EF1 (ibiome 009) strain in the cell level experiment of example 2.

FIG. 2 shows the results of detection of activation of MC4R by E. FAECALIS EF1 (ibiome 009) strain in the cell level experiment of example 2.

FIG. 3 shows a microscopic morphology of the E. FAECALIS EF1 (ibiome) 009 strain of example 3.

FIG. 4 shows a macroscopic morphology of the E. FAECALIS EF1 (ibiome) 009 strain of example 3.

FIG. 5 shows the effect of strain E. FAECALIS EF1 (ibiome) 009) on DIO mouse body weight in the DIO mouse experiment of example 4.

FIG. 6 shows the effect of strain E. FAECALIS EF1 (ibiome) 009) on fasting blood glucose in DIO mice in DIO mouse experiments of example 4.

FIG. 7 shows the effect of strain E. FAECALIS EF1 (ibiome) 009) on DIO mouse glucose tolerance (OGTT) in DIO mouse experiments of example 4.

Fig. 8 is a schematic diagram of the area under the curve of fig. 7 after calculation.

FIG. 9 shows improvement of DIO mouse triglyceride by E. FAECALIS EF1 (ibiome 009) strain in DIO mouse experiments of example 4.

FIG. 10 shows improvement of DIO mouse HDL-cholesterol by E. FAECALIS EF1 (ibiome) strain 009) in the DIO mouse experiment of example 4.

FIG. 11 shows the effect of strain E. FAECALIS EF2 on DIO mouse body weight in the DIO mouse experiments of the comparative examples.

Figure 12 shows the effect of strain e. FAECALIS EF2 on DIO mice fasting glucose in DIO mice experiments of the comparative examples.

FIG. 13 shows the effect of strain E. FAECALIS EF2 on DIO mouse glucose tolerance (OGTT) in DIO mouse experiments of comparative examples.

Fig. 14 is a schematic diagram of the area under the curve of fig. 13 after calculation.

Figure 15 shows the effect of strain e. FAECALIS EF2 on DIO mouse triglycerides in the DIO mouse experiments of the comparative examples.

Description of the embodiments

For a better understanding of the present invention, reference will now be made to the following examples, which are intended to illustrate, but not to limit the present invention, with reference to the accompanying drawings.

EXAMPLE 1 isolation and preliminary identification of strains

Healthy volunteers which do not use antibiotics within one year are recruited, after an informed consent is signed, the volunteers take fresh feces from 2-5 g, put into a sample collection tube containing glycerin, shake and homogenize, put the treated feces sample into an ice box, and send to an applicant laboratory for strain separation within 24: 24 h.

① Pretreatment of fecal samples: 1mL of the mixture obtained from the sample collection tube containing the glycerin and the feces fully mixed is added into 9 mL of 1X sterile PBS solution, the mixture is uniformly mixed by a vortex oscillator, and then 100 mu L of the mixture is taken from the mixture to be subjected to stepwise gradient dilution to 10 ^-9 for flat plate coating.

② 100 Mu L of diluted samples are coated in mGAM culture medium (commercialized GAM culture medium (Soy treasure, LA 4450), vitamin K1 with the final concentration of 1 mg/L, chlorhexidine with the final concentration of 5 mg/L, 0.1 mg/L of resazurin, 1 mu g/L of biotin, 1 mu g/L of cobalamin, 3 mu g/L of para-aminobenzoic acid, 5 mu g/L of folic acid, 15 mu g/L of pyridoxamine, 50 mu g/L of thiamine and 50 mu g/L of riboflavin) are added into mGAM mu g/L of culture medium (temperature: 37 ℃, O ₂：5%,CO₂: 5%, mixed gas: 90%), standing is carried out for 24-36 h, after single clone growth, repeated streaking and purification are carried out on the single clone, 16s rRNA sequencing is carried out on the purified strain, and the taxonomic status of the strain is determined.

