CN117821334A - EF strain and application thereof in preventing, relieving and treating fatty liver - Google Patents

Abstract

The invention relates to the technical field of biology, in particular to enterococcus faecalisEnterococcus faecalis) iriome 019 and provides a composition comprising enterococcus faecalisEnterococcus faecalis) The ibiome019 strain has the functions of improving the lipid deposition of HePG2 cells, raising the level of high density lipoprotein-cholesterol in blood and improving the level of total cholesterol, triglyceride, low density lipoprotein-cholesterol and free fatty acid in liver. The enterococcus faecalis of the inventionEnterococcus faecalis）ibiome019The strain has great clinical application value and can be used for preventing, improving or treating fatty liver, especially metabolic related fatty liver diseases.

Description

EF strain and application thereof in preventing, relieving and treating fatty liver

Technical Field

The invention relates to the technical field of biology, in particular to enterococcus faecalisEnterococcus faecalis) An ibiome019 strain and application thereof in preventing, relieving and treating fatty liver.

Background

Fatty liver is a common liver disease characterized by excessive fat accumulation in the liver. With the change of life style and the adjustment of diet structure of people, the incidence of fatty liver is in an increasing trend year by year, and becomes a public health problem concerned in the global scope. At present, the population suffering from fatty liver is numerous worldwide, and a great burden is brought to patients and society. Therefore, it has become a hot spot for research in the medical field for the treatment and prevention of fatty liver.

Currently, methods for treating fatty liver are diverse, including drug therapy, diet adjustment, exercise therapy, and the like. Among them, drug therapy is one of the common means, and the symptoms of fatty liver are improved by using some drugs to regulate blood lipid, anti-inflammatory, antioxidant and other approaches. However, drug therapy often has certain side effects and dependencies, and thus the search for safer and more effective treatments is an important direction of research.

In addition to drug therapy, the important role of intestinal microorganisms in the treatment of fatty liver has been receiving attention in recent years. Intestinal microorganisms refer to the microflora living in the intestinal tract, which affect human health by affecting nutrient absorption, metabolism, immunity, etc. Research shows that the diversity, composition and metabolites of intestinal microorganisms are closely related to the occurrence and development of fatty liver. By regulating the composition and metabolism of intestinal microorganisms, the symptoms and prognosis of fatty liver can be improved. Therefore, a therapeutic method using intestinal microorganisms is a promising field of research.

Enterococcus faecalisEnterococcus faecalis) Is a common intestinal microorganism and belongs to the enterococcus genus. Enterococcus faecalis has the ability to withstand gastric acid and bile, can survive in the intestinal tract and exert a certain physiological effect. However, there is currently little research on enterococcus faecalis in the treatment of fatty liver. Therefore, further research on the application prospect and feasibility of enterococcus faecalis in treating fatty liver is necessary.

Disclosure of Invention

The invention aims to solve the defects in the prior art and provides the enterococcus faecalisEnterococcus faecalis) An ibiome019 strain and application thereof in preventing, relieving and treating fatty liver.

The invention is realized by the following technical scheme:

enterococcus faecalisEnterococcus faecalis) ibiome019 is preserved in China center for type culture collection, the address is eight ways of China center for type culture collection of university of Wuhan in Wuhan, hubei province, and the preservation date is 2023, 12 months and 25 days, and the preservation number is CCTCC NO: M20232672.

The invention also protects a medicine comprising the enterococcus faecalisEnterococcus faecalis) ibiome019 or culture supernatant thereof, and pharmaceutically acceptable auxiliary materials.

