CN117904180A - Drought stress related transcriptional activator ZmNAC and application thereof - Google Patents

Abstract

The application belongs to the field of molecular breeding, relates to a method for cultivating a new drought-resistant variety of plants, and particularly relates to a transcription activator ZmNAC and an application thereof related to drought stress. The application screens a ZmNAC gene with obvious differential expression from the gene expression data after the drought stress of the corn, and confirms that the drought resistance of the corn is positively regulated and controlled by the analysis of the differential expression and the correlation analysis of the gene and the physiological and biochemical index, and the ear development, the flowering and the pollination of the corn are positively regulated and controlled, and finally the yield of the corn after the drought stress is influenced. Not only lays a foundation for explaining the biological functions of the corn NAC family members, but also provides a new thought for drought-resistant molecular breeding and stores molecular resources for the cultivation of drought-resistant varieties.

Description

Drought stress related transcriptional activator ZmNAC and application thereof

Technical Field

The invention belongs to the field of molecular breeding, relates to a method for cultivating a new drought-resistant variety of plants, and particularly relates to a transcription activator ZmNAC and an application thereof related to drought stress.

Background

The corn (Zea mays L.) is one of the main grain producing countries in the world, is used as an important grain crop, feed and industrial raw material in China, has extremely high yield potential and nutritive value, and plays an important role in ensuring grain safety and increasing income of farmers. The corn yield steadily increases in more than ten years, but the sensitivity to drought also increases year by year, as crops originating from subtropical zones, corn is Wen Xishi, in recent years, water resource shortage, extreme weather increase and drought environment frequently occur, so that corn in the northern and southwest main corn planting areas of China is frequently subjected to drought stress, corn in seedling stage suffers from drought stress to cause slow growth, short plants and reduced chlorophyll content, and corn in mature stage suffers from drought stress to directly influence the development of female and male ears, thereby reducing the yield and finally reducing the grain yield.

Planting drought-resistant corn varieties is one of effective ways for coping with drought stress, so that the cultivation of new varieties with drought resistance becomes a primary goal of breeders, and a series of transgenic technologies such as molecular marker assisted selection, haploid breeding, transgene, gene editing and the like in recent years provide a convenient way for corn genetic improvement in modern breeding technology. The drought-resistant gene can be introduced into the corn by utilizing a genetic engineering means, drought-resistant germplasm is created, new varieties of drought-resistant corn are rapidly cultivated, and the novel varieties are popularized and planted, so that the influence of yield reduction caused by drought stress can be essentially solved.

Transcription factors are a class of proteins that can specifically bind to a specific DNA sequence 5' upstream of a gene, and can regulate the expression intensity of the gene in different time and space. Transcription factors in higher plants play an important role in growth, secondary metabolism and adverse stress response. Among them, NAC family proteins are a plant-specific, numerous transcriptional activators that are involved in processes such as plant secondary growth, in cell division and tree planting senescence, in hormonal regulation and signal transduction, and in defense responses of plants in biotic and abiotic stress. NAM proteins belong to a subfamily of NAC proteins and are mainly involved in shoot apical meristem, apical differentiation of young embryos. At present, NAM protein research is mainly focused on apical meristem and organ boundary establishment, and application of publication No. CN110698549A discloses application of ZmNAC89 transcription factor gene in improving salt and alkali tolerance and yield of corn. The total length of the gene is 2280bp, and the gene comprises 3 exons and 2 introns; the open reading frame is 1197bp, codes 398 amino acids, the 5'-UTR region is 163bp, and the 3' -UTR region is 253bp; the encoded protein has a NAM protein conserved domain; after the gene is over-expressed, the saline-alkali resistance of crops can be obviously improved, and the yield of corn is further improved. However, no NAM protein has been reported in maize to be involved in responding to drought stress in plants. The present application has long been explored in order to further explore the role of NAC transcriptional activators in maize growth and response to stress.