③ 16S rRNA sequencing: carrying out 16s rRNA PCR amplification on the strain to be identified, wherein the amplification system comprises: 2 Taq Master Mix (Northenzan; P112-01) 12.5. Mu.L, primer 1 (27F: AGAGTTTGATCCTGGCTCAG) 1. Mu.L, primer 2 (149 2R: TACGGCTACCTTGTTACGACTT) 1. Mu.L, liquid culture broth 1. Mu. L, ddH ₂ O9.5. Mu.L; amplification conditions: 3 min at 95 ℃;95℃for 15 s,58℃for 15 s,72℃for 30s, 35 cycles; 72 ℃ 5 min. Sequencing the amplified product by the engine biotechnology Co., ltd, submitting the sequence of the strain 16s rRNA gene returned by sequencing to NCBI Basic Local ALIGNMENT SEARCH Tool, and carrying out strain 16s rRNA gene analysis. In the comparison result, the strain with the highest similarity corresponds to the strain as the strain corresponding to the strain.

Among the isolated strains, the strain identified as enterococcus faecalis (Enterococcus faecalis) was selected for further screening.

Example 2 Enterococcus faecalis in vitro cell level activation of GPR120 and MC4R screening

GPR120 is a receptor for long chain unsaturated fat and is expressed in various tissues of the human body, especially in various adipose tissues of the colon. Can regulate gastrointestinal peptide hormone secretion to influence appetite, regulate adipocyte development and differentiation, and the like, and GPR120 is closely related to obesity, diabetes, insulin resistance, fatty liver and other metabolic diseases.

MC4R is expressed primarily in hypothalamic neurons and is the terminal most gene in the leptin-mediated appetite regulation pathway. alpha-MSH derived from pro-opiomelanocortin binds to its receptor MC4R in the hypothalamus, thereby producing a physiological effect of suppressing appetite. MC4R can regulate food intake and energy expenditure by acting on central opioid-melanocyte pro-melanocortin (POMC) neurons, preganglionic neurons, and interactions with corresponding agonists, thereby ameliorating obesity. Recent studies have shown that activating MC4R in L cells of the peripheral tissue gut promotes GLP-1 and PYY secretion and also regulates energy metabolism in the body.

Taken together, GPR120 and MC4R are important targets for the treatment of metabolic diseases such as obesity, diabetes, etc., and can be used to screen strains capable of treating metabolic diseases.

(1) Experimental materials

E. preparation of faecalis bacterial culture supernatant: 100. Mu.L of glycerol bacteria (E.faecalis bacteria stored in glycerol) was added to 2mL mGAM medium (preparation method same as in example 1), 48: 48 h was cultured in an incubator at 37℃and the culture was centrifuged at 12000 rpm at 4℃for 10: 10min, and the supernatant was used for cell screening.

Positive drug: GPR120 positive drug: GSK-137647A (manufacturer: selleck); MC4R positive drug: setmelanotide (manufacturer: selleck, cat# RM-493).

MGAM media control: mGAM Medium without cultured bacteria (preparation method same as in example 1)

Blank control: HTLA cells transfected with GPCR-tango plasmid were not subjected to any treatment.

(2) Experimental method

A. HEK293 cell lines (manufacturer: HTLA; provided by the institute of immunology, university of science and technology) stably expressing β -arrestintev and tTA-luciferases were placed in DMEM medium (manufacturer: gibco; manufacturer: C11995500 BT) containing 10% fetal bovine serum (manufacturer: viva cell; manufacturer: C04001-500) and 1% penicillin/streptomycin (manufacturer: viva cell; manufacturer: C3420-0100) for cultivation;

B. Transfection mixture preparation: 200 The ng/well GPCR-tango plasmid (provided by the institute of immunology, university of science and technology) was mixed with 400 ng polyethylenimine (manufacturer: gibco; cat# 31985070) in 20. Mu.L opti-MEM (manufacturer: next holy organism; cat# 40816ES 03) (dissolved in 20. Mu.L opti-MEM) and incubated at room temperature for 20 minutes;

C. After the cells of step a are cultured to about 90% confluence, the transfection mixture of step B is added to the cells;

