CN117890602A - Medical application for inhibiting TNF receptor related protein 1 - Google Patents

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to medical application of a protein 1 related to a TNF receptor. In atherosclerosis-associated cells and animal models, it was found that interfering with TNF receptor-associated protein 1 can inhibit smooth muscle cell senescence and the development of atherosclerosis; the application provides a new target point for diagnosing and treating atherosclerosis-related cardiovascular diseases, and opens up a new direction for preparing medicines for preventing and treating atherosclerosis.

Description

Medical application for inhibiting TNF receptor related protein 1

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of a substance for inhibiting activity of TNF receptor related protein 1 (Tumor necrosis factor receptor-associatedprotein 1, TRAP 1) in medicines for preventing and treating atherosclerosis related vascular diseases caused by aging.

Background

As the population ages more severely, cardiovascular disease (cardiovascular disease, CVD) has become a leading cause of mortality worldwide. Atherosclerosis is one of the major causes of cardiovascular disease, a chronic disease of the arterial wall, and is mainly characterized by lipid accumulation and formation of atherosclerotic plaques. Death from atherosclerosis is associated with cardiovascular complications caused by plaque rupture, which can form thrombi, leading to acute coronary syndromes or strokes. Thus, timely prevention and treatment of cardiovascular diseases, including atherosclerosis, remains a paramount concern. Smooth muscle cells play a key role in the formation of atherosclerosis. More and more studies have shown that Vascular Smooth Muscle Cells (VSMC) in advanced atherosclerosis have premature senescence characteristics, such as dysproliferation, significant shortening of telomerase, and expression of senescence markers. Aging of VSMC results in reduced VSMC content, affecting repair after plaque rupture, thereby inducing vulnerability of plaque. Thus, aging of VSMC is a key factor in the development and progression of atherosclerosis.

Cell aging is a physiological process of irreversible cell cycle arrest, and metabolic disorders and chromatin structure changes are major features thereof, resulting in cell dysfunction and balance disorder. In senescent smooth muscle cells, ATP production is dependent on aerobic glycolysis for energy supply due to metabolic disorders. We have found that a novel energy-regulating factor, TNF receptor-related protein 1 (TRAP 1), is involved in the regulation of smooth muscle aging. TRAP1 is a major member of mitochondria in the HSP90 family of heat shock proteins, a key regulator of metabolism and organelle homeostasis in a variety of pathological states and healthy cells, and recent studies have found that TRAP 1-deficient mice exhibit reduced incidence of aging-related diseases, while TRAP1 expression is excessive leading to mitochondrial dysfunction. However, whether TRAP1 in smooth muscle cells is involved in atherosclerosis has not been reported.

Disclosure of Invention

In view of the above problems, the present application provides a medical use for inhibiting TNF receptor-related protein 1.

The aim of the invention can be achieved by the following technical scheme:

first, the present invention provides the gene sequence and amino acid sequence of TRAP 1.

TRAP1 Gene sequence:

https://www.ncbi.nlm.nih.gov/nuccore/NC_000016.10report＝fasta&from＝3658037&to＝3717524&strand＝true

>NC_000016.10:c3717524-3658037Homo sapiens chromosome 16,GRCh38.p14PrimaryAssembly。

TRAP1 amino acid sequence as shown in SEQ ID NO. 1:

https://www.uniprot.org/blast

>sp|Q12931|TRAP1_HUMAN Heat shock protein 75kDa,mitochondrial OS＝Homo sapiens OX＝9606GN＝TRAP1 PE＝1SV＝3.

In a first aspect, the invention provides the use of TRAP1 for the preparation of an auxiliary diagnostic reagent for cardiovascular diseases.

In a second aspect, the invention provides the use of an agent for detecting TRAP1 in the preparation of an auxiliary diagnostic agent for cardiovascular diseases.

In a third aspect, the invention provides the use of TRAP1 as a detection target in screening or aiding in screening of therapeutic agents for atherosclerosis.

In a fourth aspect, the invention provides the use of TRAP1 as a target in the manufacture of a medicament for the prevention and treatment of cardiovascular disease.

