CN117887691B

CN117887691B - Hyaluronidase fusion protein, yeast engineering bacteria, construction method and application

Info

Publication number: CN117887691B
Application number: CN202311831261.3A
Authority: CN
Inventors: 康传利; 赵玉雪; 刘洋; 廉少杰; 李海军; 王春喜; 刘磊; 郑德强; 贾庆文; 刘玉杰; 刘静; 李倩倩
Original assignee: Shandong Focus Furida Biological Co ltd; Shandong Freda Pharmaceutical Group Co ltd
Current assignee: Shandong Focus Furida Biological Co ltd; Shandong Freda Pharmaceutical Group Co ltd
Priority date: 2023-12-27
Filing date: 2023-12-27
Publication date: 2024-07-12
Anticipated expiration: 2043-12-27
Also published as: CN117887691A

Abstract

The invention provides a hyaluronidase fusion protein, yeast engineering bacteria, a construction method and application thereof, belongs to the technical field of genetic engineering, and particularly relates to the hyaluronidase fusion protein, wherein the amino acid sequence of the hyaluronidase fusion protein is shown as SEQ ID NO. 1; a yeast engineering bacterium is characterized in that a coding gene of a hyaluronidase fusion protein is introduced into the yeast, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 5; the inventor recombining the coding gene sequence of the fusion protease into the genome of the pichia pastoris to obtain the pichia pastoris engineering bacteria, and the inventor discovers that the pichia pastoris engineering bacteria not only can effectively express the fusion protein, but also has higher enzyme activity and two enzyme activities.

Description

Hyaluronidase fusion protein, yeast engineering bacteria, construction method and application

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a hyaluronidase fusion protein, yeast engineering bacteria, a construction method and application.

Background

Hyaluronic Acid (HA) is also called hyaluronic acid, is a glycosaminoglycan naturally existing in organisms, is formed by alternately connecting D-glucuronic acid and N-acetamido glucose as repeated disaccharide units through beta (1-3) and beta (1-4) glycosidic bonds. Hyaluronidase is an enzyme capable of degrading hyaluronic acid, and can be used for efficiently preparing low-molecular-weight hyaluronic acid oligosaccharide. In the aspect of market application, the hyaluronidase can be widely applied to various medical fields such as cosmetology, medical instruments, preparations, bulk drugs and the like.

The hyaluronidase sold in the market at present is obtained by extracting from animal testis by an extraction method, although a hyaluronidase extraction preparation process suitable for molding in the medicine field is established and hyaluronidase protein with enzyme activity is obtained, the protein yield of the hyaluronidase of the process is lower, a large amount of organic chemical reagents are used in extraction, the production cost is higher, the process cost for obtaining the hyaluronidase is higher, the operation is complicated, and the risk of cross infection of animal viruses is possible in application.

Research on preparing hyaluronidase by biological means at home and abroad has a certain effect, research on preparing hyaluronidase by bacillus subtilis and escherichia coli has been reported, chinese patent CN200810134513.6 utilizes escherichia coli to express and obtain hyaluronidase protein with enzymatic activity, but an expression product is positioned in a bacterium body, so that a separation and purification process is complex, the yield is influenced, and the cost and pollution risk are increased; chinese patent CN201410555212.6 utilizes bacillus subtilis to prepare hyaluronidase, but the copy number of bacillus subtilis expression is usually small, compared with yeast, the expression quantity is lower, and the defects of difficult transformation, complex genetic operation and the like are caused.

The industrial production demand is still very huge for hyaluronidase, so that the industrial prospect of the hyaluronidase is realized, the market has higher expectations for the enzyme activity of the hyaluronidase, the hyaluronidase fermented by the fermentation tank in high density has certain price and purity advantages, and the yeast has higher acceptance in multiple fields of medicine, cosmetology, food and the like and is more accepted by consumers.

In the traditional process for expressing hyaluronidase by pichia pastoris, the hyaluronidase can be expressed under the strict induction of methanol, however, certain hidden trouble exists in the amplifying process of factories: methanol is poisonous and flammable, and an explosion-proof workshop is needed; the more methanol is consumed, the more heat is generated, and the higher the cooling capacity requirement of the required equipment is; methanol is used as a petrochemical product, is not suitable for the production of additives in some food fields, and the production cost of methanol is increased along with the explosion of petroleum crisis; h ₂O₂ produced by methanol metabolism also has a certain influence on fermentation. Chinese patent documents CN201310597818.1 and CN202110245290.6 use methanol as inducer.

