CN110951785A

CN110951785A - Method for introducing CRISPR-Cas9 system into human stem cells

Info

Publication number: CN110951785A
Application number: CN201911391005.0A
Authority: CN
Inventors: 姜舒; 张芸; 熊斌
Original assignee: Shenzhen Sanzhi Medical Technology Co ltd
Current assignee: Shenzhen Sanzhi Medical Technology Co ltd
Priority date: 2019-12-30
Filing date: 2019-12-30
Publication date: 2020-04-03

Abstract

The invention relates to a method for efficiently introducing a CRISPR-Cas9 gene editing system into human stem cells, which comprises the following steps: (1) constructing and obtaining HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid; (2) introducing the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid into a human stem cell by adopting a Neon system; the conditions for electroporation transfection are: when the human stem cell is a human mesenchymal stem cell: the pulse voltage is 1300-1700V, the pulse time interval is less than 30ms, and the pulse frequency is at least once; when the human stem cells are human hematopoietic stem cells: 1450 and 1550V of pulse voltage, 40ms of pulse width and at least one pulse number; (3) and (5) culturing the cells. The invention utilizes an electroporation method to transfer the CRIPSR-Cas9 gene editing system into the stem cells, and can effectively improve the survival rate of the stem cells after electroporation transfection.

Description

Method for introducing CRISPR-Cas9 system into human stem cells

Technical Field

The invention relates to a gene editing technology, in particular to a method for introducing a CRISPR-Cas9 gene editing system into human stem cells.

Background

Stem cells are important raw materials in the field of modern biomedical technology research and are also important target cells in the field of gene therapy at present. In the gene therapy using stem cells as target cells, the differentiation characteristics and cell activities of the stem cells need to be maintained while transferring the gene editing system into the stem cells, and thus the challenge is far higher than the transfection of other cells. At present, the gene modification of stem cells by using a high-efficiency CRISPR-Cas9 gene editing system is an important means of gene therapy, exogenous genes are transferred into lineage-specific stem cells and can be integrated into chromosomes or used as additional genes to maintain high-level and lasting expression along with cell division, and the key point of successful gene editing is.

Based on various research reports at present, the electroporation transfection method is the most efficient gene transfer means for stem cells except viral vectors and liposomes, and the principle is that under the action of an electric field, pores or openings are formed on cell membranes, plasmids can contact the cell membranes under the action of electric field force generated by electric shock and form transferable complexes with electroporation areas on the cell membranes, then the plasmids are separated from the complexes and spread to cytoplasm, and part of the plasmids are transferred into nucleus and integrated with chromosome. The electroporation transfection method is a simple gene transfer method, and has incomparable advantages compared with other methods, such as simple and rapid operation, strong repeatability, high transfection efficiency, wide application range of cell types and the like.

In view of the clinical transformation application of gene therapy by transferring a CRISPR-Cas gene editing system into a stem cell, the electroporation transfection method has better safety and higher transfection efficiency for the gene transfer of the stem cell, and is the best choice in the existing transfection method, however, the electric field action can directly damage the cell, so that the important problem to be solved is how to improve the survival rate of the stem cell after electroporation transfection.

Disclosure of Invention

The technical problem to be solved by the invention is as follows: the method for introducing the CRISPR-Cas9 gene editing system into the human stem cells by adopting the electroporation transfection method is provided, and the survival rate of the stem cells after electroporation transfection can be improved.

In order to solve the technical problems, the invention adopts the technical scheme that:

a method for introducing a CRISPR-Cas9 gene editing system into a human stem cell, comprising the steps of:

(1) chemically synthesizing a CRISPR-Cas9 expression frame and connecting a GFP expression gene to construct and obtain a Cas9-T2A-GFP-SZ skeleton plasmid; aiming at an HBB gene, designing a targeted HBB-sgRNA, wherein the nucleotide sequence of the HBB-sgRNA is shown in SEQ ID No. 1; then connecting the HBB-sgRNA with the Cas-T2A-GFP-SZ skeleton plasmid to obtain an HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid;

(2) introducing the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid into a human stem cell by using a Neon system and an electroporation transfection method; the conditions for electroporation transfection are: when the human stem cells are human mesenchymal stem cells, the electroporation transfection conditions are as follows: the pulse voltage is 1300-1700V, the pulse time interval is less than 30ms, and the pulse frequency is at least once; when the human stem cells are human hematopoietic stem cells, the electroporation transfection conditions are: 1450 and 1550V of pulse voltage, 40ms of pulse width and at least one pulse number;

(3) and (4) performing cell culture on the sample after the electroporation is completed.

