CN117917476A

CN117917476A - Resistance gene and application thereof

Info

Publication number: CN117917476A
Application number: CN202310609682.5A
Authority: CN
Inventors: 吕雪峰; 黄雪年; 张伟; 张璇; 郭勍
Original assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Current assignee: Qingdao Institute of Bioenergy and Bioprocess Technology of CAS
Priority date: 2022-10-21
Filing date: 2023-05-26
Publication date: 2024-04-23
Also published as: CN117917477A; CN117917472A; CN117917478A; WO2024082757A1; CN117917216A

Abstract

The present invention provides a resistance gene cfoL capable of conferring resistance to chlorothalonil to a microorganism, thereby enabling use as a screening tag for genetic transformation procedures of microorganisms.

Description

Resistance gene and application thereof

Technical Field

The invention belongs to the fields of microbial gene resources and genetic engineering, and particularly relates to a resistance gene and application thereof.

Background

The resistance tag is one of the basic elements in the development of a microorganism genetic manipulation system, and is the most basic guarantee for screening and obtaining positive transformants in the genetic transformation process. The existing resistance tags used for the genetic manipulation of fungi have few types and poor universality, so that the development of a genetic manipulation system in fungi is severely restricted. The applicant isolated the flavonoid chloroflavomycin containing chlorine atoms from Aspergillus candidus, also known as chlorofluorocarbon (chlorflavonin, CAS: 23363-64-6). The gene cluster responsible for the biosynthesis of the compound contains a self-resistance gene cfoL for encoding acetolactate synthase, and the gene can well endow fungi with resistance to the chlorothalonil, so that the combined use of the chlorothalonil and the cfoL can be used for genetic manipulation of the fungi, the discovery of cfoL enriches the types of genetic manipulation resistance tags, and a foundation is laid for development of a genetic manipulation system in the fungi.

Disclosure of Invention

In one aspect, the invention provides a resistance gene cfoL.

In one embodiment, the amino acid sequence of resistance gene cfoL has at least 80%, 85%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% sequence identity compared to SEQ ID No. 2; preferably, the resistance gene cfoL is derived from aspergillus candidus, for example, aspergillus candidus MEFC1001; more preferably, the amino acid sequence of the resistance gene cfoL has at least 99% sequence identity compared to SEQ ID No.2, and the resistance gene cfoL is derived from aspergillus candidus; the aspergillus candidus comprises aspergillus candidus MEFC1001,1001. More preferably, the amino acid sequence of the resistance gene cfoL is shown as SEQ ID No.2, and the coding gene sequence is shown as SEQ ID No. 1.

The aspergillus candidus MEFC is 1001 with a preservation number of CGMCC 3.15294, can be obtained commercially and is a fungus preserved in the common microorganism center of China Committee for culture Collection of microorganisms.

In another aspect, the invention also provides a vector or recombinant host cell comprising the above-described resistance gene cfoL.

In another aspect, the invention also provides the use of the above-described resistance gene cfoL to combat or impart resistance to chlorosis to a microorganism to which it is susceptible.

In the present invention, a microorganism sensitive to chlorothalonil means that the growth or activity of the microorganism is inhibited in the presence of chlorothalonil. For example, the growth level of the strain in the presence of chlorothalonil is reduced to 0%, 5%, 10%, 20% or 30% of the control level compared to the absence of chlorothalonil.

In some embodiments, the amount of chlorothalonil may be between 1 μg/mL and 200 μg/mL, such as ,2μg/mL、5μg/mL、10μg/mL、15μg/mL、20μg/mL、25μg/mL、30μg/mL、35μg/mL、40μg/mL、45μg/mL、50μg/mL、60μg/mL、70μg/mL、80μg/mL、90μg/mL、100μg/mL or 150 μg/mL.

The invention does not strictly limit the dosage level of the chlorothalonil, and the dosage level of the chlorothalonil which can make microorganisms sensitive or lethal can be obtained according to the conventional technology and the conventional operation in the field.

The resistance to chlorosis of a microorganism to which chlorosis is sensitive means that the introduction of the resistance gene cfoL into the microorganism to which chlorosis sensitive can alleviate or eliminate inhibition of growth or activity of the microorganism by chlorosis.