The auxiliary materials can be classified into various modes in the preparation, such as sources, actions, purposes, administration routes and the like. The natural products, semisynthetic products and fully synthetic products can be classified by source. The auxiliary materials are classified into 65 types according to the functions and the purposes of the auxiliary materials in the preparation, namely, a pH regulator, a chelating agent, a coating agent, a protective agent, a humectant, a disintegrating agent, a surfactant, a virus inactivating agent, a supplement, a precipitating agent, a film forming material, a flavoring agent, an excipient for freeze drying, a carbon dioxide adsorbent, a foaming agent, a flavoring agent, a preservative, an excipient, a drying agent, a curing agent, a buffering agent, a sustained and controlled release material, an adhesive, a flavoring agent, an antioxidant synergistic agent, an anti-adhesive agent, an air replacement agent, a condensing agent, a paste base material, a gel material, a polishing agent, a propellant, a solvent, a softening agent, an emulsifying agent, an ointment base, a soft capsule material, a lubricant, a wetting agent, a penetration enhancer, an osmotic pressure regulator, a suppository base, a sweetener, a filler, a pellet core, a stabilizing agent, an adsorbent, a diluent, a defoaming agent, a flocculating agent, an ethanol modifier, a plaster base, an ink, a thickening agent, a solubilizer, a plasticizer, a binding agent, a Chinese medicinal auxiliary material, a cosolvent, a suspending agent and a coloring agent.

The pharmaceutically acceptable auxiliary materials comprise at least one of adjuvant, stabilizer or protective agent, bacteriostat, excipient, cosolvent, correctant, diluent and buffer.

Adjuvants: is a substance that is mixed with one or more components that bind to a vaccine antigen to enhance [ e.g., boost, accelerate, prolong, and/or potentially direct ] its specific immune response and clinical effects of the vaccine.

Stabilizers or protectants: a substance for stabilizing or protecting the active ingredient of biological products, preventing degradation or inactivation thereof.

Bacteriostat: a substance for inhibiting the growth of microorganisms and preventing microbial contamination.

Excipient: the material is used for forming medicines and playing a role of a bracket in freeze-dried products.

Cosolvent: a substance for increasing the solubility of a drug.

Flavoring agent: a substance for improving the taste of oral medicines.

Diluents, buffers: the solvent is used for dissolving and diluting products, and adjusting the pH value of the products, such as water for injection, sodium chloride injection, phosphate buffered physiological sodium chloride solution (PBS) and the like.

Exemplary excipients include, but are not limited to: butylated Hydroxytoluene (BHT), calcium carbonate, calcium phosphate (monohydrogen), calcium stearate, croscarmellose, crospovidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl p-hydroxybenzoate, microcrystalline cellulose, polyethylene glycol, povidone, pregelatinized starch, propyl p-hydroxybenzoate, retinol palmitate, shellac, silica, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin a, vitamin E, vitamin C, and xylitol.

The medicament can be prepared in the form of an injection preparation or an oral preparation. The injection preparation comprises liquid injection, powder for injection and tablets for injection according to the classification of physical states; the classification according to the injection part includes intradermal injection, subcutaneous injection, intramuscular injection, intravenous injection, and spinal cavity injection; preferred solvents for the injectable preparation include injectable water or physiological saline.

Formulations for oral use include tablets containing the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients. These excipients may be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugar, mannitol, microcrystalline cellulose, starches including potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate, or sodium phosphate); granulating and disintegrating agents (e.g., cellulose derivatives including microcrystalline cellulose, starches including potato starch, croscarmellose sodium, alginates, or alginic acid); binders (e.g., sucrose, glucose, sorbitol, acacia, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, ethyl cellulose, polyvinylpyrrolidone, or polyethylene glycol); and lubricants, glidants, and anti-tackifiers (e.g., magnesium stearate, zinc stearate, stearic acid, silicon dioxide, hydrogenated vegetable oils, or talc). Formulations for oral use may also be presented as chewable tablets, or as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g. potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g. peanut oil, liquid paraffin, or olive oil). Powders, granules and pills can be prepared in a conventional manner using the ingredients mentioned above under tablets or capsules using, for example, mixers, fluidized bed equipment or spray drying equipment.

Other pharmaceutically acceptable excipients for oral formulations include, but are not limited to, coloring agents, flavoring agents, plasticizers, humectants, and buffers. Formulations for oral use may also be presented as chewable tablets, or as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent (e.g. potato starch, lactose, microcrystalline cellulose, calcium carbonate, calcium phosphate, or kaolin), or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium (e.g. peanut oil, liquid paraffin, or olive oil). Powders, granules and pills can be prepared in a conventional manner using the ingredients mentioned above under tablets or capsules using, for example, mixers, fluidized bed equipment or spray drying equipment.