The invention has the beneficial effects that:

(1) the invention adopts a Neon transfection system, which is the latest generation of electrotransfection system at present and is different from the traditional standard electroporation chamber based on a test tube, and the Neon transfection system uses a biocompatible pipette gun head chamber to generate a more uniform electric field, thereby being more beneficial to maintaining physiological conditions; the Neon transfection system is applied to the introduction of the CRISPR-Cas9 gene editing system into the human stem cell, and on the basis, the factor with the largest influence on the efficiency of the electroporation transfection of the human stem cell, namely the electroporation parameter, is innovatively designed, so that the cell survival rate far exceeding that of the traditional electroporation technology can be realized, and the cell transfection efficiency is greatly improved;

(2) the method for transfecting the human stem cells by electroporation has no carrier capacity limitation, solves the problem of small capacity of a virus carrier system, and can efficiently introduce the exogenous genes within 20kb into the stem cells. Research shows that genes with the length of more than 20kb can also be introduced by means of electroporation, and only the transfection efficiency fluctuates;

(3) the invention directly conveys genes into cells, avoids risks such as adverse immune reaction and toxic effect generated by virus vectors and chemical transfection methods and genetic defects caused by virus genome integration, and has high safety, simple operation and easy repetition;

(4) the invention transfers the exogenous gene to the human stem cell by utilizing the electroporation transfection technology, the time required for effectively transfecting the cell is short, the expression time of the exogenous gene is relatively short, the high-efficiency expression of the target gene can be observed after 24 hours after transfection, and the expression of the target gene can be observed only after 72 hours by utilizing a virus vector system. This greatly reduces the time for in vitro culture of stem cells for subsequent clinical transformation applications.

Drawings

FIG. 1 is a composition diagram of HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid in the method for efficiently introducing a CRISPR-Cas9 gene editing system into a human stem cell according to the first embodiment of the invention;

FIG. 2 is a schematic diagram of the acquisition of a target plasmid HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid in the method for efficiently introducing the CRISPR-Cas9 gene editing system into a human stem cell according to the first embodiment of the invention;

FIG. 3 is a fluorescent chart of Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ transfected into HEK293T cells respectively in the method for efficiently introducing the CRISPR-Cas9 gene editing system into human stem cells according to the first embodiment of the invention;

fig. 4 is an electrophoresis chart obtained when the insertion/deletion efficiency is detected by the T7endonuclease i enzymatic cleavage method in the method for efficiently introducing the CRISPR-Cas9 gene editing system into a human stem cell according to the first embodiment of the present invention;

FIG. 5 is a fluorescence image of plasmids corresponding to numbers 1-2 in Table 3 and using tips of different capacities in a method for efficiently introducing a CRISPR-Cas9 gene editing system into a human stem cell according to a first embodiment of the present invention after electroporation transfection;

FIG. 6 is a fluorescence image of the method for efficiently introducing the CRISPR-Cas9 gene editing system into human stem cells according to the first embodiment of the present invention, wherein the method corresponds to the method of using plasmids with different masses (concentrations and purities) in Table 4, after electroporation transfection;

fig. 7 is a diagram showing the fluorescence effect of the hMSC 24h after electrotransformation under different electrotransformation parameters corresponding to table 5 sequence numbers 1-24 in the method for efficiently introducing the CRISPR-Cas9 gene editing system into human stem cells in the first embodiment of the present invention;

fig. 8 is a diagram showing the fluorescence effect of the human mesenchymal stem cells after being electrically transformed for 24 hours under different electrical transformation parameters corresponding to numbers 1 to 12 in table 6 in the method for efficiently introducing the CRISPR-Cas9 gene editing system into the human stem cells according to the first embodiment of the present invention;

fig. 9 is a fluorescent diagram of the hMSC transfected by electroporation under different electrotransfer parameters corresponding to sequence numbers 1-6 in table 7 in the method for efficiently introducing the CRISPR-Cas9 gene editing system into human stem cells according to the first embodiment of the present invention;

FIG. 10 is a fluorescent chart obtained after the introduction of Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ into hMSC by electroporation transfection respectively in the method for efficiently introducing the CRISPR-Cas9 gene editing system into human stem cells according to the first embodiment of the present invention;

fig. 11 is an electrophoresis diagram obtained when the T7endonuclease i enzymatic cleavage method verifies the editing effect of sgRNA on the hMSC cell genomic DNA in the method for efficiently introducing the CRISPR-Cas9 gene editing system into a human stem cell according to the first embodiment of the present invention;

FIG. 12 is a fluorescent chart of Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ after UB-HSC are introduced by electroporation transfection in the method for efficiently introducing CRISPR-Cas9 gene editing system into human stem cells according to example two of the present invention;

FIG. 13 is an electrophoretogram obtained when the T7endonuclease I enzymatic cleavage method verifies the editing effect of sgRNA on UB-HSC cell genomic DNA in the method for efficiently introducing the CRISPR-Cas9 gene editing system into a human stem cell in example two of the present invention.

Detailed Description

In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments.

The most key concept of the invention is as follows: by adopting a Neon system, experiments show that the electrotransformation parameters are the factors which have the greatest influence on the efficiency of transfecting the human stem cells by electroporation, and the electrotransformation parameters are innovatively designed.