D. After 16-24 hours of transfection, cells were collected by centrifugation, the supernatant was discarded, and after resuspension with 180. Mu.L of DMEM medium (manufacturer: gibco; product: C11995500 BT) containing 1% penicillin/streptomycin and 10 mM HEPES (manufacturer: punuocele; product: PB 180325), 20. Mu.L of i) E.faecalis bacterial culture supernatant, or ii) positive drug, or iii) DMEM medium blank was added;

E. E. faecalis bacterial culture supernatant (or positive or blank) from step D is stimulated for 16-24 h, and then centrifuged at 1500 g for 6-min h, the supernatant is discarded, and 50 μl of Bright-Glo solution diluted 20 times with 20 mM HEPES-containing PBS (manufacturer: promega; product number: E2610) is added to each well;

F. after incubation for 20 minutes at room temperature, fluorescent quantification was performed.

(3) Experimental results:

The strain activation rate was calculated as the ratio of the fluorescence quantitative value of the strain to the fluorescence quantitative value of the culture medium, and found that there were at least 10 strains e.faecalis capable of significantly activating GPR120 and MC4R, and the strain having the highest activation effect was designated as EF1 in fig. 1 and 2. As can be seen, EF1 activated GPR120 and MC4R more than the corresponding positive drugs, suggesting a possible therapeutic effect in metabolic diseases, and further experiments were performed.

Example 3E characterization of FAECALIS EF Strain 1

E. FAECALIS EF1 screened in example 2 was further identified.

Characteristics of the cells: E. the morphology of FAECALIS EF strain after staining under a 40-fold light microscope is shown in FIG. 3. Under microscope, anaerobic culture was carried out at 37℃in mGAM medium for 24: 24 h, gram staining was positive, and cells were spherical and had an average diameter of about 0.7. Mu.m.

Colony characteristics: E. the growth of FAECALIS EF strain on the plate is shown in FIG. 4, and the strain is anaerobically cultured in mGAM medium at 37 ℃ for 24 h, and the colony is round, moist, opaque, light yellow and neat in edge.

Growth characteristics: the isolated strain grows both aerobically and anaerobically, but grows faster in anaerobically, with an optimum growth temperature of 37 ℃.

16S rRNA sequencing: the sequence of the 16s rRNA gene returned by sequencing is shown as SEQ ID NO.1, and is submitted to NCBI Basic Local ALIGNMENT SEARCH Tool for strain 16s rRNA gene analysis. The comparison shows that the strain with the highest similarity is Enterococcus FAECALIS STRAIN ATCC and 19433, and the similarity is 100%.

The E. FAECALIS EF1 strain was designated enterococcus faecalis (Enterococcus faecalis) ibiome009 and was deposited with the China center for type culture collection at the following addresses: the China center for type culture collection of Wuhan university in Wuhan district of Wuhan, hubei province; the preservation date is: 2023, 08, 14; the preservation number is: cctccc M20231464.

Example 4E. FAECALIS EF1 (ibiome 009) improves high fat diet-induced obesity and related symptoms

(1) Experimental method

C57BL/6J mice (purchased from Jiangsu Jiuyaokang biotechnology Co., ltd.) were fed with high-fat feed for 20 weeks, screened according to body weight, and the average body weight of the selected mice was 47 g, and the selected mice were randomly divided into a control group, an experimental group and a positive drug group, each group of 10 mice. The mice of each group were dosed while continuing to feed with high fat diet until the end of the experiment.

The control group is irrigated with 0.4 mL of 0.9% physiological saline/day;

The experimental group fills the stomach E. FAECALIS EF1 (ibiome 009), according to the viable count of the freeze-dried bacterial powder in each batch, the gram count of the bacterial powder required by 10 and ⁹ CFU/only is calculated for each time of filling the stomach, and then the bacterial powder is resuspended in 0.4mL of 0.9% physiological saline once a day;

the positive drug group was infused with metformin hydrochloride (Michelin M813341-25 g), and each mouse was given 204mg/kg of metformin hydrochloride by weight, dissolved in 0.4mL of 0.9% physiological saline, once daily.

