CN117904203A - Preparation method of humanized Alzheimer's disease neural stem cell model - Google Patents

Abstract

The invention discloses a preparation method of a humanized Alzheimer's disease neural stem cell model, which comprises the following steps: constructing a recombinant adeno-associated virus vector containing an APP gene; and transfecting the humanized neural stem cells by using the recombinant adeno-associated virus vector, so as to construct a humanized Alzheimer's disease neural stem cell model. The invention also provides a recombinant adeno-associated virus vector and application of the recombinant adeno-associated virus vector in preparation of an Alzheimer's disease cell model. The invention uses human neural stem cells as a basis, is safe and efficient, has good self-replication capacity, can be stably amplified for a long time, can rapidly induce and differentiate into neuron cells, astrocyte cells and oligodendrocyte cells, and has no potential tumorigenicity.

Description

Preparation method of humanized Alzheimer's disease neural stem cell model

Technical Field

The invention belongs to the field of biological medicine, and in particular relates to a preparation method of a humanized Alzheimer's disease neural stem cell model.

Background

Alzheimer's Disease (AD) is a degenerative disease of the nervous system that severely affects the cognitive functions including decline, memory loss, thought disorder, language difficulties and behavioral changes, gradually losing the ability to self-care in daily life, ultimately leading to dementia. The pathogenesis of alzheimer's disease is very complex and is still under extensive research at present, mainly including abnormal deposition of beta amyloid plaques, abnormal fibrosis of Tau protein, imbalance of neurotransmitters, imbalance of inflammation and immune response, genetic factors and the like, wherein the research on beta amyloid plaques is most extensive.

APP (Amyloid Precursor Protein ) is a membrane protein, normally found in nerve cell membranes. The metabolic pathways of APP include two main pathways: non-amyloid metabolism and amyloid metabolism. Under non-amyloid metabolic pathways, APP will be normally metabolized to produce beneficial metabolites. However, under the amyloid metabolic pathway, APP is cleaved by enzymes β -secretase and γ -secretase, forming amyloid β (aβ) peptide, which is one of the main components constituting β -amyloid plaques.

The cell models currently used in the study of Alzheimer's disease are broadly divided into two types. One is an alzheimer's disease neuronal cell model based on murine neuronal cells, which, although widely used, has three drawbacks: (1) The model uses neuronal cells which do not themselves have proliferation capacity, making the model cells "consumable"; (2) The model simply expands the research on neuron cells, but ignores other types of brain cells such as astrocytes and microglial cells, and the cells play an important role in pathogenesis of Alzheimer disease; (3) In the genetic research of specific diseases, cells of murine origin are still in great gap with human cells as a research platform. The other AD cell model is constructed based on SH-SY5Y neuroblastoma cells, and compared with the mouse cell model, the SH-SY5Y cell model has good self-expansion capacity, effectively solves the problem that a neuron cell model cannot be self-expanded, and simultaneously shows the characteristics similar to those of the neuron cells, but the model also has the defects: SH-SY5Y cells are essentially malignant neuroblast tumors, have large differences from normal neuronal cells or neuronal cells affected by Alzheimer's disease alone, and are not the first choice cells for the study of Alzheimer's disease.

Disclosure of Invention

The invention aims at solving the technical problems and provides a safe preparation method of a humanized Alzheimer's disease neural stem cell model which is more suitable for the research of Alzheimer's disease.

In order to achieve the above object, the present invention provides a method for preparing a humanized neural stem cell model for Alzheimer's disease, comprising the following steps:

(1) Constructing a recombinant adeno-associated virus vector containing an APP gene;

(2) And transfecting the humanized neural stem cells by using the recombinant adeno-associated virus vector, so as to construct a humanized Alzheimer's disease neural stem cell model.

Preferably, said step (1) comprises PCR amplification of APP gene, packaging and purification of recombinant adeno-associated viral vector.

Preferably, the PCR amplification primer sequence of the APP gene is shown as SEQ ID NO:2 and SEQ ID NO: 3.

In another aspect, the invention also provides a recombinant adeno-associated virus vector comprising an APP gene.

On the other hand, the invention also provides application of the recombinant adeno-associated virus vector containing the APP gene in preparation of the Alzheimer's disease neural stem cell model.

On the other hand, the invention also provides a humanized Alzheimer's disease neural stem cell model obtained by the method.