Referring to fig. 1 to 13, the method for introducing the CRISPR-Cas9 gene editing system into human stem cells provided by the invention comprises the following steps:

Compared with virus integration systems and liposomes such as adenovirus, adeno-associated virus and retrovirus, the invention has the following advantages that the CRIPSR-Cas9 gene editing system is transferred into stem cells by using an electroporation method:

(1) the invention adopts a Neon transfection system, which is the latest generation of electrotransfection system at present and is different from the traditional standard electroporation chamber based on a test tube, and the Neon transfection system uses a biocompatible pipette gun head chamber to generate a more uniform electric field, thereby being more beneficial to maintaining physiological conditions; the Neon transfection system is applied to the introduction of the CRISPR-Cas9 gene editing system into the human stem cell, and on the basis, the innovative design is carried out on the electrotransformation parameter which is the factor with the greatest influence on the efficiency of the electroporation transfection of the human stem cell, so that the cell survival rate far exceeding that of the traditional electroporation technology can be realized, and the cell transfection efficiency is greatly improved;

Further, in step (2), the human stem cells are mesenchymal stem cells, and the electroporation transfection conditions are as follows: the pulse voltage is in the range of 1300V to 1400V. Preferably, the electroporation transfection conditions are: the pulse voltage is 1325V, the pulse time interval is 20ms, and the pulse times are 2 times.

Further, in the step (2), electroporation transfection operation is performed by using a Tip of Tip with a size of 10 μ L.

Further, in the step (2), the A260/280 ratio of the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid is not lower than 1.64, and the concentration is not lower than 508 ng/. mu.L. Preferably, in the step (2), the A260/280 ratio of the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid is not less than 1.8, and the concentration is not less than 1 mu g/mu L.

Further, a step of verifying the gene editing effect of the HBB-sgRNA-Cas9-T2A-GFP-SZ is also included between the step (1) and the step (2).

Further, in step (2), the human stem cells are hematopoietic stem cells, and the conditions for electroporation transfection are as follows: the pulse voltage is 1500V, the pulse width is 40ms, and the number of pulses is 1. Preferably, in the step (2), the A260/280 ratio of the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid is not less than 1.8, and the concentration is not less than 1 mu g/mu L.

Referring to fig. 1-13, the embodiments of the present invention are as follows:

example 1

The invention patent is described in detail by using a CRISPR-Cas9 gene editing system introduced into human umbilical cord-derived mesenchymal stem cells (hMSCs) as a specific example.

1. Construction of HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid carrying Gene editing

1.1, modifying an EF1 promoter to drive Cas9 so as to reduce the size of an introduced gene fragment, chemically synthesizing a CRISPR-Cas9 expression frame and connecting a GFP expression gene to construct a Cas9-T2A-GFP-SZ skeleton plasmid; meanwhile, aiming at hemophilia B human hemoglobin gene (HBB, human haemoglobin beta), highly targeted HBB-sgRNA is designed and connected with a Cas-T2A-GFP-SZ plasmid to form a recombinant plasmid HBB-sgRNA-Cas9-T2A-GFP-SZ (figure 1-2).

The following is a partial HBB-sgRNA vector DNA sequence (wherein the gRNA sequence of the HBB gene, i.e. the underlined sequence, i.e. SEQ ID No. 1: TGGTATCAAGGTTACAAGAC):

TATGGGGATATTTGACTGTAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTGGTATCAAGGTTACAAGACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTGTGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTATTTATTATTAAATTATTTTGTGCAGCCATGGGGAGCTGTGATAAGCAAGGGGGGCCCCTCCCCCTAATATGACATATCAGTCACCAATTGAGTGTATGTGGGTTACAAAAATAAACCGCCTATCCAAGGCAGGGATGTAGGGGTGGGGAAAGAATGTGAATAGACTAGGACAGCGTGTACAGTATTATTCACGATTATAGATACCCCCATGGGGTTTGGGGAGTGCGTCTGTCTGTTGGCTCCCGTATCGGGAGGGGGAGAACACAGTTGAGAAAATAGACGAAGAAGCAGAAGAGGAGAGAAATAGATGGTACATGAATCTGTAGTGATGGCGTTGAAGCGTTCAGATGAGTGTGAGTGTATCTCGTTATATGATATATAGTATGATACTGATGGAAAACACGGAAGCAGATGCGTATGCTGAGTCGACGGTAAGAGGTAATGCGAAGTGAAGGATCTAAGGAAATCGTGCATGTGAGTTTTTGGGCCGACGATC(SEQ ID No.2)。

1.2 verification of Gene editing Effect of HBB-sgRNA-Cas9-T2A-GFP-SZ

1) HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid is transfected into HEK293T cells by a liposome transfection method (figure 3), the cells are harvested by centrifugation at 400g for 5 minutes at room temperature after 48 hours, and the cell samples are stored at-20 ℃ after the supernatant is sucked off.

2) And extracting the transfected HEK293 cell genome DNA by using a genome DNA extraction kit.

3) Specific primers of HBB target sequences are designed, and target fragments of HBB are obtained by PCR amplification.