In a fifth aspect, the invention provides the use of a substance for protecting against knockdown or inhibiting TRAP1 in the manufacture of a medicament for the prevention and treatment of cardiovascular disease.

In a sixth aspect, the invention provides the use of a substance which prevents knockdown or inhibits expression of TRAP1 in the manufacture of a medicament for screening or aiding in screening of cardiovascular disease.

Preferably, the substance that inhibits or knocks out TRAP1 expression is selected from the group consisting of siRNA for TRAP1, gene editing system for specifically knocking out TRAP1, or other small molecule compounds capable of specifically inhibiting TRAP 1.

As a preferred aspect of the present invention, the siRNA is as shown in SEQ ID NO. 2-3.

Preferably, the cardiovascular disease is a cardiovascular disease drug caused by aging.

Preferably, the cardiovascular disease caused by aging is atherosclerosis.

In a seventh aspect, the present invention provides a method of screening for an atherosclerosis therapeutic agent, detecting TRAP1 content before and after administration, and evaluating the efficacy of a candidate agent for treating atherosclerosis by the decrease in TRAP1 content.

Construction of Apoe ^KO mice (Apoe ^KOTrap1^SMCKO) with smooth muscle cell-specific knockout Trap1, its use in the preparation of a medicament for treating atherosclerosis.

The invention has the beneficial effects that:

Experiments such as Western Blot, RT-qPCR, immunofluorescent staining and the like show that TRAP1 expression is increased in Ras-induced aging smooth muscle cells. TRAP1 deficiency can significantly improve smooth muscle cell senescence and metabolic disorders. Meanwhile, an Apoe ^KO mouse for specifically knocking out Trap1 by smooth muscle cells is constructed: apoe ^-/- mice at 8 weeks of age were selected and randomized into control and TRAP1 knockout groups and fed with high fat for 16 weeks. Compared with a control group, the plaque area, the aging marker and the SASP of the mice are reduced, the regulation of TRAP1 on smooth muscle cell aging is clarified for the first time, a novel prevention and treatment drug development path and drug action target point are provided for diagnosis and treatment of atherosclerosis, and the invention has very important medicinal value.

Drawings

FIG. 1 shows protein levels of TRAP1 in Ras-induced human vascular smooth muscle cells: TRAP1 expression levels in normal and Ras-induced smooth muscle cells were detected by Western Blot.

FIG. 2 is the effect of protein expression levels of P53, P21 and P16 in Ras-induced smooth muscle cells after TRAP1 knockout: smooth muscle cells were treated with siTRAP a and then Ras-induced to extract cellular proteins and the levels of P16, P21, P53 protein expression were detected by Western Blot.

FIG. 3 shows the detection of smooth muscle senescence by beta-galactosidase staining after TRAP1 knockout: smooth muscle cells were treated with siTRAP a and then Ras-induced, and the level of smooth muscle cell senescence was detected using a beta-galactosidase staining assay.

FIG. 4 shows the detection of SASP (IL-6, IL-8, IL-1β, CCL2, ICAM-1, TNF- α) expression levels by real-time quantitative PCR (RT-qPCR) after TRAP1 knockdown: smooth muscle cells were treated with siTRAP a, then Ras-induced, sample RNA was extracted and SASP expression was detected by RT-qPCR.

Fig. 5 is a vascular oil red O staining of Normal (NC) and High Fat (HFD) fed Apoe ^KOTrap1^WT mice and Apoe ^KOTrap1^SMCKO mice: apoe ^KOTrap1^WT and Apoe ^KOTrap1^SMCKO mice were fed normal diet (NC) or High Fat (HFD) for 16 weeks, the aortic blood vessels of the mice were extracted and oil red O staining was performed to detect plaque size.

Fig. 6 is vascular fluorescent staining of senescence marker P21: apoe ^KOTrap1^WT and Apoe ^KOTrap1^SMCKO mice were fed normal diet (NC) or High Fat (HFD) for 16 weeks, the aortic blood vessels of the mice were extracted for OCT embedding and frozen sections and expression of P21 and α -SMA was detected using fluorescent staining.