On the other hand, the invention also provides application of the resistance gene cfoL as an antibiotic resistance screening marker or screening tag; preferably, the antibiotic is chlorothalonil.

In one embodiment, the selectable marker or selectable tag may be placed in a vector/plasmid that is introduced into the microorganism of interest, which may result in the microorganism developing resistance to an antibiotic.

In the present invention, the selection marker or selection tag may be understood that the target microorganism introduced with the resistance gene cfoL is able to maintain a growth state in the presence of the chlorothalonil, whereas the microorganism not introduced with the resistance gene cfoL is unable to maintain a growth state in the presence of the chlorothalonil, so that the target microorganism introduced with the resistance gene cfoL may be selected; based on this, the resistance gene cfoL is made available as a resistance selection marker or selection tag for chlorosis.

In another aspect, the invention also provides the application of the resistance gene cfoL in preparing a resistance/tolerance chlorosis or a resistance-producing genetic engineering strain to chlorosis.

In another aspect, the present invention also provides a method for preparing a genetically engineered strain resistant to or resistant to chlorosis, said method comprising the step of introducing said resistance gene cfoL into said strain.

The "introduction" includes the step of expressing, preferably overexpressing, the above-mentioned gene of interest in the starting strain. For example, the gene of interest is constructed on an expression vector, which is transferred into a host cell to express the gene of interest, preferably over-expressed. In other embodiments, the "introducing" comprises inserting the gene of interest into the genome of the host cell; preferably, the insertion into the genome of the host cell may be by homologous recombination double crossover; in one embodiment, insertion of the gene of interest into the appropriate genomic location may be accomplished by inserting the gene of interest and the homology arms into the vector, and then transferring the vector into the host cell, using the homology arms to double-exchange homologous recombination with the host cell genome; in other embodiments, gene editing may also be employed, for example, using a CRISPR/Cas system to cleave at a desired genomic site, while inserting the gene of interest as an exogenous donor into the cleavage site.

In one embodiment, the starting strain of the genetically engineered strain is a strain sensitive to chlorothalonil; the introduction of the above-described resistance gene cfoL into a strain susceptible to chlorosis may result in the strain being resistant to chlorosis.

In the present invention, susceptibility to chlorosis means that the growth or activity of the strain or microorganism is inhibited in the presence of chlorosis. For example, the strain or microorganism has a growth level in the presence of chlorothalonil reduced to 0%, 5%, 10%, 20% or 30% of the control level compared to the absence of chlorothalonil.

In the present invention, resistance to, tolerance to or resistance to chlorosis, meaning similar, means that the microorganism or strain of interest is capable of sustaining growth in the presence of chlorosis. In particular, with respect to a microorganism sensitive to chlorosis, when the resistance gene of the present invention is introduced, "resistance to chlorosis, resistance to chlorosis or resistance to chlorosis" means that introduction of the above resistance gene cfoL into the microorganism sensitive to chlorosis can alleviate or eliminate inhibition of growth or activity of the microorganism by chlorosis.

In the present invention, a strain sensitive to chlorothalonil can be obtained by a method conventional in the art.

In one embodiment, the starting strain of the genetically engineered strain comprises a fungus, e.g., aspergillus fumigatus.

In other embodiments, the starting strain of the genetically engineered strain may be Candida albicans (Candida albicans) or sclerotium rolfsii (Sclerotium rolfsii sacc.).

In another aspect, the present invention also provides a genetically engineered strain capable of resisting, tolerating or developing resistance to chlorosis, said genetically engineered strain comprising the above-described resistance gene cfoL.

Drawings

FIG. 1. Composition of genes of cfo gene cluster responsible for the synthesis of chloroflavin in Aspergillus candidus.

FIG. 2. Gene cfoL is a self-resistance gene verification of chlorothalonil (1).

FIG. 3. Gene cfoL confers resistance to chlorosis (1) on A.fumigatus; a. growth of wild type A.fumigatus on PDA plates and PDA plates containing Compound 1. b. Transformants were screened for the cfoL gene introduced into Aspergillus fumigatus on the resistant plates containing Compound 1 and PCR verified for the transformants. c. Growth of wild type A.fumigatus and A.fumigatus overexpressing cfoL gene on PDA plates.

Detailed Description

The following examples are further illustrative of the invention and are not intended to be limiting thereof.