The HBB primer sequences were as follows:

a forward primer: 5'-CCTGAGGAGAAGTCTGCCGTTAC-3', (SEQ ID No. 3);

reverse primer: 5'-TTGAGGTTGTCCAGGTGAGCC-3', (SEQ ID No. 4).

The PCR amplification procedure for HBB gene target fragment is as follows in Table 1:

TABLE 1

4) The PCR product was electrophoresed on 1.5% agarose gel; the gel electrophoresis product is then recovered with a gel recovery kit.

5) The T7endonuclease I enzyme cleavage method is used for detecting the editing effect of HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid (figure 4). 200ng of the product was recovered, 2. mu.l of NEB Buffer2 was added, the mixture was made up to 19. mu.l by adding water, and the reaction was incubated in a PCR apparatus according to the procedure shown in Table 2 below:

TABLE 2

Temperature of	Rate of change of temperature	Time of day
			95℃	-	5 minutes
95℃-85℃	-2℃/s
			85℃-25℃	-0.1℃/s
4℃	-	+∞

Mu.l of T7endonuclease I was added to the incubated reaction solution, and incubated at 37 ℃ for 30 minutes.

6) The cleavage products were electrophoresed in 2% agarose gel.

In FIGS. 1 to 4 of the present invention, FIGS. 1 to 4 are experimental diagrams for verifying the gene editing effect of HBB-sgRNA-Cas9-T2A-GFP-SZ introduced into HEK293T cells. FIG. 1 shows the composition of the HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid. FIG. 2 shows that the plasmid containing CRISPR-Cas9 expression frame is cut and linearized by Bbs I and then connected with HBB sgRNA which is designed and synthesized, and the target plasmid HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid can be obtained. FIG. 3 shows the transfection of Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ separately in HEK293T cells. FIG. 4 shows the insertion/deletion efficiency of T7endonuclease I by enzymatic cleavage. The T7endonuclease I enzyme digestion method is used for verifying the editing of the constructed HBB-sgRNA-Cas9-T2A-GFP-SZ plasmid on cell genome, and the result of gel electrophoresis of the enzyme digestion product shows that the HBB-sgRNA-Cas9-T2A-GFP-SZ can generate obvious gene editing effect on cell genome DNA.

2. Introduction of HBB-sgRNA-Cas9-T2A-GFP plasmid into hMSCs by electroporation transfection

2.1 culture of human mesenchymal Stem cells (hMSC)

The hMSC used in the scheme is separated from human umbilical cord Wharton's jelly tissue, is an adult stem cell, has self-renewal and proliferation and differentiation capacities, and can be directionally differentiated into cells of various tissues under specific conditions. The following experiments all used P3-P4 generation hMSCs derived from the same individual and in a stable good state.

Taking out the frozen hMSC, placing the hMSC in a water bath kettle at 42 ℃ for incubation until the frozen cells are dissolved, immediately transferring the thawed cells into a centrifugal tube containing a fresh cell culture medium, and centrifuging the cell culture medium at 800rpm at room temperature for 5 minutes; the supernatant was aspirated, fresh medium was added to resuspend the cells, and the cells were seeded into cell culture dishes for culture.

2.2 search for the best conditions for electrotransformation of hMSC by HBB-sgRNA-Cas9-T2A-GFP plasmid

2.2.1 cell preparation

Two days before electroporation transfection, transferring the cells into a culture dish filled with a fresh culture medium to ensure that the cell density reaches 70-90%; adding fresh cell culture medium (without antibiotics) in a volume of 500. mu.l per well into a 24-well plate before electrotransformation, and preheating in a 37 ℃ cell constant-temperature incubator; taking out the cultured cells, washing with 1 × PBS, sucking out PBS, adding pancreatin for digestion for 2 min, adding whole serum culture medium to terminate digestion and blow-off to form single cells, taking part of cell suspension, counting cells, and determining cell density; at a rate of 5X 10 per hole⁵Transferring the single cell suspension of the cells required by the electroporation to a 15ml centrifuge tube, centrifuging for 5 minutes at room temperature of 100-; 1 XPBS (Ca-free)²⁺And Mg²⁺) Resuspending the cells, and centrifuging at room temperature at 400g for 5 min; sucking out PBS, adding Buffer R to resuspend cells, and gently blowing to obtain a single cell suspension, wherein the cell suspension can be placed at room temperature for no more than 30 minutes, and the cell activity and the transfection efficiency are reduced.