Disclosure of Invention

In order to solve the technical problems, the invention provides a transcriptional activator ZmNAC and an application thereof, wherein the transcriptional activator is related to drought stress.

The technical scheme of the invention is realized as follows:

use of transcriptional activators associated with drought stress in regulating crop yield.

The application of transcriptional activators related to drought stress in regulating the development time of male flowers and female ears of hermaphrodite crops.

The above transcriptional activator is located on chromosome 10 and contains 2 exons and NAM domain.

The transcription activator is ZmNAC-76 gene, and the nucleotide sequence of the transcription activator is shown as SEQ ID No. 1.

The amino acid sequence of the protein coded by the ZmNAC gene is shown as SEQ ID No. 2.

A gene editing vector containing a transcriptional activator related to drought stress, wherein the transcriptional activator is ZmNAC gene, and the nucleotide sequence of the transcriptional activator is shown as SEQ ID No. 1.

The gene editing vector is a recombinant vector for over-expressing ZmNAC76,76 proteins.

A method for improving the yield of crops under drought stress or improving the synchronicity of the development of male flowers and female ears comprises the following steps: constructing the recombinant vector for over-expressing ZmNAC protein 76, and transferring the recombinant vector into crops by an agrobacterium genetic transformation method to obtain transgenic crops resistant to drought stress.

The amino acid sequence of ZmNAC protein 76 is shown as SEQ ID No. 2.

Preferably, the crop is corn.

The invention has the following beneficial effects:

1. The patent screens a ZmNAC gene with obvious differential expression from the gene expression data after the drought stress of the corn, and confirms that the drought resistance of the corn is positively regulated and controlled by the analysis of the differential expression and the correlation analysis of the gene and the physiological and biochemical indexes, and the ear development, the flowering and the pollination of the corn are positively regulated and controlled, so that the yield is finally influenced. Not only lays a foundation for explaining the biological functions of the corn NAC family members, but also provides a new thought for drought-resistant molecular breeding and stores molecular resources for the cultivation of drought-resistant varieties.

2. The application discloses a novel transcription factor ZmNAC and a preparation method thereof, wherein a CRISPR/Cas9 technology is adopted to knock out ZmNAC gene in a maize inbred line B104, and drought treatment is carried out on a deletion mutant plant. Experimental study shows that compared with WT, the drought resistance of seedlings is reduced, leaves are curled, withered and green-losing, leaf tips withered, the relative water content and antioxidant enzymes (POD, SOP and CAT) are reduced, and the malondialdehyde content is higher than that of normal plants. Then the ZmNAC gene is over-expressed in the maize inbred line B104, and the drought resistance of the over-expressed line is enhanced compared with that of the WT after drought stress. The result shows that ZmNAC gene positively regulates drought resistance of corn.

3. In drought stress, the development of tassel and female spike of zmnac76_1 and zmnac76_2 mutant plants is delayed, flowering Time (FT), days of Silking (DSE) and interval of flowering silking (ASI) are obviously prolonged, and the yield is obviously reduced. Experiments show that lack of ZmNAC gene makes corn sensitive to drought, and reproductive growth is inhibited, resulting in yield reduction.

Drawings

In order to more clearly illustrate the embodiments of the invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows ZmNAC76 gene expression levels in maize tissues.

FIG. 2 is a maize ZmNAC protein conserved domain.

FIG. 3 is an electrophoretogram of corn ZmNAC gene PCR products.

FIG. 4 is a schematic representation of the target position of the coding region of the CRISPR/Cas9 technology knockout ZmNAC gene.

FIG. 5 is the effect of drought on wild type and ZmNAC gene deletion mutant lines seedling phenotype, leaf RWC, antioxidant enzyme activity, malondialdehyde, CAT content.

FIG. 6 is a graph showing the effect of drought on wild type and ZmNAC gene deletion mutant lines plant phenotype, tassel development and corn ears.

FIG. 7 is a graph showing the effect of drought on the days of flowering (DTA), days of laying (DSE), and interval of flowering (ASI), as well as on aboveground biomass, hundred grain weight, and yield per plant, for wild-type and ZmNAC-76-gene deletion mutant strains.