The experimental procedures, which do not address the specific conditions in the examples below, are generally carried out under conventional conditions or standard operating conditions for filamentous fungi or under conditions recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

Enzymolysis liquid: 0.4g of cellulase (Sigma product, catalog number: C1184), 0.4g of lyase (Sigma product, catalog number: L1412) and 0.2g of snailase (product of Biotechnology Co., ltd., shanghai, catalog number: SB 0870) were weighed out, dissolved in 50ml of 0.6M aqueous MgSO ₄ solution and sterilized by filtration through a sterile filter of 0.22. Mu.m.

In the invention, the plasmid extraction adopts an OMEGA PLASMID MINI KIT I Kit (D6942-01), the DNA fragment recovery adopts an OMEGA Cycle-Pure Kit (D6492-01), and the gel recovery adopts an OMEGA Gel Extraction Kit Kit (D2500-01).

PDBS plate: 24g/L potato culture medium PDB dry powder (BD company product, catalog number: 7114771), 1.2M sorbitol, 4g/L agarose, the balance deionized water, and after autoclaving at 121℃for 20 minutes, incubation at 48 ℃.

PDA plate: 39g/L potato medium PDA dry powder (BD company product, catalog number: 633840), balance deionized water, and autoclaved at 121℃for 20 minutes, and cooled to about 60℃to prepare a flat plate.

PDAS plates: 39g/L potato medium PDA dry powder (BD company product, catalog number: 633840), 1.2M sorbitol, balance deionized water, autoclaved at 121℃for 20 minutes, and cooled to about 60℃to prepare a plate.

SGCY medium: 2% sucrose, 1% glucose, 0.5% casein hydrolysate, 0.5% yeast extract powder, 1% MgCl ₂·6H₂ O, and the balance deionized water, and autoclaving at 121deg.C for 20 min, cooling to about 30deg.C, and inoculating and culturing.

PPM medium: 15% sucrose, 2.5% soybean meal, 0.5% peptone, 0.1% NaNO ₃ and the balance deionized water, and sterilizing at 121deg.C for 20 min, cooling to about 30deg.C, and inoculating and culturing.

SM medium is prepared from 10% glucose, 1% sucrose, 0.5% yeast extract, 0.5% peptone, 0.1% Na ₂CO₃, and deionized water by autoclaving at 121deg.C for 20 min, and inoculating and culturing at 30deg.C.

Example 1 fermentative preparation of Chloroflavone

1.1 Placing Aspergillus candidus MEFC1001 strain (commercially available, deposited on fungi of China general microbiological culture Collection center, registration number: CGMCC 3.15294) on a PDA plate for stationary culture, washing spores with sterile water, inoculating to SM medium, culturing seed solution at 28deg.C at 220rpm, inoculating to PPM medium, fermenting at 28deg.C at 220rpm for 14 days to obtain fermentation broth.

1.2 Extracting the fermentation liquor with ethyl acetate with the same volume for three times, and concentrating to obtain a crude extract. And (3) carrying out column chromatography on the crude extract by adopting a dry method column packing method, wherein the packing is octadecylsilane chemically bonded silica packing, and methanol water is subjected to gradient elution (10-100% of methanol volume), and each gradient elution comprises 10 column volumes. Target compound 1 was in 80% methanol/water fraction. The 80% methanol/water fraction was concentrated and dissolved in methanol, and the semi-prepared liquid phase was purified after filtration through a 0.22 μm filter. The purification method comprises the following steps: mobile phase a (100% water+0.05% formic acid), mobile phase B (100% acetonitrile+0.05% formic acid), column Waters X-bridge C18 (100 mm X10 mm,5 μm), flow rate 2mL/min, detection wavelength 345nm, adjusting the ratio of mobile phases a and B according to the polarity of compound 1, collecting each compound at the corresponding retention time. Based on HRESI and NMR identification, compound 1 was finally determined to be chlorothalonil (chlorflavonin, CAS: 23363-64-6).

The structural formula of compound 1 is shown below:

example 2, cfoL the genes are self-resistance genes of Aspergillus candidus against chlorofluorobacterins

In Aspergillus candidus MEFC1001, a gene cluster cfo responsible for synthesizing the chlorothalonil contains a gene cfoL encoding acetolactate synthase (the nucleic acid sequence is shown as SEQ ID No.1, the amino acid sequence is shown as SEQ ID No. 2) (the structure of the gene cluster is shown as figure 1).