FIG. 7 shows P16, P21 and P53 protein content in vascular smooth muscle cells of Normal (NC) and High Fat (HFD) fed Apoe ^KOTrap1^WT mice and Apoe ^KOTrap1^SMCKO mice: the 8-week-old mice were high-fat-fed for 16 weeks, and then aortic vascular smooth muscle cells were extracted, and protein expression of P21, P16 and P53 was detected using Western Blot.

FIG. 8 is SASP expression in vascular smooth muscle cells of Normal (NC) and High Fat (HFD) fed Apoe ^KOTrap1^WT mice and Apoe ^KOTrap1^SMCKO mice: high fat diet of 8 week old mice for 16 weeks followed by extraction of aortic vascular smooth muscle cells and detection of SASP expression using RT-qPCR.

Detailed Description

The following examples will provide those skilled in the art with a thorough understanding of the present invention and are not intended to limit the present invention in any way.

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. The described embodiments are not all embodiments, but only a portion of the embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

EXAMPLE 1TRAP1 and smooth muscle cell aging-related assay

To explore the levels of mitochondrial protein TRAP1 in atherosclerosis, it was verified whether TRAP1 was involved in regulating cellular senescence and thus atherosclerosis, and in this experiment, the levels of TRAP1 in normal and Ras-induced smooth muscle cells were detected using the Westernblot assay.

Constructing a smooth muscle cell aging model: smooth muscle cells were cultured in plates for 24h and then transfected with 20. Mu.g of retrovirus plasmid at 37℃for 15h. The virus-containing medium was filtered using a 0.45 μm filter and the first supernatant was removed. The same procedure was repeated once and virus was collected again. At the time of infection, an appropriate amount of the first supernatant was added to DMEM medium, and then smooth muscle cells were cultured at 37 ℃ for 12 hours. Cells were then screened for 3 days using 2 μg/mL puromycin to model cell senescence, while taking the equal amount of PBS added as a control group (Con);

Western Blot detection TRAP1 protein expression: cell proteins are extracted, protein concentration is quantified by using a BCA quantitative kit, then a sample is diluted, loading is carried out, and the sample is centrifuged and slightly shaken up before loading. Through electrophoresis, transfer of the membrane, the sample was transferred to PVDF membrane. PVDF membranes were blocked with 5% skim milk for 1h at room temperature and then incubated overnight at 4 ℃ with specific primary antibodies. After three washes with TBST, the membrane was incubated with secondary antibody. Protein bands were visualized using ECL chromogenic solution and statistically quantified using ImageJ software. As shown in FIG. 1, the expression level of TRAP1 protein in aged smooth muscle cells was significantly increased after Ras stimulation (FIG. 1).

To further verify whether TRAP1 is involved in smooth muscle cell senescence, leading to atherosclerosis, we constructed siTRAP1 smooth muscle cells and examined the expression of senescence markers by Western Blot.

Transfection of small interfering RNA (siRNA) into human smooth muscle cells: the solutions A and B were prepared according to the transfection system (A: ECM 125. Mu.L+siRNA 6.25. Mu. L B: ECM 125. Mu.L+lipo 30003. Mu.L), and after mixing, they were allowed to stand at room temperature for 5min. Mixing the solution A and the solution B, standing at room temperature for 15-20min, adding into a dish, and uniformly distributing. Finally, placing the cells into a 37 ℃ compress box, and replacing a new preheating culture medium for 4-6 hours.

In the invention, siRNA is designed according to TRAP1 gene sequence, and the sequence of the siRNA is:

the sense strand is 5 '. Fwdarw.3' GCUGCUGCUGGUGGUCAGAUA, and is shown as SEQ ID No. 3;

the antisense strand is 3 '. Fwdarw.5' UAUCUGAUCCACCACCAGCAGCUG, and is shown in SEQ ID No. 4.