In some embodiments, administering includes administering the medicament described herein intramuscularly, intravenously (e.g., in the form of a sterile solution and in a solvent system suitable for intravenous use), intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intra-articular, intra-prostatic, intrapleural, intratracheal, intranasal, intravitreal, intravaginally, intrarectal, topical, intratumoral, intraperitoneal, subcutaneous, subconjunctival, intracapsular, transmucosal, intrapericardiac, intraumbilical, intraocular, oral (e.g., tablet, capsule, caplet, or syrup), topical (e.g., in the form of a cream, gel, lotion, or ointment), topically, by inhalation, by injection, or by infusion (e.g., continuous infusion in the form of a cream or lipid composition, local infusion by direct infusion of the target cells, catheterization, lavage).

The invention also protects a pharmaceutical composition comprising the enterococcus faecalisEnterococcus faecalis) ibiome019 or culture supernatant thereof, and a combination drug of other drugs of the formula @ with enterococcus faecalis @, wherein the combination drug isEnterococcus faecalis) iriome 019 plays a role in synergy.

Preferably, the combination is other hypoglycemic and lipid-lowering pharmaceutical active ingredients, such as GLP-1 receptor agonists or GLP-1 mimics, GIP receptor agonists, dipeptidyl peptidase-4 inhibitors, metformin and the like, and is specifically selected from exenatide, liraglutide, cable Ma Lutai, oral dosage form cable Ma Lutai, benraglutide, liraglutide, exenatide weekly preparations and the like.

The formulation of the composition is granule, capsule, tablet, powder, oral liquid, suspension, emulsion or the like.

The effective dosage of the invention is enterococcus faecalisEnterococcus faecalis) Total viable count contained in viable bacteria preparation prepared by using iriome 019 as main pharmaceutical active ingredientIs 10 ⁶ -10 ¹⁴ CFU。

The administration period is based on the effect that can be achieved, including but not limited to 1-3 times daily, 3-7 days per week, etc., and is dependent on the concentration of the particular formulation.

The invention also protects the enterococcus faecalis containing the above-mentioned enterococcus faecalisEnterococcus faecalis) iriome 019 starter, functional microbial inoculum or nutritional composition.

Fermenting agent or functional microbial agent comprising the enterococcus faecalisEnterococcus faecalis) Bacterial liquid prepared by ibiome019, or powder or granules obtained by further treatment; the ferment can further comprise more than one microbial agent which is not antagonistic to each other, and is prepared from more than one compound microbial agent selected from Krils Teng Senjun, paralopecuroides, acremodella muciniphila and Bacteroides thetaiotaomicron.

The effective bacterial agent concentration and the viable count are 10 ⁶ -10 ¹⁴ CFU。

The ferment or functional microbial inoculum can also be used as functional food and nutritional products.

Nutritional composition comprising enterococcus faecalis as described aboveEnterococcus faecalis) ibiome019, food, nutraceutical, supplement, probiotic or symbiotic.

The food comprises the enterococcus faecalisEnterococcus faecalis) iriome 019 and auxiliary substances that perform food functions in forms including, but not limited to, "dietary supplements," "fermented foods," and the like.

The dietary supplement comprises the enterococcus faecalisEnterococcus faecalis) Bacterial liquid prepared by the ibiome019 or powder obtained by further treatment, and further added with nutrients such as cellulose, vitamins, minerals and the like for treatment.

The fermented food comprises dairy products, bean products or fruit and vegetable products and the like. The dairy product is milk, sour cream or cheese, etc. The bean product is soybean milk, fermented soybean or soybean paste. The fruit and vegetable products are cucumber, carrot, beet, celery or cabbage products and the like.

By probiotic is meant a living microorganism which, when provided in a suitable amount, is beneficial for the health of the host organism.

Symbiotic bacteria refer to those foods that contain a mixture of probiotics and probiotics. They generally comprise a probiotic component that is beneficial for growth and/or metabolic activity, and generally interact with a polypeptide such as, but not limited to, enterococcus faecalisEnterococcus faecalis) The probiotic effect of ibiome019 in combination with fructo-oligosaccharides or galacto-oligosaccharides.