SEQ ID No.1:

atgctccgaagtcgccaggcagcaaccgccctgagggccgtgggccagacccggccattgcggtcccagacaccattggccttcacgca

gtcgctcaacaaggtccctgtgaatcgcaggaccgaggccacggcggccactgcttcttctacggcgtcccaggtccgacccactccgagc

ccgacgttcaatcagtatgatagccaggtgcagccgttgacgggcgtgtcgaaaaatgtcacggatgagtcgtttatcggcaagtccggtgg

cgagatctttcacgacatgatgctacgacagggtgtcaagcatatctttggataccccggcggcgccattctccccgtcttcgatgcaatctaca

actccccgcacttcgacttcatcctccccaggcacgagcaaggcgccggccacatggccgaaggctacgcccgggcatctggaaagccg

ggcgtcgtcctcgtgacgtccggccccggcgccaccaacatcgtgacccccatgcaggacgcgctcctcgacgggacgccgatggtcgtc

ttctgcggccaggtcccgaccaccagtatcggcagcgacgccttccaagaggccgacatctgcggcatctcgcggccctgcaccaagtgg

aacgtcatggtcaagaacgtcgccgagcttccgcgccgcatcaacgaggcgttccagatcgccaccaccggccggcccggtcccgtcctc

gtcgacctgcccaaggacgtgacggccggcatcctgcgccgggcgattccgacggagagtgcgatcccctcgctgccgagcgccgcgat

ccaagacgccatggacctcaaccacaaacagctcgaggcctccgttgcgcgtgtcgctaagctcgtcaacatggccaagcagccggtcatc

tacgccggccagggcgtcgtccagtccgaactcgggcccgagctgctcaagcagctctccgacctcgcgtccatccccgtgaccaccacg

ctgcagggtctcggcggcttcgacgagctcgactacaagtccctgcacatgctcggcatgcacggatccggctacgccaacatggccatgc

aggaagcggacctcatcatcgccctcggcggacgcttcgacgaccgcgtgaccctcaacgtcagcaagttcgccccgggggcccgcgcc

gcggccgccgagaaccgcggcggcatcgtgcagttcgagatcatgcccaagaacatcaacaaggtggtggaggccaccgaggcgatcgt

cggcgacgtcggcaccaacctgcgcctgctcctgccgcacgtcgagccccgctcgctggacgaccgccaagcgtggtacaccaagatcg

acgcctggaagaagaggtggccgctgtcggactaccagaagaccgagcgccacgggctcatcaagccgcagacgctcatcgaggagct

gagcaacctctgcgccgaccgcaaggacaagacgtacatcacgaccggcgtcgggcagcaccagatgtggaccgcgcagcacttccgct

ggcgacatccccgcacgatgatcacctccggcgggctcggcacgatggggtacggcctgcccgcggcgatcggggccaaggtcgccca

gcccgacgccctcgtcgtcgacatcgacggcgacgcctcgttcaacatgaccctgacggagctgtccaccgccgcgcagttcaacatcggc

gtcaaggtcatcgtcctcaacaacgaggagcaggggatggtcacgcagtggcagaacctcttctacgaggaccggtacgcccatacccac

caggcgaacccggacttcatccagcttgccaccgccatgggcatccagggccagagagtggccgatccgaccaaggtcaaggagagcct

ccagtggctcatcgacacggacgggcctgccctgctggaggtgatcacggataagaaggtgcccgtgttgccgatggtgccgggtggatgt

ggtctgcatgagtttatcgcctttaatcctgaagatgaaaagacgcgtcgtgggctgatgcgcgagcggacgtgcgggcttcatgggtaaSEQ ID No.2:

MLRSRQAATALRAVGQTRPLRSQTPLAFTQSLNKVPVNRRTEATAATASSTASQVRPTPSPTFNQYDSQVQPLTGVSKNVTDESFIGKSGGEIFHDMMLRQGVKHIFGYPGGAILPVFDAIYNSPHFDFILPRHEQGAGHMAEGYARASGKPGVVLVTSGPGATNIVTPMQDALLDGTPMVVFCGQVPTTSIGSDAFQEADICGISRPCTKWNVMVKNVAELPRRINEAFQIATTGRPGPVLVDLPKDVTAGILRRAIPTESAIPSLPSAAIQDAMDLNHKQLEASVARVAKLVNMAKQPVIYAGQGVVQSELGPELLKQLSDLASIPVTTTLQGLGGFDELDYKSLHMLGMHGSGYANMAMQEADLIIALGGRFDDRVTLNVSKFAPGARAAAAENRGGIVQFEIMPKNINKVVEATEAIVGDVGTNLRLLLPHVEPRSLDDRQAWYTKIDAWKKRWPLSDYQKTERHGLIKPQTLIEELSNLCADRKDKTYITTGVGQHQMWTAQHFRWRHPRTMITSGGLGTMGYGLPAAIGAKVAQPDALVVDIDGDASFNMTLTELSTAAQFNIGVKVIVLNNEEQGMVTQWQNLFYEDRYAHTHQANPDFIQLATAMGIQGQRVADPTKVKESLQWLIDTDGPALLEVITDKKVPVLPMVPGGCGLHEFIAFNPEDEKTRRGLMRERTCGLHG*

To prove that cfoL genes are self-resistance genes of aspergillus candidus to the chlorothalonil, different gene deletion mutant strains are constructed, and finally cfoL can be found to endow the aspergillus candidus with the resistance to the chlorothalonil. The method comprises the following steps:

2.1 construction of target Gene knockout and anaplerotic mutant in Gene Cluster cfo

A pair of external primers was designed on the upstream and downstream sides, respectively, based on the nucleotide sequence cfoL. The left and right homology exchange arms for homologous recombination are obtained by PCR amplification, the lengths of which are about 1500 base pairs respectively, and a hygromycin resistance marker hph is connected between the homology arms. And (3) purifying and concentrating the PCR product to obtain a targeting element, knocking the targeting element into MEFC strain 1001, and screening to obtain a cfoL gene deleted mutant strain delta cfoL.

Specifically, MEFC strain 1001 is cultured in SGCY culture medium at 28 ℃ and 220rpm for 2 days, mycelium is collected by a sterile filter cloth of 100 meshes, the cell wall is digested by an enzymolysis liquid with the weight of 10 times of the mycelium, and the enzymolysis condition is that the enzymolysis liquid is digested at 30 ℃ and 130rpm for 2 hours. Filtering the enzymolysis solution by using 500-mesh sterile filter cloth, centrifuging and collecting the filtrate at 4000rpm to obtain protoplast, washing the protoplast once by using precooled 1.0M sorbitol solution, washing the protoplast once by using precooled STC (1.0M sorbitol, 50mM Tris-HCl-pH8.0, 50mM CaCl ₂), and finally spinning the protoplast into the precooled STC to adjust the concentration to 5X 10 ⁷ per mL to obtain protoplast suspension. To the suspension 10. Mu.L of the gene targeting element (about 3. Mu.g) was added, followed by 50. Mu. LPSTC (40% PEG4000,1.2M sorbitol, 50mM Tris-HCl-pH 8.0, 50mM CaCl ₂), gently mixed, and ice-incubated for 30min. 1mL of PSTC was added, the mixture was left at room temperature for 20min after mixing, and the mixture was poured into 5 PDAS screening plates (containing 50mg/L hygromycin B) after mixing with 15mL PDBS, and incubated for 5 days at 30℃in the dark.

Transformants with hygromycin resistance were selected from the screening plate and transferred to PDAH plates (PDA+50 mg/L hygromycin B), after 5 days of culture, part of mycelia on single colonies were picked up, the genome was extracted, and PCR amplification was performed using the outer primers on the homology arms as templates. If the random insertion PCR product is about 3.5kb in size, if homologous recombination occurs, the PCR product is about 5.0kb in size, indicating that the gene of interest is knocked out.

Using the same method as described above, a double knockout strain Delta cfoA-Delta cfoL was constructed to obtain simultaneous knockouts cfoA and cfoL. cfoA is a core gene responsible for synthesizing the chlorofluoromycin, and after cfoA is knocked out, the strain does not produce flavonoid compounds such as the chlorofluoromycin. In addition, cfoL genes are amplified on the genome of aspergillus candidus, and the delta cfoA-delta cfoL mutant strain is transformed to obtain a mutant strain delta cfoA-delta cfoL of the anaplerotic cfoL:: cfoL.