2.2.2 electroporation transfection procedure

Adding 10 mu g of plasmid into a 1.5ml centrifuge tube, adding the cell suspension, and gently mixing; in Neon^TMAdding electrolytic buffer solution into the tube, and performing later electrotransfer by using 10 μ l electrotransfer tip^TMBuffer E was added to the tube, and if a 100. mu.l electroporation tip was used, Buffer E2, Neon was added to the tube^TMThe electrolytic buffer solution in the tube can be used for 10 times of electrotransformation; setting pulse voltage, pulse width and pulse number on the electrotransformation instrument; inserting the electric lance head into the Neon^TMOn a pipettor, the mixture of the cells and the plasmids is sucked later (no air bubbles are needed in the pipette heads when sucking), each pipette head can be used at most twice, and Neon is used^TMThe tubes are inserted into a pipettor rack. Then the Neon with the sample is added^TMVertical insertion of pipettor into Neon^TMIn the tube; selecting an electroporation program and pressing a Start key on a touch screen; after the touch screen displays that the electroporation is finished, transferring the pulsed sample to a prepared culture plate filled with a preheating culture medium, and putting the culture plate into an incubator for culture; after normal culture for 6h, the fresh culture medium can be replaced to remove upper dead cells; after 24h of culture, the cells are collected for cell transfection efficiency detection or cell experimental treatment.

2.2.3 optimal Condition exploration for electroporation transfection of human mesenchymal Stem cells

The transfection efficiency directly influences the copy number of the introduced exogenous gene, so that the establishment of the optimal condition for electroporation transfection improves the transfection efficiency, and is very critical for improving the editing efficiency of the CRISPR-Cas9 system on cell genome. In combination with the analysis of each literature report, factors known to affect electroporation transfection include: cell-self factors such as cell passage number, cell physiological state, cell density, etc.; the concentration, purity and transfection amount of the plasmid; the electric conversion parameters are pulse voltage, pulse time interval, pulse times and the like. Of ThermoFisher Scientific

The transfection system has been shown to be able to electroporate hMSCs with up to 50% efficiency under certain conditions, but was found during the experimentWhen the introduced gene fragment is increased and electrotransfer tips with different capacities are used, the electrotransfer parameters are not applicable (see the following table 3 and the result of fig. 5 in detail, the table 3 shows the influence of different electrotransfer tips on the efficiency of electroporation transfection of human mesenchymal stem cells), and in view of the fact that the number of cells required for gene therapy by transferring the CRISPR-Cas9 gene editing system into stem cells is large and the length of the introduced gene fragment is long, the optimization of the conditions of electroporation transfection is very important for ensuring efficient transfection of the stem cells. In the condition optimization of the invention, Cas9-T2A-GFP-SZ is taken as an electrotransformation plasmid.

1) First according to

The electrotransformation parameters provided by the transfection system, different electrotransfer tips are used for transfecting the human mesenchymal stem cells under the condition of keeping other parameters unchanged, the results show that the electrotransfer efficiency of the human mesenchymal stem cells is different by using the electrotransfer tips with different capacities, the same amount of plasmids are electrotransferred in the hMSC under the same electrotransfer parameters, the electrotransfer efficiency of 10 mu l of Tip tips can reach more than 40%, and the cells can not be successfully electrotransferred when 100 mu l of tips are used (table 3, figure 5).

TABLE 3

FIG. 5 is a graph showing the effect of using different capacities Tip on the electric power conversion efficiency corresponding to numbers 1-2 in Table 3.

2) The effect of plasmids with different purities on the efficiency of electroporation transfection of human mesenchymal stem cells, and the purity and concentration of the plasmids influence the electroporation efficiency under the condition of keeping other electroporation conditions consistent. As shown in table 4 and the results of fig. 6, table 4 shows the effect of plasmid quality on the efficiency of electroporation transfection of human mesenchymal stem cells. The higher the plasmid purity and concentration, the higher the electrotransformation efficiency under the same conditions (Table 4, FIG. 6).

TABLE 4

FIG. 6 shows the effect of using plasmids of different qualities (concentration and purity) on the electrotransformation efficiency, corresponding to the numbers 1-2 in Table 4. In FIG. 6, the left side 1 shows fluorescence images of plasmids with a plasmid concentration of 850 ng/. mu.l after electroporation transfection, and the right side 2 shows fluorescence images of plasmids with a plasmid concentration of 508 ng/. mu.l after electroporation transfection.

3) The experimental result shows that the electrotransformation parameters, namely pulse voltage, pulse time course and pulse frequency, are the factors which have the greatest influence on the efficiency of the electroporation transfection of the human mesenchymal stem cells. The permeability of the membrane is increased and pores are formed under the action of an electric field of cells in the electroporation transfection process, the death rate of the cells is increased when the electric field intensity (pulse voltage) is too high, and the permeability of the membrane cannot be increased or the pores are formed on the membrane when the electric field intensity is too low, so that the pulse voltage is a main parameter needing to be optimized. The pulse duration refers to the time it takes for the voltage to decay to the initial voltage 1/3, and in general, increasing the voltage should decrease the pulse duration, while decreasing the voltage should increase the pulse duration. For the number of pulses, most cell types are selected for a single time, and in some cases, multiple pulses are used, because the low voltage, short pulse time, and multiple pulses can effectively avoid cell damage.