On the other hand, the invention also provides application of the humanized Alzheimer's disease neural stem cell model in preparation of a reagent for screening Alzheimer's disease medicines.

Compared with the prior art, in the preparation method of the humanized Alzheimer's disease neural stem cell model, the nerve stem cells after infection can highly express APP and can cause abnormal accumulation of beta-amyloid, so that the generation process of Alzheimer's disease is simulated at a molecular level, an AD cell model based on the nerve stem cells is constructed, and a clinical research platform is provided for disease research. Meanwhile, compared with the traditional Alzheimer's disease cell model, the method has obvious technical advantages:

(1) The model uses human neural stem cells as a basis, so that species differences among mice are avoided, and experimental research data have more clinical values.

(2) The model cells have good self-replication capacity, can be stably amplified for a long time, and have no obvious inhibition on cell proliferation capacity, so that the defect that the Alzheimer disease cell model based on neuron cells cannot proliferate by itself is overcome.

(3) The cell model can stably maintain the characteristics of the neural stem cells, and simultaneously can rapidly induce and differentiate into neuron cells, astrocytes and oligodendrocytes, thereby providing a stable and single cell background for the research of Alzheimer's disease. Given that Alzheimer's disease is a disease involving multiple nervous system cells, this cell model provides a clear, single upstream progenitor cell for multi-cell angle studies of Alzheimer's disease pathogenesis and signaling pathways. In addition, the cell model can also be used for researching single cells by adopting techniques such as directional induction differentiation, flow separation and the like to clearly classify differentiated cells.

(4) The neural stem cell used in the invention is a normal cell, thereby avoiding the potential oncogene interference of SH-SY5Y malignant neuroblast tumor cells.

(5) AAV (adeno-associated virus) does not integrate the gene of interest into the genome of the host cell, thereby avoiding potential tumorigenicity, resulting in altered biological properties, and maintaining normal biological properties of neural stem cells.

Drawings

FIG. 1 shows a map of plasmid pAAV-hSyn-EGFP carrying the gene of interest.

FIG. 2 shows the result of agarose gel electrophoresis of the PCR products.

FIG. 3 shows comparison of the results of gene overexpression mediated by human neural stem cells infected with liposomes and different viruses.

FIG. 4 shows that AAV 1-APP-infected human neural stem cells are capable of inducing hNSC differentiation by FBS.

FIG. 5 shows the expression levels of AAV-APP infected hNSC and neuronal, astrocyte APP induced by cells after infection.

FIG. 6 shows the proliferative capacity of hNSC after AAV-APP infection.

Detailed Description

In order to more clearly illustrate the present invention, the present invention will be further described with reference to preferred embodiments and the accompanying drawings. It should be understood that the following examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

In the following examples, the cell culture conditions were 37℃and 5% CO ₂ and saturated humidity unless otherwise specified.

The reagents and cells used in the examples of the present invention were as follows: DMEM/F12 medium, EGF, bFGF, B, fetal Bovine Serum (FBS) and penicillin/streptomycin were purchased from gibco company. When in use, the DMEM/F12 neural stem cell culture medium is prepared according to bFGF 20ng/mL, EGF 20ng/mL and B27 2mL/100 mL; FBS and penicillin/streptomycin were added to DMEM medium to give final volume fractions of 10% and 1% for FBS and penicillin/streptomycin, respectively.

Lipo293DNA transfection reagents were purchased from bi yun.

The hNSC (human neural Stem cell) used in the invention is stably passaged based on an immortalized human neural stem cell line obtained by Chinese patent ZL201910653817.1, and the hNSC which is transferred to 17 generations in the following experiment is used as an experimental cell.

1. Constructing a plasmid:

(1) Obtaining a target gene: GFP-carrying plasmid pAAV-hSyn-EGFP (5265 bp) was derived from Addgene. The plasmid pAAV-hSyn-EGFP is shown in FIG. 1. Using the 5 'cloning primers (EcoRI cleavage site) PAAV-Hu-APP-F and 3' cloning primer PAAV-Hu-APP-R (HindIII cleavage site) shown in Table 1, the flag tag GATTACAAGGACGACGATGACAAG (SEQ ID NO: 1) was used to call the gene sequence of APP containing the cleavage site from cDNA of the C57 mouse brain cortex tissue specimen by PCR.