2.2 Plate resistance experiments of mutant strains

CfoL and Wild Type (WT) strains of all Aspergillus candidus mutants Delta cfoL, delta cfoA-. DELTA. cfoL, delta cfoA-. DELTA. cfoL obtained in 2.1 were inoculated on PDA plates and PDA plates containing final concentration of 10. Mu.g/mL of chlorothalonil (1), respectively, and the growth conditions of the wild type and each mutant strain were observed (FIG. 2). Mutant Δ cfoL grew slowly on both plates, whereas mutant Δ cfoA- Δ cfoL, which did not produce compound 1 (chlorothalonil), grew in PDA, and grew inhibited on PDA plates containing compound 1 (chlorothalonil). The mutant strain delta cfoA-delta cfoL of the anaplerotic cfoL:: cfoL was grown on both plates. The above experiments show that cfoL gene is a self-resistance gene in Aspergillus candidus, whose presence can resist the inhibition of the strain itself by chlorothalonil.

Example 3 self-resistance Gene cfoL can confer resistance to chlorofluoromycin to A.fumigatus

To verify whether cfoL gene confers resistance to chlorosis on other strains, applicant introduced cfoL gene into Aspergillus fumigatus sensitive to chlorosis, and found that Aspergillus fumigatus mutant strain acquired resistance to chlorosis. Thus, the cfoL gene in combination with chlorothalonil can be used for genetic transformation of A.fumigatus.

To verify whether the cfoL gene confers resistance to chlorosis on other strains, the applicant introduced the cfoL gene into Aspergillus fumigatus, which is sensitive to chlorosis. Specifically, aspergillus candidus MEFC is inoculated in PPM culture medium, cultured at 28 ℃ for 2 days at 220rpm, RNA in the culture medium is extracted by adopting MiniBEST Plant RNA Extraction Kit (TaKaRa) kit, DNA is reversely transcribed by adopting PRIMESCRIPT ^TM RT REAGENT KIT WITH GDNA ERASER (TaKaRa) kit, a CDS sequence of cfoL genes is obtained by specific primer amplification, and cfoL-CDS is connected with a constitutive promoter PgpdAt commonly used in Aspergillus by fusion PCR to construct an overexpression element. PEG-CaCl ₂ -mediated protoplast transformation method in Aspergillus fumigatus was essentially the same as that in Aspergillus candidus in example 2.3, the screening plate was PDAS (containing 10. Mu.g/mL of chlorothalonil), and transformants were observed to grow on the screening plate when cultured for 5 days under dark conditions at 30 ℃. A portion of the mycelium was picked up to extract genome, and PCR amplification was performed using a primer that gave cfoL-CDS sequence, which showed that all transformants contained cfoL-CDS sequence compared to the wild type (FIG. 3). The above results indicate that cfoL gene can confer resistance to chlorosis to aspergillus fumigatus strain, so cfoL gene in combination with chlorosis can be used for genetic manipulation of fungi, i.e. chlorosis can be used for strain resistance screening, and cfoL gene sequence can be used as resistance tag.

Specifically, aspergillus candidus MEFC1001 is inoculated into PPM culture medium, cultured at 28 ℃ for 2 days at 220rpm, RNA in the culture medium is extracted by adopting MiniBEST Plant RNA Extraction Kit (TaKaRa) kit, DNA is reversely transcribed by adopting PRIMESCRIPT ^TM RT REAGENT KIT WITH GDNA ERASER (TaKaRa) kit, a CDS sequence of cfoL genes is obtained by taking the DNA as template specific primer for amplification, and cfoL-CDS is connected with a common constitutive promoter PgpdAt in Aspergillus by fusion PCR to construct an over-expression element. PEG-CaCl ₂ -mediated protoplast transformation in A.fumigatus was essentially the same as in A.leucins transformation in example 2.1, and transformants were observed on screening plates which were PDAS (containing 10. Mu.g/mL of Compound 1 or crude extract containing Compound 1) and which were grown for 5 days at 30℃in the dark (FIG. 3).