① firstly 24 corresponding electrotransfer parameters are set according to the highest voltage and the lowest voltage which can be borne by the electrotransfer instrument (table 5, fig. 7, table 5 shows that the electroporation method introduces the plasmid into the human mesenchymal stem cells under different electrotransfer parameter conditions), and in the electrotransfer process, except the electrotransfer parameters, other conditions such as cell density, plasmid quantity and the like are kept consistent, after 24h of electroporation transfection, the best electric field intensity for introducing the Cas9-T2A-GFP-SZ plasmid into the hMSC is evaluated by recording the relative quantity of GFP positive cells.

TABLE 5

FIG. 7 is a graph showing the fluorescence effect of hMSC after 24h electrotransformation under different electrotransfer parameters corresponding to the numbers 1-24 in Table 5. The values of the electrical transfer parameters represented by reference numerals 1-24 (corresponding to the sequence from left to right in FIG. 7) are shown in Table 5. Among them, the fluorescence pictures of the cells after electrotransformation under 1300V and 1400V pulse voltages with the 15 serial numbers and the 16 serial numbers respectively show that the number of the positive cells is higher than that of GFP, namely, the efficiency of electrotransfection of Cas9-T2A-GFP-SZ plasmid into human mesenchymal stem cells is higher in the range of 1300V-1400V.

② according to the previous experimental results, it was suggested that the human mesenchymal stem cells were electroporated with Cas9-T2A-GFP-SZ by setting the pulse voltage in the range of 1300V-1475V and adjusting the pulse duration to set the electroporation parameters (Table 6, FIG. 8, Table 6 shows the effect of electroporation parameters on the efficiency of electroporation transfection of human mesenchymal stem cells). the experimental results showed that hMSC was completely dead when the pulse duration was increased to 30ms within the optimal pulse voltage range.

TABLE 6

Serial number	Pulse voltage	Time course of pulse	Number of pulses	Relative GFP-positive cell number
					1	1350	20	2	+++
2	1375	20	2	+++
					3	1400	20	2	++
4	1425	20	2	++++
					5	1450	20	2	+++
6	1475	20	2	+++
					7	1275	30	2	——
8	1300	30	2	——
					9	1325	30	2	——
10	1350	30	2	——
					11	1375	30	2	——
12	1400	30	2	——

FIG. 8 is a graph showing the fluorescence effect of the human mesenchymal stem cells after being electrotransformed for 24 hours under different electrotransformation parameters corresponding to the numbers 1 to 12 in Table 6. The electrical transfer parameters represented by reference numerals 1-6 (corresponding in order from left to right in fig. 8) are shown in table 6.

③ considering that the larger the pulse voltage, the more damage to the cells, the more suitable the pulse voltage was found by setting the pulse voltage to 1050V to 1400V to ensure the high electroporation efficiency and the good state of the cells (Table 7, FIG. 9, Table 7 show the effect of the electroporation parameters on the efficiency of electroporation transfection hMSC)

TABLE 7

Serial number	Pulse voltage	Time course of pulse	Number of pulses	Relative GFP-positive cell number
					1	1050	20	2	+++
2	1200	20	2	++++
					3	1325	20	2	++++
4	1350	20	2	++
					5	1375	20	2	++
6	1400	20	2	++

FIG. 9 is a fluorescence plot of electroporated hMSCs at different electroporation parameters corresponding to numbers 1-6 in Table 7 above. In which the values of the electrical transition parameters represented by 1-6 are shown in table 7.

3. Verifying the gene editing efficiency of the CRISPR-Cas9 gene editing system on hMSC

And (3) according to the optimal power conversion parameters: the pulse voltage is 1325V, the pulse time interval is 20ms, the pulse times are twice, plasmids Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ are introduced into the hMSC by an electroporation transfection method, and the gene editing efficiency of sgRNA on the hMSC is verified.

3.1 transfection of hMSCs

Table 8 below shows parameter information for transfection of human mesenchymal stem cells with optimized electroporation parameters.

TABLE 8

3.2 culturing the cells after the electricity conversion for 48h to collect the cells, sucking the cell culture medium, adding PBS to wash the cells once, adding pancreatin to digest the cells, and stopping digestion by using a DMEM cell culture medium containing 10% FBS; the cells were transferred to a 1.5ml EP tube, 400g, centrifuged at room temperature for 5 minutes; the supernatant was discarded and the sample was stored at-20 ℃.

3.3 extracting the cell genome DNA of the hMSC by using a genome DNA extraction kit; the target specific fragment is amplified by HBB specific primers by taking genome DNA as a template; the PCR product was subjected to agarose gel electrophoresis and the gel of the electrophoresis product was recovered.

3.4 taking 300ng of the gel recovered product, adding NEB Buffer2 for denaturation and gradient annealing.

3.5 digestion/annealing products with T7endonuclease I to verify the editing effect of sgRNA on the hMSC genome. Relevant plasmids containing the HBB gene sgRNA were transfected into hMSC cells with optimized electroporation parameters, which showed that the plasmids transfected inside the cells produced a significant editing effect on their genomic DNA (fig. 11).