TABLE 1

Cloning primers	Nucleotide sequence
		PAAV-Hu-APP-F	CGGAATTCGCCACCatgctgcccggtttggcactg(SEQ ID NO：2)
PAAV-Hu-APP-R	CGAAGCTTgttctgcatctgctcaaagaac(SEQ ID NO：3)

The PCR system (50. Mu.L) is shown in Table 2.

TABLE 2

The amplification procedure is shown in Table 3.

TABLE 3 Table 3

PCR products agarose gel electrophoresis: 2% agarose gel: 2g of agarose, 100ml of TAE, 10. Mu.l of nucleic acid dye, and melting by heating in a microwave oven for 2.5min. Transferring into gel plate, and inserting comb. Waiting for solidification. The result of electrophoresis is shown in FIG. 2. FIG. 2 shows that the APP gene sequence was successfully amplified.

(2) And (3) gel recovery and purification of DNA: the DNA was purified using a gel recovery kit.

(3) And (3) enzyme cutting and connecting:

The cleavage system is shown in Table 4.

TABLE 4 Table 4

Component (A)	Volume (mu L)
		Purified DNA	1ug
EcoRI	1μL
		HindIII	1μL
10x Cutsmart buffer	5μL
		H2O	To 50 mu L

(4) And (3) gel recovery and purification of DNA: and (3) purifying the vector DNA and the target gene after enzyme digestion by using a gel recovery kit.

(5) And (3) connection: the purified vector fragment and the target gene fragment were ligated using T4DNA ligase.

Acquisition of AAV virus (adeno-associated Virus)

(1) 293T cells with confluence above 90% were grown according to 1:3 proportion passage (10 cm cell culture dish), the culture medium is Gibco high sugar DMEM medium (containing 10% FBS);

(2) The transfection system was formulated according to the following ratio:

(3) Mix 1 and Mix 2 after mixing separately, mix 1 and Mix 2 reverse Mix, stand for 15min at room temperature, add to 10cm Petri dish dropwise;

(4) 24h after plasmid transfection, a new DMEM medium containing 10% fbs was replaced;

(5) After 72h of transfection, the cells were collected together with the medium into 50ml centrifuge tubes, centrifuged at 1,000g for 10 min at 4℃and the culture supernatant and cell pellet were harvested separately.

(6) Cell supernatant virus collection: after the supernatant was filtered through a 0.45 μm filter, the virus in the culture supernatant was precipitated by adding 5x PEG8000℃overnight; the next day 2818g was centrifuged at 4℃for 15min, the pellet was resuspended in 10mL PBS+0.001%pluronic F68+200mM NaCl solution and placed at 4 ℃;

(7) Cell pellet virus collection: cells were resuspended using PBS+0.001%pluronic F68+200mM NaCl solution and lysed by repeated freeze thawing (15 minutes each at 37℃in liquid nitrogen, 4 cycles). After completion of cell lysis, 3220g of the cells were centrifuged at 4℃for 15min, and the centrifuged supernatant was transferred to the cell supernatant virus collected in step 6;

(8) Adding nuclease into the virus collection liquid according to the proportion of 50U/mL, and standing at 37 ℃ for 45min to degrade any residual DNA carried in the packaging process;

(9) The virus suspension was transferred to a centrifuge tube and centrifuged at 2415g for 10 minutes at 4 ℃;

purification of AAV viruses

(1) The following solutions were prepared

1) 1M NaCl/PBS solution: 5.84g NaCl, 26.3mg MgCl and 14.91mg KCl were dissolved in 1 XPBS;

2) 1 XPBS-MK solution: 26.3mg MgCl and 14.91mg KCl were dissolved in 1 XPBS;

3) 0.001% Pluronic-F68: mu.L of 100 XPrinic F-68 was added to 49.95mL of PBS and stored at 4℃for no more than one month.