A part of mycelium extracted genome is taken as a template for PCR amplification verification, and the result shows that all transformants contain cfoL-CDS sequences compared with wild aspergillus fumigatus. The Aspergillus fumigatus mutant introduced cfoL was able to grow normally on compound 1-containing or compound 1-containing crude extract plates (shown in FIG. 3) compared to wild-type Aspergillus fumigatus. The above results indicate that cfoL gene can confer resistance to compound 1 to aspergillus fumigatus strain, so cfoL gene in combination with chlorothalonil (1) can be used for genetic manipulation of fungi, wherein cfoL gene can be used as resistance tag when gene knockout or exogenous gene is introduced, and chlorothalonil can be used for screening of positive transformants.

In addition to the above-mentioned Aspergillus fumigatus sensitive to chlorosis, a person skilled in the art can obtain other microorganisms sensitive to chlorosis by conventional technical means, thereby performing genetic transformation using cfoL gene as a selection marker. For example, applicants have also found that chlorothalonil has an inhibitory effect on Candida albicans (Candida albicans) and sclerotium rolfsii (Sclerotium rolfsii sacc.), in particular:

1mg of Compound 1 (chlorothalonil) was dissolved in 100. Mu.L of DMSO to prepare a 10mg/mL solution. After thoroughly mixing, 50. Mu.L of the sample solution was pipetted into another centrifuge tube, followed by 50. Mu.L of DMSO to obtain a halved concentration of the sample solution. According to this method, 15 groups of sample solutions with sequentially halved concentrations were obtained. Under aseptic conditions, 95 μl of the bacterial suspension to be tested is sequentially added into a 96-well plate, 5 μl of diluted sample to be tested is sequentially added into the 96-well plate containing the bacterial suspension, and the final concentration of the compound to be tested is sequentially 500, 250, 125, 62.5, 31.25, 15.63, 7.81, 3.91, 1.95, 0.98, 0.49, 0.24, 0.12, 0.06 and 0.03 μg/mL. After gentle shaking and mixing, 96-well plates were sealed and incubated at 28℃for 72 hours. And measuring the absorbance value of each hole (or observing whether the solution in the hole is turbid or not at a bright place by naked eyes) at the wavelength of 600nm by using an enzyme-labeled instrument, wherein the Minimum Inhibitory Concentration (MIC) of the compound is the Minimum Inhibitory Concentration (MIC) of the compound, which can completely inhibit the growth of indicator bacteria in the hole. The above assays were performed in triplicate and the results of the assays are shown in the following table, with compound 1 exhibiting very strong inhibitory activity against Candida albicans (Candida albicans) and sclerotium rolfsii (Sclerotium rolfsii sacc.) with MIC of 0.12 μg/mL and 1.95 μg/mL, respectively.

Based on the above teachings, one skilled in the art can use cfoL genes and chlorothalonil to establish a genetic transformation system against a chlorothalonil-sensitive microorganism.

While the invention has been described in terms of preferred embodiments, it is not intended to limit the invention, but rather, it will be apparent to those skilled in the art that various changes and modifications can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

Claims

1. A resistance gene having an amino acid sequence that has at least 80% sequence identity compared to SEQ ID No. 2.

2. The resistance gene according to claim 1, wherein said resistance gene is derived from aspergillus candidus.

3. Use of a resistance gene according to claim 1 or 2 for combating or conferring resistance to chlorostyrosin in a microorganism sensitive to chlorostyrosin.

4. Use of a resistance gene according to claim 1 or 2 as an antibiotic resistance selection marker or selection tag; preferably, the antibiotic is chlorothalonil.

5. The use according to claim 4, wherein the selectable marker or selectable tag is placed in a vector/plasmid.

6. Use of a resistance gene according to claim 1 or 2 for the preparation of a genetically engineered strain resistant to or capable of tolerating chlorostyrosin.

7. A method of preparing a genetically engineered strain resistant to or resistant to chlorostyrosin, comprising the step of introducing a resistance gene according to claim 1 or 2 into a starting strain of said strain.

8. The method according to claim 7, wherein the starting strain of the genetically engineered strain is a strain sensitive to chlorothalonil.

9. The method of claim 7, wherein the introducing comprises the step of expressing the resistance gene in a starting strain.

10. A genetically engineered strain capable of being resistant to or tolerant to chlorosis, said genetically engineered strain being obtainable by the method of any one of claims 7-9.