As shown in FIG. 2, the increase in the senescence marker due to Ras induction was reversed after TRAP1 deletion, compared with senescence smooth muscle cells. Meanwhile, a beta-galactosyltransferase staining experiment (beta-Gal staining experiment) was performed.

Beta-Gal staining experiment: the cells were seeded in a six-well plate, attached, and then the cell culture solution was aspirated, washed 3 times with PBS, and 1mL of a staining fixative solution was added and fixed at room temperature for 15min. The fixative was aspirated and the cells were washed 3 times with PBS for 3min each. The PBS was removed by pipetting, 1mL SA- β -gal staining solution was added to each well, and incubated overnight at 37 ℃. The next day, the staining solution was discarded, washed with PBS, and the detection solution was added and observed under a normal optical microscope.

As shown in FIG. 3, the cells were significantly decreased in staining positive cells induced by Ras after TRAP1 deletion, as compared with aged smooth muscle cells. To further confirm that TRAP1 can regulate smooth muscle aging and cause atherosclerosis, SASP expression was analyzed using RT-qPCR.

RT-qPCR analysis SASP: cellular RNA extraction Total RNA was extracted as described in Trizol kit.

(1) Taking out the cells, sucking and discarding the culture solution, washing 1 time with 1 XPBS, adding 1mLTrizol, standing for a while, and blowing the cells by using a liquid-transferring gun to completely fall off;

(2) Repeatedly blowing and sucking the lysate by a pipetting gun until no obvious precipitate exists, transferring the lysate to a marked 1.5mL EP tube, and standing for 5min at room temperature;

(3) Adding 0.2mL of chloroform into each EP tube, reversing, mixing uniformly, and placing on ice for cracking for 10min;

(4) Centrifuging at 12000rpm at 4deg.C for 15min;

(5) Transferring the supernatant to a new EP pipe, adding equal volume of isopropanol into each pipe, mixing the mixture upside down, and placing the mixture on ice for 10min;

(6) Centrifuging at 12000rpm at 4deg.C for 15min to form colloidal precipitate at the side and bottom of the tube, discarding supernatant, and adding 1mL 75% ethanol to blow-suspend the precipitate;

(7) Centrifuging at 12000rpm at 4deg.C for 15min, removing supernatant, air drying at room temperature for 5min, adding 20 μl DEPC water to dissolve RNA, measuring RNA concentration by NanoDrop, and placing in a refrigerator at-80deg.C for use;

(8) Reverse transcription was performed using II 1st Strand cDNA Synthesis Kit, the total reaction volume was 20. Mu.L, and the specific composition was as follows:

RNase free ddH₂O To 20μL

Total RNA 1μg

ⅡBufferplus 4μL

(9) After mixing evenly, reverse transcription is carried out by a PCR instrument:

25℃ 5min

42℃ 30min

85℃ 5min

(10) After the end of reverse transcription, the cDNA was added to 80. Mu. LDEPC water at a ratio of 1:4, diluting in proportion, and storing at-20 ℃ for standby.

(11) The target gene is relatively quantitatively detected by qPCR SYBR GREEN MASTER Mix, and the PCR reaction system is as follows:

(16) Grouping, calculating a system (finally adding cDNA);

(17) Sealing the membrane, centrifuging the 384-hole plate, and then placing the membrane into a fluorescent quantitative PCR instrument;

(18) The reaction was performed on a Bio-Rad 480 type I quantitative PCR instrument.

The primer sequences were as follows:

IL-6Forward:CTCCAGAACAGATTTGAGAG；

Reverse:GGGTCAGGGGTGGTTATTGC；

IL-8Forward:CTGAGGTGCCAGTGCATTAG；

Reverse:AGCACACCTCTCTTCCATCC；

IL-1βForward:TTGCCAGCCAGTGACACAAT；

Reverse:GAGAAGGTGGTTGTCTGGGAAT；

ICAM-1Forward:AGGTTGAACCCCACAGTCAC；

Reverse:TCTGAGACCTCTGGCTTCGT；

CCL2 Forward:GATCTCAGTGCAGAGGCTCG；

Reverse:TCTGGGGAAAGCTAGGGGAA；

TNF-αForward:TAACAAGCCGGTAGCCCACG；

Reverse:TCTTGATGGCAGACAGGATG。

As shown in FIG. 4, SASP expression was significantly reduced after TRAP1 depletion compared to aged smooth muscle cells.