FIG. 8 is an effect of drought on wild type and ZmNAC76 gene over-expression strain plant phenotypes.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without any inventive effort, are intended to be within the scope of the invention.

Example 1: zmNAC76 Gene biological information analysis

The ZmNAC gene with obvious differential expression is screened from the gene expression data of corn drought stress performed earlier in the subject group (the sequence is shown as SEQ ID No. 1). Drought treated maize inbred line Zheng 8713 was simulated with 20% PEG 6000. The amount of ZmNAC76 expressed under drought stress was significantly higher than before treatment, and the highest amounts were 38 times higher than before treatment, respectively, indicating that ZmNAC gene was strongly up-regulated after drought stress treatment (FIG. 1).

NCBI functional annotation found that the gene was located on chromosome 10 and contained 2 exons. Analysis of the conserved domain of the protein shows that the protein sequence contains NAM domain (figure 2) as shown in SEQ ID No.2, belongs to NAM subfamily in NAC transcription factor family, and is named ZmNAC76.

Example 2: cloning of ZmNAC76 Gene

The total RNA of corn is obtained by reverse transcription, cDNA is taken as a module, zmNAC76-F: ATGGAGGTGAAGAAGGAGGG and ZmNAC-R: TCACGGGCCTCTGCTGGTG G specific sequences are taken as primers, and gene ORF is amplified.

The amplification procedure comprises pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 45s, annealing at 60 ℃ for 45s, extension at 72 ℃ for 1 min, third step cycle for 35 times, and extension at 72 ℃ for 10 min;

The amplification system is as in table 1:

Table 1ZmNAC Gene clone amplification system

Reagent(s)	Reaction system (mu L)
		2×GC BufferI	12.5
dNTP Mixture (2.5 mM)	2
		Forward Primer (10 uM)	1
Reverse Primer (10 uM)	1
		cDNA	1
DNA Polymerase (2.5 U/uL)	0.3
		ddH2O	7.2
Total	25

The resulting PCR amplified product was detected by 1% agarose gel electrophoresis, and had a single band and a fragment consistent in size with the target gene (FIG. 3).

Example 3: analysis of plant phenotype variation of ZmNAC gene-positive knocked-out plant under drought treatment

ZmNAC76 in inbred B104 was knocked out using CRISPR/Cs9 technology, and two targets for Cas9 cleavage were located within the first and second exons of ZmNAC 67. Cut targets of ZmNAC were screened on website http:// www.genome.arizona.edu/crispr/CRISPRsearch. Html and primers were designed for double knocks (FIG. 4):

F1:ATTGATCCCGGACGTCCGCATCCTGG；

R1:AAACCCAGGATGCGGACGTCCGGGAT；

F2:ATTGAAGTACGTGAAGGGCCGGGCGCG；

R2:AAACCGCGCCGGCCCTTCACGTACTT。

Subsequent experiments were performed with the selection of mutant lines zmnac67-1 and zmnac67-2 with lower expression levels and resulting frame shifts (FIG. 4). Then, WT, zmnac67-1 and zmnac67-2 were subjected to drought stress for 3 days and 5 days, respectively. The results showed that zmnac-1, zmnac-67-2 and WT plants all began to lose water and lose green, the leaves curled and withered after drought stress, but WT seedlings grew better than zmnac-1 and zmnac-67-2, and the mutants were more sensitive to drought (FIG. 5). The deletion of ZmNAC is proved to reduce the drought resistance of corn seedlings, and the result shows that the ZmNAC67 gene plays a positive role in drought stress.