The following experiments were performed:

a. body weight was monitored weekly;

b. Fasting blood glucose was measured at week 5 of dosing (12 hours fasted);

c. oral glucose tolerance (OGTT) was tested at week 10 of dosing: the mice are fasted for 12 hours, blood is taken from the tail tips (0 h) for measuring blood sugar and 2 g/kg glucose solution is filled into the stomach, then blood is taken from the tail tips of 30min, 60min and 120min respectively for measuring blood sugar, a blood sugar time-varying curve is drawn, and the area under the curve is calculated;

d. After administration for 10 weeks, mice were fasted with 12 h, blood was collected from the eyeballs and placed in heparin tubes, 4000 rpm, centrifuged at room temperature for 10 min, and the supernatant was taken to a new centrifuge tube and stored at-80℃for further use, and triglyceride (Nanjing; A110-1-1) and high-density lipoprotein-cholesterol (Nanjing; A111-1-1) in the blood were detected using the kit.

(2) Experimental results

① Weight change during dosing

As shown in FIG. 5, the gastric lavage E. FAECALIS EF1 (ibiome) strain had a significant decrease in body weight from week 2 and significantly inhibited the increase in body weight of the mice compared to the control group.

② Effects of dosing on blood glucose in mice

As shown in fig. 6, the gastric lavage e. FAECALIS EF1 (ibiome 009) strain was able to significantly reduce fasting blood glucose in mice without significant differences compared to the positive drug group.

As shown in fig. 7 and 8, the gastric lavage e. FAECALIS EF1 (ibiome) strain 009) was able to significantly reduce the area under the glucose tolerance curve and the effect of the experimental group was superior to the positive drug group.

The results show that the E. FAECALIS EF1 (ibiome 009) strain can improve the condition of insulin resistance and has better effect than the commercial hypoglycemic drug-metformin hydrochloride.

③ Effects of administration on lipid metabolism in mice

As shown in fig. 9, the gastric lavage e. FAECALIS EF1 (ibiome) strain was able to significantly reduce triglyceride levels in mice compared to the control group, and the effect was comparable to the positive drug group.

As shown in fig. 10, the gastric lavage e. FAECALIS EF1 (ibiome) strain was able to significantly increase the high density lipoprotein-cholesterol level in mice compared to the control group and the effect was superior to the positive drug group.

The results show that the E. FAECALIS EF1 (ibiome 009) strain can improve the lipid metabolism level and has better effect than the commercial metformin hydrochloride drug.

Comparative example E. FAECALIS EF2 Effect of 2 on high fat diet induced obese mice

In order to explore whether all E.faecalis has the effects of inhibiting weight gain, reducing fasting blood glucose, improving lipid metabolism level and the like, E. FAECALIS EF2 of the same different strains are selected for experiments. E. FAECALIS EF2 is derived from the microbial pool of the vast microorganisms technologies limited, and is a different donor source than e. FAECALIS EF.

(1) Experimental method

C57BL/6J mice (purchased from Jiangsu Jiuyaokang biotechnology Co., ltd.) were fed with high-fat feed for 20 weeks, screened according to body weight, and the average body weight of the selected mice was 47 g, and the selected mice were randomly divided into a control group and an experimental group, each group of 10 mice. The mice of each group were dosed while continuing to feed with high fat diet until the end of the experiment.

The control group is irrigated with 0.4 mL of 0.9% physiological saline/day;

the experimental group is filled with E. FAECALIS EF2, according to the viable count of the freeze-dried bacterial powder in each batch, the gram count of the bacterial powder required by 10 ⁹ CFU/each time of filling is calculated, and then the bacterial powder is resuspended in 0.4mL of 0.9% physiological saline once a day.