The biological function and the specific application of the hyaluronic acid depend on the molecular mass, the high molecular hyaluronic acid has stable structure and the advantages of strong water locking property, high viscosity, weak fluidity and the like, and the low molecular hyaluronic acid can keep joint lubrication, keep moisture for a long time and has obvious curative effect in the treatment of osteoarthritis; the small molecule hyaluronic acid can permeate into dermis and dilate capillary, and has wide application in the cosmetic field. The hyaluronic acid oligosaccharide has unique biological activity functions, such as the functions of stimulating fibroblast proliferation, collagen synthesis, selectively killing cancer cells and the like, has important application prospects in the fields of food health care and medicine, and has the advantages of mild reaction, no toxicity, no harm, good repeatability and the like compared with a physical method and a chemical method for preparing the oligomeric hyaluronic acid with different polymerization degrees by using a method of hydrolyzing hyaluronidase. In the market, the application of enzyme preparation of hyaluronic acid oligosaccharide by hyaluronidase is mainly to break one of beta (1-3) or beta (1-4) glycosidic bonds, and most of the produced hydrolysis products are even oligosaccharides, such as hexasaccharide, octasaccharide and the like, for example, chinese patent application CN103484513A and application number 202110937316.3. At present, there is no successful case in which an enzyme is used for the preparation of an odd number of hyaluronic acid oligosaccharides.

Further, in the prior art, when hydrolyzing hyaluronic acid from beta (1-3) and beta (1-4) sites, two enzyme solutions are added in two steps, and one enzyme solution is hydrolase and the other enzyme solution is lyase prepared by an extraction method, and the disadvantage of the method is that if the two enzyme solutions are to be prepared, two preparation steps are needed: the beta (1-3) hydrolase is fermented once, and the beta (1-4) hydrolase is extracted once again, so that the process is complicated, and if the beta (1-4) hydrolase is directly purchased, the beta (1-3) hydrolase is expensive and is not suitable for large-scale application in factories.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a hyaluronidase fusion protein, a yeast engineering bacterium, a construction method and application.

A hyaluronidase fusion protein has an amino acid sequence shown in SEQ ID NO. 1.

The nucleotide sequence of the coding gene of the hyaluronidase fusion protein is shown as SEQ ID NO. 5.

A yeast engineering bacterium is obtained by introducing a coding gene of a hyaluronidase fusion protein into a yeast, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO. 5.

Preferably, the yeast is pichia pastoris.

Pichia pastoris HAase (an) -His-9K-GS115 is preserved in China center for type culture Collection, with a preservation address of China, university of Wuhan, and a preservation number of CCTCC NO: m20231485, storage date 2023, month 08 and 15.

The construction method of the yeast engineering bacteria comprises the following steps:

(1) Inserting the coding gene sequence SEQ ID NO.5 of the hyaluronidase fusion protein between EcoRI and NotI cleavage sites in the pPIC9K vector by means of homologous recombination to obtain a recombinant plasmid pPIC9K-HAase-Fus;

(2) Inserting the coding gene sequence SEQ ID NO.5 of the hyaluronidase fusion protein into the pGAPZ alpha A vector by means of homologous recombination to obtain recombinant plasmid pGAPZ alpha A-HAase-Fus;

(3) Linearizing the recombinant plasmid pPIC9K-HAase-Fus obtained in the step (1) by using restriction endonuclease SalI to obtain linearization fragments, transforming the linearization fragments into pichia pastoris competent cells, and screening engineering bacteria P.pastoris/pPIC9K-HAase-Fus for obtaining recombinant hyaluronidase fusion protein genes;

(4) Linearizing the recombinant plasmid pGAPZ alpha A-HAase-Fus obtained in the step (2) by using restriction endonuclease AvrII to obtain linearization fragments, transforming the linearization fragments into competent cells of engineering bacteria P.pastoris/pPIC9K-HAase-Fus obtained in the step (3), and screening the engineering bacteria P.pastoris/pPIC9K-HAase-Fus/pGAPZ alpha A-HAase-Fus for obtaining recombinant hyaluronidase fusion egg genes.

According to a preferred embodiment of the invention, in step (3), the pichia pastoris is pichia pastoris GS115.

According to a preferred embodiment of the present invention, in step (3), after culturing in MD medium, the selection is performed in a medium containing geneticin G418.

According to a preferred embodiment of the present invention, in step (4), the selection is performed using a bleomycin-containing medium.

The application of the yeast engineering bacteria and Pichia pastoris HAase (an) -His-9K-GS115 in preparing hyaluronidase fusion protein is shown in SEQ ID NO. 1.

The application of the yeast engineering bacteria Pichia pastoris HAase (an) -His-9K-GS115 in degrading hyaluronic acid.

The application of the yeast engineering bacteria Pichia pastoris HAase (an) -His-9K-GS115 in the production of odd-numbered hyaluronic acid oligosaccharides.

According to a preferred embodiment of the present invention, the odd numbered hyaluronan oligosaccharides include trisaccharides, pentasaccharides, heptasaccharides, and nonasaccharides.

The beneficial effects of the invention are as follows:

1. the invention fuses the leech hyaluronidase and the mountain big-leaf ant hyaluronidase for the first time to form a new enzyme, namely fusion protease, the inventor recombines the coding gene sequence of the fusion protease into the genome of pichia pastoris to obtain pichia pastoris engineering bacteria, and the inventor discovers that the pichia pastoris engineering bacteria not only can effectively express the fusion protein, but also has higher enzyme activity, has the activity of two enzymes, can hydrolyze from beta (1-3) and beta (1-4) sites simultaneously, and can effectively degrade hyaluronic acid to produce odd-numbered hyaluronic acid oligosaccharides including trisaccharide, pentasaccharide, heptasaccharide, nonasaccharide and the like.