(2) Preparation of iodixanol gradient:

1) 15% iodixanol: 4.5mL of 60% iodic Sha Fen and 13.5mL of 1M NaCl/PBS-MK buffer were mixed;

2) 25% iodixanol: 5mL of 60% iodized Sha Fen and 7mL of 1 XPBS-MK buffer and 30. Mu.L of phenol red were mixed;

3) Iodixanol 40%: 6.7mL of 60% iodic Sha Fen and 3.3mL of 1 XPBS-MK buffer were mixed;

4) 60% iodixanol: 10mL of 60% iodixanol and 45. Mu.L of phenol red were mixed;

(3) Each solution was capped into QuickSeal tubes using a 10mL syringe and 18g needle in the following order, taking care to avoid air bubbles:

1.5mL of 60% iodixanol → 2.5mL of 40% iodixanol → 3.6mL of 25% iodixanol → 4.8mL of 15% iodixanol solution;

(4) Adding virus into the upper layer of iodixanol, and filling the residual space with 1 XPBS;

(5) Sealing the rapid sealing tube;

(6) 350000g, held in a T70i rotor at 10℃for 90 minutes;

(7) Puncturing QuickSeal the tube at the bottom and top with a needle, discarding the liquid of the 60% iodixanol layer;

(8) Obtaining purified AAV viral particles from the 40% phase layer using a sterile centrifuge tube;

(9) The collected AAV viruses were concentrated using Millipore 100kd 50ml ultrafiltration centrifuge tubes;

the concentrated virus was stored at 4℃for a short period (2 weeks) or in aliquots and at-80℃for a long period.

4. Liposome-carried GFP-transfected hNSC

(1) One day prior to transfection, 5x 10 ⁵ hscs were sown in each well of the 24 well plates;

(2) The next day, cells were transfected;

(3) For each well, GFP plasmid and Lipo transfection reagent were added as follows;

1) 100pmole GFP was added to 98. Mu.L of serum-free medium and mixed well with a shaker;

2) Before using the Lipo2000, firstly mixing uniformly, then adding 2 mu L of Lipofectamine2000 into 98 mu L of serum-free culture medium, mixing uniformly upside down or flicking an EP tube, and standing for 5min at room temperature;

3) Uniformly mixing GFP and Lipo2000 diluent according to a ratio of 1:1, and standing at room temperature for 20min;

(4) Adding the mixture into corresponding cell culture holes, and shaking the culture plate left and right to mix the liquid uniformly;

(5) Placing the cells in a cell incubator for culturing for 8 hours;

(6) The mixture is centrifuged at 800rpm/min for 5min, the supernatant is sucked off and changed into a neural stem cell culture medium, and the neural stem cell culture medium is placed in a cell culture box for culturing for about 48h.

5. Construction of GFP-carrying lentiviral vector (Lentivirus-GFP)

(1) 293T cells were resuscitated one week in advance and passaged more than 3 times using 10% FBS-DMEM medium.

The 293T cells with good growth state are digested with 0.25% pancreatin one day before transfection to obtain cell suspension, counted, then lentiviral plasmid transfection is carried out, and dilution is carried out to 10/mL; 293T was seeded into 6-well plates (2 mL per well) to a density of 40%. Transfection was performed after it grew to 80-90% of the area of the well plate.

(2) Endotoxin-free plasmids were obtained by plasmid large extraction.

(3) 150. Mu.L of DMEM medium and 15. Mu.L of lipofectamine 2000 were added to each of the 1.5mLEP tubes.

(4) Mu.L of DMEM medium, 7. Mu.g of GFP-DNA, 5.25. Mu.g of psPAX2, 1.75. Mu.g of pCMV-VSVG (to give a mass ratio of the three plasmids of 4:3:1) were each added to a 1.5mL EP tube.

(5) An equal volume of plasmid mixture was added to the transfection reagent mixture and allowed to stand at room temperature for 5min.

(6) The medium in the overnight 6-well plate was carefully aspirated and replaced with fresh DMEM complete medium. mu.L of DNA-lipo 2000 complex was added to each well.

(7) The virus supernatant was collected from six well plates 24h and 48h after transfection, and cell debris was removed by filtration or centrifugation through a 0.45 μm filter (stored at 4℃for a short period and stored in a-80℃refrigerator for a long period without repeated freeze thawing).

Example 1

The AAV virus containing APP gene is obtained and purified as described above.

After obtaining purified AAV1 virus containing APP gene, AAV1 virus of 1X10 ¹⁰ vg/mL was added to hNSC and cultured under conventional cell culture conditions (37 ℃, 5% CO ₂, saturated humidity) for 48 hours by virus titer assay. After the completion of the culture, cells were observed by fluorescence microscopy for the presence of GFP ⁺, and the test was performed by comparing the infection of hNSC with GFP-carrying lentiviruses (Lentivirus-GFP) and AAV1 serotypes (AAV 1-GFP), respectively. The proportion of GFP ⁺ cells detected by flow cytometry was quantitatively compared. The results are shown in FIG. 3.