The invention also protects the enterococcus faecalisEnterococcus faecalis) Use of ibiome019 or a culture supernatant thereof, or a medicament or a pharmaceutical composition as described above for the preparation of a medicament for treating, alleviating and preventing fatty liver.

Fatty liver is classified from etiology into alcoholic fatty liver, non-alcoholic fatty liver, and special type of fatty liver, wherein non-alcoholic fatty liver has been renamed as metabolic-related fatty liver disease (MAFLD) in 2020. The fatty liver of most people is metabolic related fatty liver disease caused by simple obesity, and the fatty liver mainly refers to metabolic related fatty liver disease.

MAFLD diagnostic criteria (Eslam M, et al A new definition for metabolic dysfunction-associated fatty liver disease: an international expert consensus statement J hepatol 2020;73 (1): 202-209. Doi:10.1016/J. Jhep.2020.03.039) are met by 2 or more of the following:

1. for Asians, the waistline is greater than 90/80cm;

2. blood pressure greater than 130/85mmHg or receiving specific drug treatment;

3. plasma triglycerides not less than 150mg/dl (170 mmol/L), or treated with specific drugs;

4. male: plasma HDL-cholesterol <40 mg/dl (< 1.0 mmol/L),

female: plasma HDL-cholesterol <50 mg/dl (< 1.3 mmol/L), or receiving drug treatment;

5. pre-diabetes mellitus: the fasting blood sugar value reaches 100-125mg/dl (5.6-6.9 mmol/L),

or the blood glucose level reaches 140-199 mg/dl (7.8-11.0 mmol) after 2 hours,

glycosylated hemoglobin 39-47mmol/mol;

6. insulin resistance score >2.5;

7. plasma high sensitivity C-reactive protein level >2mg/L.

It is contemplated that embodiments of the invention may be combined within the scope of the invention such that any combination of the features described herein is also included within the scope of the invention. In particular, it is contemplated within the scope of the invention that any therapeutic effect of the bacteria may be simultaneously manifested.

Preferably, the medicament is for at least one of the following uses:

improving the lipid deposition of the HePG2 cells;

activating GPR120 and/or MC4R;

improving the high density lipoprotein-cholesterol level in the blood of the mammal;

improving the level of at least one of the following in the liver of a mammal: total cholesterol, triglycerides, low density lipoprotein-cholesterol, free fatty acids.

The invention has the beneficial effects that:

the enterococcus faecalis of the inventionEnterococcus faecalis) The ibiome019 strain can remarkably improve the lipid deposition of HePG2 cells and activate GPR120 and MC4R; can increase the high density lipoprotein-cholesterol level in the blood, i.e. can improve the lipid metabolism level, and can improve the total cholesterol, triglyceride, low density lipoprotein-cholesterol, free fatty acid level in the liver. The enterococcus faecalis of the inventionEnterococcus faecalis) The ibiome019 strain has great clinical application value and can be used for preventing, improving or treating fatty liver, especially metabolism related fatty liver diseases.

Preservation of organisms

Enterococcus faecalisEnterococcus faecalis) ibiome019, the preservation date 2023 is 12 months 25 days, the preservation place is China center for type culture Collection, the address is eight paths of China center for type culture collection of Wuhan university in Wuhan, hubei province, and the preservation number is CCTCC NO: M20232672.

Drawings

FIG. 1 shows a morphology of normal cells after staining in the HePG2 cell experiment of example 2.

Fig. 2 shows a morphology of the fatty liver cell model after staining in the HePG2 cell experiment of example 2.

FIG. 3 shows the HePG2 cell assay of example 2E. faecalisEffect of the ibiome019 strain on fatty liver cell model.

Fig. 4 shows the effect of other strains on fatty liver cell model in the HePG2 cell experiment of example 2.

FIG. 5 shows the process of example 3E. faecalis Microscopic morphology of the ibiome019 strain.

FIG. 6 shows the structure of example 3E. faecalis Macroscopic morphology of the ibiome019 strain.

FIG. 7 showsE. faecalis The ibiome019 strain activated GPR120 assay in the cell level experiments of example 4.

FIG. 8 showsE. faecalis The ibiome019 strain activated MC4R assay in the cell level experiments of example 4.