The following experiments were performed:

a. body weight was monitored weekly;

b. Fasting blood glucose was measured at week 5 of dosing (12 hours fasted);

c. oral glucose tolerance (OGTT) was tested at week 10 of dosing: the mice are fasted for 12 hours, blood is taken from the tail tips (0 h) for measuring blood sugar and 2 g/kg glucose solution is filled into the stomach, then blood is taken from the tail tips of 30min, 60min and 120min respectively for measuring blood sugar, a blood sugar time-varying curve is drawn, and the area under the curve is calculated;

d. After 13 weeks of administration, mice fasted 12h, were subjected to eyeball blood collection and placed in a heparin tube, 4000rpm were subjected to room temperature centrifugation 10min, supernatant plasma was taken to a new centrifuge tube, and stored at-80 ℃ for later use, and triglyceride in blood was detected by using a kit (Nanjing; A110-1-1).

(2) Experimental results

As shown in figures 11-15, the gastric lavage E. FAECALIS EF2 strain has no significant differences in mice weight, fasting blood glucose, glucose tolerance, and triglycerides compared to the control group, indicating that not all E.faecalis strains can play a positive role in preventing and treating metabolic diseases.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solution of the present invention should fall within the scope of protection defined by the claims of the present invention without departing from the spirit of the present invention.

Claims (10)

1. Enterococcus faecalis (Enterococcus faecalis) ibiome009, characterized in that: the enterococcus faecalis strain is preserved in China center for type culture collection, the address is eight ways of China center for type culture collection of university of Wuhan in Wuhan, hubei province, and the preservation date is 2023, 8 months and 14 days, and the preservation number is CCTCC M20231464.

2. A medicament, characterized in that: comprising enterococcus faecalis (Enterococcus faecalis) ibiome009 of claim 1 and pharmaceutically acceptable excipients.

3.A medicament according to claim 2, characterized in that: the pharmaceutically acceptable auxiliary materials comprise at least one of an adjuvant, a stabilizer or a protective agent, a bacteriostatic agent, an excipient, a cosolvent, a flavoring agent, a diluent and a buffering agent.

4. A medicament according to claim 2 or 3, characterized in that: the medicine is any one of powder, suspension, granule, capsule, tablet, pill, oral liquid, injection and powder injection.

5. A pharmaceutical composition characterized by: comprising enterococcus faecalis (Enterococcus faecalis) ibiome009 of claim 1 and a combination of other agents that act synergistically with enterococcus faecalis (Enterococcus faecalis) ibiome 009.

6. The pharmaceutical composition according to claim 5, wherein: the combined medicine is other active ingredients of hypoglycemic and hypolipidemic medicines, such as GLP-1 receptor agonists, GLP-1 analogue medicines, biguanides medicines and the like.

7. A starter, functional microbial agent or nutritional composition comprising enterococcus faecalis (Enterococcus faecalis) ibiome009 of claim 1.

8. The starter, functional microbial agent or nutritional composition of enterococcus faecalis (Enterococcus faecalis) ibiome009 according to claim 7, wherein: the nutritional composition is a food, a nutraceutical, a supplement, a probiotic or a symbiotic.

9. Use of enterococcus faecalis (Enterococcus faecalis) ibiome009 of claim 1 or a medicament of any one of claims 2-4 or a pharmaceutical composition of any one of claims 5-6 in the manufacture of a medicament for the treatment, alleviation, prevention of a metabolic disorder.

10. The use according to claim 9, wherein the medicament is for at least one of the following uses:

Preventing or treating diabetes caused by obesity;

preventing or treating type II diabetes;

Activating GPR120 and/or MC4R;

Reducing the weight of the mammal;

reducing the weight of adipose tissue of the mammal;

Lowering fasting blood glucose in the mammal;

improving impaired oral glucose tolerance in a mammal;

improving abnormal fasting insulin content in a mammal;

Reducing the glycosylated hemoglobin content;

decreasing the area under the insulin resistance curve;

Lowering the HOMA-IR index in the mammal;

Improving the level of at least one of the following in mammalian blood: total cholesterol, triglycerides, high density lipoprotein-cholesterol, low density lipoprotein-cholesterol, free fatty acids;

improving the level of at least one of the following in the liver of a mammal: total cholesterol, triglycerides, high density lipoprotein-cholesterol, low density lipoprotein-cholesterol, free fatty acids;

Increasing glucagon-like peptide-1 content.