Example 2

Liposome-mediated mRNA overexpression is a novel in vitro and in vivo gene editing technology in recent years, GFP mRNA is transduced into hNSC by using RNA transfection reagent, and the cells are cultured for 24 hours under conventional cell culture conditions (37 ℃ C., 5% CO ₂ and saturated humidity), and the proportion of GFP ⁺ in the cells is observed by using a fluorescence microscope after 24 hours. The results are shown in FIG. 3. FIG. 3 shows that liposome-transduced mRNA-mediated gene overexpression (Lipo 2000) was less efficient in hNSC.

Example 3

As a gene editing technique, it is essential to mediate gene expression safely and efficiently. AAV1 virus containing APP gene at 1X10 ¹⁰ vg/mL was added to hNSC and cultured under conventional cell culture conditions (37 ℃, 5% CO ₂, saturation humidity) for 24 hours. After the completion of the culture, after the cells were digested, cell samples were collected and the AAV 1-mediated APP gene expression efficiency was examined by flow cytometry. The results are shown in FIG. 3. The result shows that the overexpression of APP gene can be safely and efficiently realized in hNSC through AAV1 virus infection, and in addition, the efficiency of AAV1 infection of human neural stem cells is obviously higher than that of the current common gene editing means (lentivirus and liposome).

Example 4

AAV1-APP (AAV 1 virus comprising the APP gene) infected hNSC differentiation was induced using DMEM containing 10% FBS. The differentiation capacity of AAV1-APP infected hNSC was verified by RT-qPCR and immunofluorescence detection of Map2 and Gfap expression. The results are shown in FIG. 4, where the abscissa is the number of days. FIG. 4 shows that AAV 1-APP-infected human neural stem cells are capable of inducing hNSC differentiation by FBS.

Example 5

The differentiated neurons and glial cells were sorted by flow cytometry, and the expression level of APP after differentiation of hNSC cells overexpressing APP was detected by WB, and the results are shown in fig. 5. FIG. 5 shows the expression levels of AAV 1-APP-infected hNSC (hNSC-APP) and of neurons and astrocytes APP induced to differentiate by the infected cells, wherein Dif-NC-APP and Dif-AC-APP bands are the over-expressed protein bands of APP after differentiation of neural stem cells into neurons and astrocytes, respectively, and it is seen that APP is expressed, that hNSC over-expressed APP has the ability to differentiate into neurons and astrocytes, that human neural stem cells can still induce differentiation by serum after infection of APP, and that the expression levels of neurons and astrocytes APP after differentiation remain significantly up-regulated.

Example 6

The absorbance at OD _450nm was measured by CCK8 analysis of the proliferative capacity of hNSC. The results are shown in FIG. 6. The result shows that the human neural stem cells can still self replicate and stably up-regulate the expression level of APP after APP infection, and the APP over-expression has a certain influence on the proliferation capacity of hNSC, but the influence amplitude is smaller.

Claims (7)

1. A method for preparing a humanized Alzheimer's disease neural stem cell model, which comprises the following steps:

(1) Constructing a recombinant adeno-associated virus vector containing an APP gene;

(2) And transfecting the humanized neural stem cells by using the recombinant adeno-associated virus vector, so as to construct a humanized Alzheimer's disease neural stem cell model.

2. The method according to claim 1, characterized in that: the step (1) comprises PCR amplification of APP genes, packaging and purification of recombinant adeno-associated virus vectors.

3. The method according to claim 2, characterized in that: the PCR amplification primer sequence of the APP gene is shown as SEQ ID NO:2 and SEQ ID NO: 3.

4. A recombinant adeno-associated viral vector comprising an APP gene.

5. Application of recombinant adeno-associated virus vector containing APP gene in preparation of Alzheimer's disease neural stem cell model.

6. A human-derived alzheimer's disease neural stem cell model obtained according to the method of any one of claims 1 to 3.

7. Use of the humanized alzheimer's disease neural stem cell model according to claim 6 in the preparation of a reagent for screening alzheimer's disease drugs.