FIG. 9 shows the high fat diet induced fatty liver mice experiments of example 5E. faecalis The iriome 019 strain improves the plasma high density lipoprotein-cholesterol of mice.

FIG. 10 shows the results of the high fat diet induced fatty liver mice experiments of example 5E. faecalis The ibiome019 strain improves the liver triglyceride of mice.

FIG. 11 shows the results of the high fat diet induced fatty liver mice experiments of example 5E. faecalisThe ibiome019 strain improves the total cholesterol of the liver of the mice.

FIG. 12 shows the results of the high fat diet induced fatty liver mice experiments of example 5E. faecalisThe ibiome019 strain improves the liver low density lipoprotein-cholesterol of mice.

FIG. 13 shows the results of the high fat diet induced fatty liver mice experiments of example 5E. faecalisThe ibiome019 strain improves the liver free fatty acid status of mice.

Detailed Description

For a better understanding of the present invention, reference will now be made to the following examples, which are intended to illustrate, but not to limit the present invention, with reference to the accompanying drawings. Each of the reagents and materials mentioned herein are conventional commercial products.

EXAMPLE 1 isolation and preliminary identification of strains

Healthy volunteers which do not use antibiotics within one year are recruited, after an informed consent is signed, the volunteers take fresh excrement of 2-5 g, put the fresh excrement into a sample collecting tube containing glycerin, shake and homogenize the excrement sample, put the treated excrement sample into an ice box, and send the excrement sample to an applicant laboratory for strain separation within 24 h.

(1) Pretreatment of fecal samples: adding 1X 1 mL mixture into 9 mL 1 Xsterile PBS solution from sample collection tube containing glycerol and feces, mixing with vortex oscillator, and gradually diluting to 10 mu L ^-9 For flat coating.

(2) 100 μl of diluted sample is coated on GAM culture medium (Soy Bao, LA 4450), and the surface of the plate is dried, and the plate is placed upside down on a microaerophilic bench for culturing (temperature: 37 ℃ C., O) ₂ ：5%，CO ₂ :5%, mixed gas: 90 percent), standing and culturing for 24-36 hours, after a monoclonal colony grows out, carrying out repeated streak purification on the monoclonal, and carrying out 16s rRNA sequencing on the purified strain to determine the taxonomic position of the strain.

(3) 16s rRNA sequencing: carrying out 16s rRNA PCR amplification on the strain to be identified, wherein the amplification system comprises: 2 Taq Master Mix (Norflu; P112-01) 12.5. Mu.L, primer 1 (27F: AGAGTTTGATCCTGGGCTCAG) 1. Mu.L, primer 2 (1492R: TACGGCTACCTTGTTACGACTT) 1. Mu.L, liquid cultured broth 1. Mu. L, ddH ₂ O9.5 μl; amplification conditions: 3 min at 95 ℃;95℃for 15 s,58℃for 15 s,72℃for 30s, 35 cycles; and at 72℃for 5 min. Sequencing the amplified product by the engine biotechnology Co., ltd, and submitting the sequence of the strain 16s rRNA gene returned by sequencing to NCBI Basic Local Alignment Search Tool for strain 16s rRNA gene analysis. In the comparison result, the strain with highest similarity corresponds to the strain as the corresponding strainAnd constructing a bacterial library.

Example 2 efficient strain screening of HePG2 cell fatty liver model

(1) Experimental materials

Preparation of bacterial culture supernatant: 100. Mu.L of each of the isolated and purified strains of example 1 was added to 2 mL of GAM medium (Soxhlet, LA 4450), and the culture was incubated in an incubator at 37℃for 48 h, centrifuged at 12000 rpm and 4℃for 10 min, and the supernatant was used for cell experiments.

(2) Experimental method

A. HePG2 cells (purchased from ATCC) were cultured in DMEM medium (Gibco, C11995500 BT) containing 10% fetal bovine serum (Viva cell, C04001-500) and 1% penicillin/streptomycin (Viva cell, C3420-0100).