Example 4: physiological and biochemical index determination of ZmNAC76 gene deletion mutant under drought treatment

The physiological index of corn is measured, the water content (RWC) of the leaf is measured by a weighing method, and the water loss rate of each strain in 5h is calculated. The Malondialdehyde (MDA) content was determined by the thiobarbituric acid method. Measuring the activity of superoxide dismutase (SOD) by adopting a nitrogen blue tetrazolium photochemical reduction method; measuring Peroxidase (POD) activity by using a guaiacol method; catalase (CAT) was extracted with 0.05 mol ·l ^-1 phosphate buffer (ph=7.5) containing 1% PVP and the enzyme activity was measured.

The results are shown in FIG. 5: under the normal growth condition, various indexes of each strain have no obvious difference. After drought stress, each strain of leaf has a reduced RWC, and the WT leaf moisture content is significantly higher than zmnac < 67 > -1 and zmnac < 67 > -2.RWC can reflect the water potential of plant leaves and is an important index of drought resistance of plants. Under drought stress, RWC keeps higher plants and has stronger drought resistance.

MDA content is an important physiological index for evaluating the damage degree of leaf cell membranes under drought stress. After drought stress, MDA of the maize lines was significantly increased, indicating that drought stress caused damage to maize cells. At this time, a series of antioxidant enzymes such as SOD, POD and CAT can play a role in scavenging, thereby maintaining cell functions and metabolic activities. As can be seen from fig. 5, there was no significant difference in MDA, SOD, POD and CAT enzyme activity between the lines prior to stress treatment. After 3 and 5 days of drought treatment, the MDA content of zmnac67-1 and zmnac67-2 plants was significantly higher than that of WT, demonstrating that the loss of ZmNAC67 severely damaged the plant cell membranes. Meanwhile, zmnac67-1 and zmnac67-2 plants had lower enzyme activities than WT. The above results indicate that the ZmNAC67,67 deletion does reduce drought resistance of corn.

Example 5: analysis of female and male ears and ear phenotype change under ZmNAC76 gene deletion mutant drought treatment

To demonstrate whether ZmNAC gene affects major agronomic traits and yield under drought stress, transgenic lines with WT and ZmNAC67 gene deletions were grown in rainshed under normal and drought conditions (soil relative water holding capacity of about 45%) until maturity (fig. 6). Under normal conditions, the strain heights of zmnac-67-1 and zmnac-2 mutants were similar to the corresponding WTs, while under drought conditions, the strain heights of zmnac-67-1 and zmnac-2 mutants were lower than those of WTs under normal conditions (fig. 6-a).

Development of WT, zmnac67-1 and zmnac-2 mutant plants at V10 stage tassel and V10-V14 stage female tassel under drought stress conditions was also studied (FIG. 6-B). Both the female and male ears of the WT and zmnac mutant plants developed a delayed phenotype under drought stress, while zmnac67-1 and zmnac67-2 mutant plants developed slightly later than WT under drought stress.

Under drought stress, the WT, zmnac67-1 and zmnac67-2 mutants all showed developmental arrest and reduced growth in the ear of maize, with zmnac67-1 and zmnac67-2 mutants being more severe. Finally, zmnac67-1 and zmnac67-2 mutants showed reduced yield under drought stress compared to WT (fig. 6-C).

Taken together, zmnac-1 and zmnac-2 mutants were sensitive to drought, and the loss of ZmNAC67 resulted in delayed maize female and male ear development and ultimately in maize yield loss.

Example 6: flowering character and grain yield determination analysis under ZmNAC76,76 gene deletion mutant drought treatment

Flowering traits reflect adaptation of plants to environmental conditions and the transition from vegetative to reproductive growth. When the corn is subjected to drought stress, the front end advantage can provide energy substances for the male flowers preferentially, so that the male flowers grow into powder rapidly, and auxin is conveyed to axillary meristems to delay the growth of female ears. Thus, drought stress can lead to prolonged flowering Days (DTA), days of laying (DSE) and interval of flowering (ASI), resulting in unsynchronized male and female tassel development, impeding successful pollination of corn, resulting in severe yield loss. Research shows that ASI is inversely related to corn yield under water stress, so ASI is one of important morphological characters for identifying drought resistance of corn. The DTA, DSE and ASI of the zmnac-1 and zmnac67-2 mutants were found to be similar to WT under normal conditions, as measured by the indices of plant growth, flowering trait and grain yield under drought stress conditions, whereas the DTA, DSE and ASI of the zmnac-67-1 and zmnac67-2 mutants were increased over WT under drought conditions (fig. 8).