Fig. 10 to 11 show verification of the HBB gene sgRNA on hMSC genome editing efficiency, respectively. FIG. 10 shows the introduction of Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ into hMSCs by electroporation transfection, respectively, at a cell count of 5X 10⁵Individual cells/well; FIG. 11 shows T7endonuclease I enzymatic cleavage method to verify the editing effect of sgRNA on hMSC cell genomic DNA.

(II) example 2

The present invention is described in detail by using a CRISPR-Cas9 gene editing system introduced into human umbilical cord blood-derived hematopoietic stem cells (UB-HSC) as a specific example.

Hematopoietic stem cells are derived from various sources, such as bone marrow and peripheral blood, but UB-HSC contain more early hematopoietic stem cells and have a higher differentiation potential than adult-derived hematopoietic stem cells, compared to adult-derived hematopoietic stem cells. At present, hematopoietic stem cell transplantation is used for treating various diseases, and the UB-HSC and CRIPSR-Cas9 editing system has good application prospect. However, the UB-HSC is a suspended stem cell, and the efficient introduction of the system into the UB-HSC is a big difficulty of the current technology. The invention can fully utilize the advantages of electroporation transfection to introduce HBB-sgRNA-Cas9-T2A-GFP containing HBB gene sgRNA and CRIPSR-Cas9 expression cassettes into UB-HSC.

UB-HSC cell culture the UB-HSCs used in this experiment were sorted from Miltenyi Biotec CD34+ magnetic beads and identified and screened by flow cytometry. Inoculating the cells into a cell culture bottle for culture for a period of time, supplementing a cell culture medium in time in the culture process to ensure that the cells have a good growth state, and using the cells for electric conversion when the cell amount reaches 70-90%.

UB-HSC electroporation transfection method fresh medium (without antibiotics) was added to 24-well cell culture plates 500. mu.l per well before electroporation, and the plates were then placed in a 37 ℃ cell culture chamber for preheating; taking out the cells, taking part of the cultured cells for cell counting, and determining the cell density; at least 2 x 10 per hole⁶Amount of individual cells an appropriate amount of cell suspension was transferred to a 15ml centrifuge tube and centrifuged at 100-; the supernatant was aspirated and washed with 1 XPBS (Mg-free)²⁺And Ca²⁺) Resuspending the cells, and centrifuging at room temperature at 400g for 5 min; sucking out the supernatant, and resuspending the cells by Buffer T, wherein the time of the cell suspension at room temperature cannot exceed 30 minutes; adding plasmids with the volume not more than 10 percent of the total volume of the mixed solution of the cells and the plasmids into a 1.5ml centrifuge tube, then adding the cell suspension, and gently mixing uniformly; in Neon^TMThe tube was filled with an electrotransfer Buffer E2 and Neon was added^TMThe tube is inserted into a pipettor rack; setting pulse voltage 1500V, pulse width 40ms and pulse number 1 time on the electrotransformation instrument; inserting the lance tip into the Neon^TMSucking the mixed solution of the cells and the plasmids after the pipettor is placed; will carry the Neon of the sample^TMVertical insertion of pipettor into Neon^TMIn the tube; selecting an electroporation program, pressing a Start key on a touch screen, and taking out the pipettor and the sample when the touch screen displays that electroporation is finished; transferring the electrically shocked cells to a culture plate with a preheated culture medium, and culturing the culture plate in a cell constant-temperature incubator at 37 ℃; after culturing for 24h, the cell transfection efficiency can be detected or cell experiment treatment can be carried out.

Transfection of UB-HSC by HBB-sgRNA-Cas9-T2A-GFP-SZ electroporation transfection

We first introduced HBB-carrying sgRNA plasmids into UB-HSCs using electroporation transfection and examined the editing effect of the CRISPR-Cas9-sgRNA system on the UB-HSC genome.

1) The plasmid is extracted by using a kit for extracting large amount of endotoxin-removing plasmid, so that the concentration of the plasmid is higher than 1 mug/mul, and A260/A280 is more than 1.8.

2) Cas9-T2A-GFP-SZ and HBB-sgRNA-Cas9-T2A-GFP-SZ were transferred into UB-HSC by electroporation transfection.

3) After the cells are subjected to electrotransformation culture for 48 hours, the cells are collected; 400g, centrifuge for 5 minutes at room temperature.

4) Extracting the genome DNA by using the cell genome DNA extraction kit.

5) Taking genome DNA as a template, and carrying out PCR amplification on HBB specific primers to obtain specific fragments;

6) carrying out agarose gel electrophoresis on the PCR product and cutting and recovering the gel; and (3) enzyme digestion of the gel recovery product by T7endonuclease I to identify the gene editing effect of HBB sgRNA on UB-HSC.

Fig. 12-13 show verification of HBB gene sgRNA on hMSC genome editing efficiency. FIG. 12 shows the introduction of Cas9-T2A-GFP-SZ (corresponding to the left column in FIG. 12, column numbered 1 in FIG. 13) and HBB-sgRNA-Cas9-T2A-GFP-SZ (corresponding to the right column in FIG. 12, column numbered 2 in FIG. 13) into UB-HSC by electroporation transfection, with parameters: 1500V, 40ms, 1T, number of electrotransfected cells 2X 10⁶Individual cells/well; FIG. 13 shows T7endonuclease I restriction enzyme validation of sgRNA on UB-HSC cell genomic DNA editing.