B. Preparation of Free Fatty Acids (FFA): 20mM oleic acid (microphone, O815202) and 10mM palmitic acid (microphone, P799157) were combined at 2:1 to obtain 15mM free fatty acid, and diluting it to 0.25mM with cell culture medium (DMEM medium containing 10% fetal bovine serum and 1% penicillin/streptomycin, same as A).

C. After cell culture of step a to about 90% confluence, discarding the cell supernatant, adding FFA diluted in step B to the cell model group, and adding 20 μl of either i) bacterial culture supernatant, or ii) DMEM medium blank;

D. after 24h incubation, the supernatant was discarded, washed 1-2 times with PBS, fixed with 4% paraformaldehyde for 30min, the fixed solution was discarded, washed 2 times with distilled water, and immersed in 60% isopropanol for 30s. And (5) removing isopropanol, and then adding an oil red O staining solution for dip dyeing for 20min. Discarding the staining solution, rinsing with 60% isopropanol until the interstitial spaces are clear, washing with water for 5 times, and counterstaining with hematoxylin staining solution for 1-2min. After the staining solution was discarded, the solution was washed with water 5 times, distilled water was added, and the solution was observed under a microscope.

(3) Experimental results

Staining results were observed as shown in fig. 1, 2, with significant red lipid drop formation in FFA-interfered cells (fig. 2) compared to non-FFA-interfered cells (fig. 1). Further selecting out bacteria with optimal effect, finding that compared with other bacteria (such as 4 strains in FIG. 4), the cell model lipid drop of the bacterial culture supernatant after the dry prognosis of the bacterial culture supernatant is obviously reduced, and indicating that the bacterial culture supernatant can improve the lipid deposition of HePG2 cells and relieve the symptoms of fatty liver, thereby further identifying.

Example 3 identification of strains

The strains selected in example 2 were further identified.

Characteristics of the cells: the morphology of the strain after staining under a 40-fold microscope is shown in FIG. 5. Under microscope, anaerobic culture was carried out at 37℃in GAM medium for 24h, gram staining was positive, and cells were spherical and had an average diameter of about 0.7. Mu.m.

Colony characteristics: the growth of the strain on the plate is shown in figure 6, and the strain is anaerobically cultured in GAM culture medium at 37 ℃ for 24h, and the colony is round, moist in surface, opaque, light yellow and neat in edge.

Growth characteristics: the isolated strain grows both aerobically and anaerobically, but grows faster in anaerobically, with an optimum growth temperature of 37 ℃.

16s rRNA sequencing: the sequence of the 16s rRNA gene returned by sequencing is shown as SEQ ID NO.1, and the sequence is submitted to NCBI Basic Local Alignment Search Tool for strain 16s rRNA gene analysis. The comparison result shows that the strain with highest similarity isEnterococcus faecalis strain NBRC 100481, similarity was 100%.

The strain is named as enterococcus faecalisEnterococcus faecalis) iriome 019 is preserved to China center for type culture Collection with the preservation address: the China center for type culture collection of Wuhan university in Wuhan district of Wuhan, hubei province; the preservation date is: 2023, 12, 25; the preservation number is: cctccc No. M20232672.

EXAMPLE 4 enterococcus faecalisEnterococcus faecalis) iriome 019 activates GPR120 and MC4R at the cellular level in vitro

GPR120 is a receptor for long chain unsaturated fat and is expressed in various tissues of the human body, especially in various adipose tissues of the colon and liver. Studies have shown that GPR120 may play a key role in slowing down non-alcoholic fatty liver disease.

MC4R is expressed primarily in hypothalamic neurons and is the terminal most gene in the leptin-mediated appetite regulation pathway. MC4R can regulate food intake and energy expenditure by acting on central opioid-melanocyte pro-melanocyte (POMC) neurons, preganglionic neurons, and interactions with corresponding agonists, thereby improving obesity and regulating energy metabolism in the body. Studies have shown that knockout of the MC4R gene can reduce hepatic steatosis in mice, control body weight, reduce blood glucose, and regulate energy metabolism in humans.

Taken together, GPR120 and MC4R are important targets for the treatment of metabolic diseases such as liver steatosis, and we therefore used to verify the possible mechanism of action of this strain.