Aboveground biomass, hundred grain weight and yield per plant are all indicators showing corn ear yield. Normally, the above ground biomass, hundred grain weight and yield per plant of zmnac-1 and zmnac-2 mutants do not differ much from the WT ratio, whereas under drought conditions, both mutant and WT yields are reduced. Wherein, the overground biomass and the yield of each strain of the mutant are reduced more, the overground biomass and the yield of each strain are greatly different from those of the WT, and the hundred grain weight of the mutant is similar to that of the WT, which proves that zmnac67-1 and zmnac67-2 mutants are reduced due to the asynchronous development of male flowers and female ears, and the ovule is aborted due to the obstruction of corn pollination. The results show that zmnac-1 and zmnac-67-2 mutants are sensitive to drought, and the deletion of ZmNAC67 genes influences the timing of emasculation and silk production of corn, thereby influencing yield.

Example 7: analysis of plant phenotype change under ZmNAC76 gene over-expression plant drought treatment

Designing a target gene primer by using NCBI:

ZmNAC67-pFGC5941-AscI-F：

ATTACCATGGGGCGCGCCATGGAGGTGAAGAAGGAGGG；

ZmNAC67-pFGC5941-BamHI-R：

TCTAGACTCACCTAGGATCCCGGGCCTCTGCTGGTGG。

the existing original vector pFGC5941 is subjected to double enzyme digestion linearization by AscI and BamHI, and then a target gene is connected to an expression vector pFGC5941 by using a homologous recombination technology (Vazyme) to obtain a ZmNAC-pFGC 5941 vector. The ZmNAC67 gene is introduced into the maize inbred line B104 through ZmNAC-pFGC 5941 vector by agrobacterium genetic transformation to realize over-expression, and two positive strains OE1 and OE2 with high expression levels are selected. FIG. 8 shows that over-expressed ZmNAC67 transgenic plants grew better, leaves were less green and WT leaves wilted and growth retardation was more severe after drought stress than wild type.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

Claims (10)

1. Use of transcriptional activators associated with drought stress in regulating crop yield.

2. The application of transcriptional activators related to drought stress in regulating the development time of male flowers and female ears of hermaphrodite crops.

3. Use according to claim 1 or 2, characterized in that: the transcriptional activator is located on chromosome 10 and contains 2 exons and NAM domains.

4. A use according to claim 3, characterized in that: the transcription activator is ZmNAC gene, and the nucleotide sequence of the transcription activator is shown as SEQ ID No. 1.

5. The use according to claim 4, characterized in that: the amino acid sequence of the protein coded by the ZmNAC gene is shown as SEQ ID No. 2.

6. A gene editing vector comprising a transcriptional activator associated with drought stress, comprising: the transcription activator is ZmNAC gene, and the nucleotide sequence of the transcription activator is shown as SEQ ID No. 1.

7. The gene editing vector according to claim 5, wherein: the gene editing vector is a recombinant vector for over-expressing ZmNAC76,76 proteins.

8. A method for increasing yield or increasing synchronicity of development of male flowers and female ears under drought stress conditions of crops, comprising the steps of: constructing a recombinant vector for over-expressing ZmNAC protein 76 as defined in claim 6, and transferring the recombinant vector into crops by an agrobacterium genetic transformation method to obtain transgenic crops resistant to drought stress.

9. The method for increasing yield under drought stress conditions or for increasing synchronicity of tassel and tassel development in crops according to claim 8, wherein: the amino acid sequence of ZmNAC76 protein is shown as SEQ ID No. 2.

10. The method for increasing yield under drought stress conditions or for increasing synchronicity of tassel and tassel development in crops according to claim 7, wherein: the crop is corn.