In conclusion, the method for efficiently introducing the CRISPR-Cas9 gene editing system into the human stem cells provided by the invention can effectively improve the survival rate of the stem cells after electroporation transfection by transferring the CRIPSR-Cas9 gene editing system into the stem cells by using an electroporation method.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.

SEQUENCE LISTING

<110> Shenzhen Sanzhi medical science and technology Limited

<120> method for introducing CRISPR-Cas9 system into human stem cells

<130>2019

<160>4

<170>PatentIn version 3.5

<210>1

<211>20

<212>RNA

<213> Artificial sequence

<400>1

tggtatcaag gttacaagac 20

<210>2

<211>1231

<212>DNA

<213> Artificial sequence

<400>2

tatggggata tttgactgta acacaaagat attagtacaa aatacgtgac gtagaaagta 60

ataatttctt gggtagtttg cagttttaaa attatgtttt aaaatggact atcatatgct 120

taccgtaact tgaaagtatt tcgatttctt ggctttatat atcttgtgga aaggacgaaa 180

caccgtggta tcaaggttac aagacgtttt agagctagaa atagcaagtt aaaataaggc 240

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg cttttttgtt ttagagctag 300

aaatagcaag ttaaaataag gctagtccgt ttttagcgcg tgcgccaatt ctgcagacaa 360

atggctctag aggtacccgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc 420

aacgaccccc gcccattgac gtcaatagta acgccaatag ggactttcca ttgacgtcaa 480

tgggtggagt atttacggta aactgcccac ttggcagtac atcaagtgta tcatatgcca 540

agtacgcccc ctattgacgt caatgacggt aaatggcccg cctggcattg tgcccagtac 600

atgaccttat gggactttcc tacttggcag tacatctacg tattagtcat cgctattacc 660

atggtcgagg tgagccccac gttctgcttc actctcccca tctccccccc ctccccaccc 720

ccaattttgt atttatttat tattaaatta ttttgtgcag ccatggggag ctgtgataag 780

caaggggggc ccctccccct aatatgacat atcagtcacc aattgagtgt atgtgggtta 840

caaaaataaa ccgcctatcc aaggcaggga tgtaggggtg gggaaagaat gtgaatagac 900

taggacagcg tgtacagtat tattcacgat tatagatacc cccatggggt ttggggagtg 960

cgtctgtctg ttggctcccg tatcgggagg gggagaacac agttgagaaa atagacgaag 1020

aagcagaaga ggagagaaat agatggtaca tgaatctgta gtgatggcgt tgaagcgttc 1080

agatgagtgt gagtgtatct cgttatatga tatatagtat gatactgatg gaaaacacgg 1140

aagcagatgc gtatgctgag tcgacggtaa gaggtaatgc gaagtgaagg atctaaggaa 1200

atcgtgcatg tgagtttttg ggccgacgat c 1231

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<400>3

cctgaggaga agtctgccgt tac 23

<210>4

<211>21

<212>DNA

<213> Artificial sequence

<400>4

ttgaggttgt ccaggtgagc c 21

Claims

1. A method for introducing a CRISPR-Cas9 gene editing system into human stem cells, which is characterized by comprising the following steps:

2. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to claim 1, wherein in step (2), the human stem cells are mesenchymal stem cells, and the electroporation transfection conditions are as follows: the pulse voltage is in the range of 1300V to 1400V.

3. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to claim 2, wherein the electroporation transfection conditions are as follows: the pulse voltage is 1325V, the pulse time interval is 20ms, and the pulse times are 2 times.

4. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to claim 1, wherein in step (2), a 10 μ L-sized Tip of Tip is used for electroporation transfection.

5. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to any one of claims 1-3, wherein in the step (2), the A260/280 ratio of the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid is not less than 1.64, and the concentration is not less than 508ng/μ L.

6. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to any one of claims 2-3, wherein in the step (2), the A260/280 ratio of the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid is not lower than 1.8, and the concentration is not lower than 1 μ g/μ L.

7. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to claim 1, wherein a step of verifying the gene editing effect of HBB-sgRNA-Cas9-T2A-GFP-SZ is further included between the step (1) and the step (2).

8. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to claim 1, wherein in step (2), the human stem cells are hematopoietic stem cells, and the electroporation transfection conditions are as follows: the pulse voltage is 1500V, the pulse width is 40ms, and the number of pulses is 1.

9. The method for introducing the CRISPR-Cas9 gene editing system into human stem cells according to claim 8, wherein in step (2), the A260/280 ratio of the HBB-sgRNA-Cas9-T2A-GFP-SZ recombinant plasmid is not less than 1.8, and the concentration is not less than 1 μ g/μ L.