(1) Experimental materials

E. faecalisPreparation of iriome 019 bacterial culture supernatants: 100. Mu.L of glycerol bacteria (stored in glycerolE. faecalisThe ibiome019 bacteria) was added to 2 mL of GAM medium (solebao, LA 4450), incubated in an incubator at 37 ℃ for 48 h, and the cultures were centrifuged at 12000 rpm,4 ℃ for 10 min, and the supernatants were taken for cell screening.

Positive drug: GPR120 positive drug: GSK-137647A (manufacturer: selleck); MC4R positive drug: setmannide (Selleck, RM-493).

GAM medium control: GAM medium without cultured bacteria (Soy pal, LA 4450)

Blank control: HTLA cells transfected with GPCR-tango plasmid were not treated at all.

(2) Experimental method

A. HEK293 cell lines (manufacturer: HTLA; provided by the university of Chinese science and technology immunology research) stably expressing beta-arestintev and tTA-luciferases were placed in DMEM medium (Gibco, C11995500 BT) containing 10% fetal bovine serum (Viva cell, C04001-500) and 1% penicillin/streptomycin (Viva cell, C3420-0100) for cultivation;

B. transfection mixture preparation: 200 The ng/well GPCR-tango plasmid (provided by the institute of immunology, university of science and technology) was mixed with 400 ng polyethylenimine (in the next holy organism, 40816ES 03) in 20. Mu.L opti-MEM (Gibco, 31985070) and incubated at room temperature for 20 minutes;

C. after the cells of step a are cultured to about 90% confluence, the transfection mixture of step B is added to the cells;

D. after 16-24 hours of transfection, cells were collected by centrifugation, the supernatant was discarded, resuspended in 180. Mu.L of DMEM medium (Gibco, C11995500 BT) containing 1% penicillin/streptomycin and 10mM HEPES (Punuocele, PB 180325), and 20. Mu.L of i was addedE. faecalisiriome 019 bacterial culture supernatant, or ii) positive drug, or iii) DMEM medium blank;

E. step DE. faecalisAfter the ibiome019 bacterial culture supernatant (or positive drug or blank) is stimulated for 16-24 h, 1500 g is centrifuged for 6 min, the supernatant is discarded, and 50 μl of Bright-Glo solution (Promega, E2610) diluted 20-fold with 20mM HEPES-containing PBS is added to each well;

F. after incubation for 20 minutes at room temperature, fluorescent quantification was performed.

(3) Experimental results:

the strain activation rate was calculated as the ratio of the fluorescent quantitative value of the strain to the fluorescent quantitative value of the medium, and the results are shown in FIGS. 7 and 8,E. faecalisthe activation rate of ibiome019 on GPR120 and MC4R is higher than that of the corresponding positive drugs, which suggests that the strain can play a role in treating fatty liver by activating GPR120 and MC4R, thus further experiments are carried out.

Example 5E. faecalisiriome 019 improves fatty liver mouse-related symptoms induced by high-fat feed

(1) Experimental method

C57BL/6J mice (purchased from Jiangsu Jiugao Kangshen biotechnology Co., ltd.) were fed with high-fat feed for 20 weeks, screened according to body weight, and the average body weight of the selected mice was 47 g, and the selected mice were randomly divided into a control group and an experimental group, each group of 10 mice.

The control group is irrigated with 0.4mL of 0.9% physiological saline/day;

experimental group stomach lavageE. faecalisiriome 019, according to the living bacteria of each batch of freeze-dried bacteria powderCounting and counting 10 per lavage ⁹ CFU/gram of only required fungus powder, re-suspended in 0.4ml of 0.9% physiological saline once per day;

the following experiments were performed:

a. after 15 weeks of administration, mice fasted 12 h, were bled from the eyes, placed in heparin tubes, centrifuged at 4000 rpm for 10 min at room temperature, and the supernatant plasma was taken to a new centrifuge tube and stored at-80 ℃ for later use. The kit is used for detecting the high density lipoprotein-cholesterol (Nanjing built; A111-1-1) in blood.

b. Taking liver 100 mg after 15 weeks of administration, adding 900 μl PBS, homogenizing, centrifuging at 4000 rpm at room temperature for 10 min, taking supernatant to a new centrifuge tube, and preserving at-80deg.C for use; the kit is used for detecting triglyceride (Nanjing build; A110-1-1), total cholesterol (Nanjing build; A111-1-1), high density lipoprotein-cholesterol (Nanjing build; A111-1-1), low density lipoprotein-cholesterol (Nanjing build; A111-1-1) and free fatty acid (Nanjing build; A042-2-1) in liver.