Example 2 mouse model test

To further verify the effect of TRAP1 on atherosclerosis in vivo, this example constructed smooth muscle-specific TRAP1 knockout mice by hybridizing male TRAP1 ^flox/flox mice to the Tagln promoter-driven Cre recombinase system (Tagln-Cre), smooth muscle cell-specific TRAP1 deficient mice in the context of Apoe ^KO (Apoe ^KOTrap1^SMCKO).Apoe^KOTrap1^WT mice as control animals).

Atherosclerosis was modeled and 8 week old mice were fed normal diet (NC) or High Fat Diet (HFD) for 16 weeks. Meanwhile, the aortic blood vessels of the mice were harvested and plaque size was detected by oil red O staining.

Aortic root vascular oil red O staining:

(1) After aortic tree separation, the aortic tree was placed in a clean six-well plate and fixed with 4% paraformaldehyde.

(2) The aorta fixed by paraformaldehyde is taken by micro forceps and put into a new six-hole plate, and rinsed by three distilled water for about 10 min.

(3) Three distilled water in the six-hole plate was sucked off by a pipette, 60% isopropyl alcohol solution was added, and the mixture was treated for 2 minutes.

(4) The isopropanol in the six-hole plate is sucked by a pipetting gun, the oil red O dye liquor filtered in advance is added, and the mixture is placed on a horizontal shaking table for dyeing for 1h.

(5) The oil red O dye solution in the six-hole plate is sucked by a pipette, and is rinsed for 1min by adding 60% isopropanol solution, and the steps are repeated for 3 times until the vascular background is not red.

(6) Residual vessel outer wall fat was carefully removed under a microscope with micro-scissors.

(7) And finally, tiling the dyed aortic tree on a black dissecting wax plate, and photographing.

The test results are shown in fig. 5, and the plaque area of Apoe ^KOTrap1^SMCKO mice is significantly reduced relative to that of Apoe ^KOTrap1^WT mice fed with high fat.

Further vascular immunofluorescence was performed, after 16 weeks of high fat feeding, the aortic tissue of the different groups of mice was extracted and frozen section embedding medium (optimal cutting temperature compound, OCT) was used, and after frozen section, immunofluorescence was performed to detect the expression of P21 and α -SMA as shown in fig. 6, wherein red represents P21, green represents α -SMA, and white arrows indicate red and green co-localized yellow regions. It can be seen that P21 expression in vascular smooth muscle cells was significantly increased following HFD administration by Apoe ^KO, and co-localization of P21 with α -SMA was yellow; whereas Apoe ^KOTrap1^SMCKO mice given HFD, vascular smooth muscle P21 expression decreased while co-localization of P21 with α -SMA decreased significantly in yellow. Meanwhile, vascular smooth muscle cell proteins of different groups of mice are extracted, and senescence markers such as P16, P21, P53 and the like are detected by using Western Blot.

Extraction of mouse aortic vascular smooth muscle cells:

(1) 2mL of 10% chloral hydrate is injected into the abdominal cavity to anesthetize the mice, and the mice are soaked in 75% ethanol;

(2) Opening the chest and abdominal cavity under aseptic conditions, exposing the heart;

(3) The pleuroperitoneal cavity organs were sequentially cut until the aorta was exposed, the aorta was completely separated, placed in a 35mm sterile dish, 1mL of sterile PBS was added, and rapidly transferred to a super clean bench.

(4) The residual blood was removed by repeated rinsing with D-Hanks' solution, and the adipose tissue outside the aorta was carefully removed with forceps, and the adventitia was carefully removed until the blood vessel was smooth and transparent.