(2) Experimental results

(1) Effects of administration on lipid metabolism in mice

As shown in fig. 9, the stomach E was irrigated compared to the control group.faecalisThe ibiome019 strain can obviously raise the level of high density lipoprotein-cholesterol in the blood of mice and improve the lipid metabolism capability.

(2) Effects of administration on fatty liver in mice

As shown in fig. 10, the stomach E was irrigated compared to the control group.faecalisThe ibiome019 strain can significantly reduce liver triglyceride levels in mice.

As shown in fig. 11, the stomach E was irrigated compared to the control group.faecalisThe ibiome019 strain can significantly reduce the liver total cholesterol level of mice.

As shown in fig. 12, the stomach E was irrigated compared to the control group.faecalisThe ibiome019 strain can significantly reduce the liver low density lipoprotein-cholesterol level of mice.

As shown in fig. 13, the stomach E was irrigated compared to the control group.faecalisThe ibiome019 strain can significantly reduce the free fatty acid level of the liver of mice.

The above results show that,E. faecalisthe ibiome019 strain can improve fatty liver symptoms of mice.

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims (10)

1. Enterococcus faecalisEnterococcus faecalis) iriome 019, its characterized in that: the enterococcus faecalis strain is preserved in China center for type culture collection, the address is eight ways of China center for type culture collection of university of Wuhan in Wuhan, hubei province, the preservation date is 2023, 12 months and 25 days, and the preservation number is CCTCC NO: M20232672.

2. A medicament, characterized in that: comprising the enterococcus faecalis according to claim 1Enterococcus faecalis) ibiome019 or culture supernatant thereof, and pharmaceutically acceptable auxiliary materials.

3. A medicament according to claim 2, characterized in that: the pharmaceutically acceptable auxiliary materials comprise at least one of an adjuvant, a stabilizer or a protective agent, a bacteriostatic agent, an excipient, a cosolvent, a flavoring agent, a diluent and a buffering agent.

4. A medicament according to claim 2 or 3, characterized in that: the medicine is any one of powder, suspension, granule, capsule, tablet, pill, oral liquid, injection and powder injection.

5. A pharmaceutical composition characterized by: comprising the enterococcus faecalis according to claim 1Enterococcus faecalis) ibiome019 or culture supernatant thereof, and a combination drug of other drugs of the formula @ with enterococcus faecalis @, wherein the combination drug isEnterococcus faecalis) iriome 019 plays a role in synergy.

6. The pharmaceutical composition according to claim 5, wherein: the combined medicine is other active ingredients of hypoglycemic and hypolipidemic medicines, such as GLP-1 receptor agonists, GLP-1 analogue medicines, biguanides medicines and the like.

7. A method comprising the enterococcus faecalis according to claim 1Enterococcus faecalis) A leavening agent, a functional microbial agent or a nutritional composition of ibiome 019.

8. The enterococcus faecalis according to claim 7Enterococcus faecalis) A ferment, functional microbial inoculum or nutritional composition of ibiome019, characterized in that: the nutritional composition is a food, a nutraceutical, a supplement, a probiotic or a symbiotic.

9. The enterococcus faecalis of claim 1Enterococcus faecalis) Use of ibiome019 or a culture supernatant thereof, or a medicament according to any one of claims 2 to 4 or a pharmaceutical composition according to any one of claims 5 to 6 for the manufacture of a medicament for the treatment, alleviation, prevention of fatty liver.

10. The use according to claim 9, wherein the medicament is for at least one of the following uses:

improving the lipid deposition of the HePG2 cells;

activating GPR120 and/or MC4R;

improving the high density lipoprotein-cholesterol level in the blood of the mammal;

improving the level of at least one of the following in the liver of a mammal: total cholesterol, triglycerides, low density lipoprotein-cholesterol, free fatty acids.