(5) The aorta was placed in DMEM solution (containing 4.5g/L glucose, 10mmol/L pyruvic acid, 2mmol/L glutamine, 100U/L penicillin and streptomycin, 20% fetal bovine serum), the aorta was cut off with an ophthalmic scissors, and the intima was gently scraped 2-3 times with a blade to remove the intima.

(6) The dissected vessel was transferred to another 35mm sterile plate containing 3mL of 20% FBSDMEM/F12 medium, and minced with ophthalmic scissors, with fragments of about 1mm by 1mm in size.

(7) Uniformly planting the tissue blocks on the bottom of a culture bottle, lightly turning the culture bottle to enable the bottle bottom to face upwards, and adding 2mL of fresh DMEM/F12 culture medium containing 20% FBS;

(8) Placing the mixture in a 37 ℃ and 5% CO ₂ cell incubator for standing for 4-5 hours to dry the small blocks, and after the tissue blocks are firmly attached to the bottom of a cell bottle, lightly turning over the culture bottle to enable the tissue blocks to be completely immersed in the culture solution.

(9) Placing into a 37 ℃ incubator containing 5% CO ₂, standing for 3d, and changing the liquid after observation.

(10) After the cells grow to be full of 80% of the bottom area of the culture flask, digesting and passaging by 0.25% of pancreatin, absorbing supernatant after passaging for 2 hours, inoculating the supernatant into another culture flask, collecting non-adherent cell suspension according to the cell adherence condition after 24 hours, centrifuging for 5 minutes, inoculating the suspension into a new culture flask after resuspension, and purifying the cells by a repeated differential adherence method.

Markers of P16, P21, P53 senescence were detected by Western Blot. The results of the assay are shown in figure 7, where aged smooth muscle cells were significantly reduced in Apoe ^KOTrap1^SMCKO mice relative to high fat fed Apoe ^KOTrap1^WT mice.

Further RT-qPCR experiments were performed to detect SASP gene levels. The results of the assay are shown in FIG. 8, where SASP is significantly reduced in smooth muscle cells in Apoe ^KOTrap1^SMCKO mice relative to high fat fed Apoe ^KOTrap1^WT mice.

As can be seen from the above examples: in the atherosclerosis patients caused by aging and atherosclerosis related cells and animal models, TRAP1 is inhibited or knocked out, so that the cell aging can be inhibited, and the atherosclerosis progress can be delayed. Therefore, substances inhibiting or knocking out TRAP1 can be used for preparing medicaments for treating cardiovascular diseases caused by cell aging, in particular medicaments for treating atherosclerosis caused by aging.

The above examples are provided for illustrating the technical concept and features of the present invention and are intended to enable those skilled in the art to understand the contents of the present invention and to implement the same, and are not intended to limit the scope of the present invention. All equivalent changes or modifications made according to the spirit of the present invention should be included in the scope of the present invention.

Claims (9)

1. Application of TRAP1 in preparing auxiliary diagnostic reagent for cardiovascular diseases.
2. Application of TRAP1 as target in screening or auxiliary screening of cardiovascular disease preventing and treating medicine.
3. Application of TRAP1 as target in preparing medicine for preventing and treating cardiovascular diseases.
4. 4. Use of substances for knocking down or inhibiting TRAP1 in the preparation of medicines for preventing and treating cardiovascular diseases is provided.
5. 5. Use of substances knockdown or inhibition of TRAP1 in screening or assisted screening of drugs for the prevention and treatment of cardiovascular diseases.
6. 6. The use according to claim 4 or 5, wherein the TRAP1 inhibitor comprises a small interfering RNA that knocks down TRAP1 expression, a gene editing system that specifically knocks down TRAP1, or other small molecule compounds capable of specifically inhibiting TRAP 1.
7. 7. The use according to claim 6, wherein the small interfering RNA sequence knocked down by TRAP1 is shown in SEQ ID NO. 2-3.
8. 8. The use according to any one of claims 1 to 7, wherein the cardiovascular disease is a cardiovascular disease drug caused by aging.
9. 9. The use according to claim 8, wherein the cardiovascular disease caused by aging is atherosclerosis.