2. The invention also constructs a Pichia pastoris engineering strain for high-yield hyaluronidase fusion protein, further improves the enzyme activity of the fusion protein, reaches 153386U/mL in the shaking bottle stage, reaches 1243462.72U/mL after high-density fermentation in a fermentation tank, and simultaneously, the recombinant strain for high-yield hyaluronidase fusion protein can be induced by methanol or glycerol, and can select different inducers for fermentation in industrial production; the glycerol induction mode can greatly improve the safety in actual operation and reduce the harm to the environment.

3. The inventor also discovers that the growth speed of the pichia pastoris engineering bacteria is almost the same as that of the pichia pastoris control bacteria, namely, the coding gene sequence of the fusion protease is recombined into the genome of the pichia pastoris for expression, and the growth of the pichia pastoris is not affected.

4. The constructed hyaluronidase fusion protein can provide a new strategy for preparing low-molecular hyaluronic acid in vitro, realizes the strategy of secreting and expressing hyaluronidase by using a pichia pastoris recombinant transformant, lays a foundation for industrial production of recombinant hyaluronidase, can be used for mass production of the hyaluronidase protein with good hydrophilicity, complete structure and excellent functions, and is used as a raw material of products such as cosmetics, medical cosmetology and the like; the odd-numbered hyaluronic acid oligosaccharides prepared by the method not only enrich the diversity of oligosaccharide structures, but also have great significance for developing the relationship between the hyaluronic acid oligosaccharides with different structure types and diseases, and the like.

Drawings

FIG. 1 is a diagram showing the result of PCR amplification of pPIC 9K-HAase-Fus;

In the figure: DNA markers with M of 5000 bp; 1 is the result of PCR assay using vector universal primers.

FIG. 2 is a graph showing the results of 4g/L geneticin screening.

FIG. 3 is a diagram of polyacrylamide gel protein electrophoresis of fermentation supernatant;

in the figure: m is a 250kDa protein molecular weight marker; 1 is shake flask induction for 48h supernatant; 2 is shake flask induction 96h supernatant.

FIG. 4 is an electrophoresis diagram of polyacrylamide gel proteins after purification;

In the figure: m is a 250kDa protein molecular weight marker; 1 is the purified fusion protein.

FIG. 5 is a graph showing the results of enzyme activity detection of the hyaluronidase fusion protein of P.pastoris/pPIC9K-HAase-Fus yeast in a 3L fermenter fermentation.

FIG. 6 is a graph showing the results of 1g/L bleomycin screening.

FIG. 7 is a polyacrylamide gel protein electrophoresis;

In the figure: m is a 250kDa protein molecular weight marker;

1 is a blank GS115 fermentation supernatant;

2 is fermentation supernatant of recombinant hyaluronidase fusion protein P.pastoris GS115/pPIC9K-HAase-Fus induced by a methanol method;

3 is a fermentation supernatant of the recombinant hyaluronidase fusion protein P.pastoris GS115/pPIC 9K-HAase-Fus/pGAPZalpha A-HAase-Fus induced by a methanol method;

4 is the fermentation supernatant of the recombinant hyaluronidase fusion protein P.pastoris GS115/pPIC 9K-HAase-Fus/pGAPZalpha A-HAase-Fus induced by the glycerol method.

FIG. 8 is a graph showing the results of enzyme activity detection of a fermentation hyaluronidase in a 3L fermenter of a yeast of methanol-induced P.pastoris GS115/pPIC9K-HAase-Fus/pGAPZαA-HAase-Fus.

FIG. 9 is a graph showing the results of enzyme activity detection of a hyaluronidase fusion protein 3L fermenter fermented by a yeast of the glycerol-induced P.pastoris GS115/pPIC9K-HAase-Fus/pGAPZαA-HAase-Fus.

FIG. 10 is a diagram of oligosaccharide detection by LC-MS;

The mass to charge ratio 558.2059 in the figure is the [ M-H ] ^- peak of the hyaluronan trisaccharide C ₁₉H₂₉NO₁₈.

FIG. 11 is a diagram of oligosaccharide detection by LC-MS;

The mass to charge ratio 937.6176 in the figure is the [ M-H ] ^- peak of hyaluronan pentasaccharide C ₃₃H₅₁N₃O₂₈.

FIG. 12 is a diagram of oligosaccharide detection by LC-MS;

The mass to charge ratio 1302.4556 in the figure is the [ M-H ] ^- peak of hyaluronan heptasaccharide C ₄₆H₇₀N₄O₃₉.

FIG. 13 is a diagram of oligosaccharide detection by LC-MS;

The mass to charge ratio 1667.1687 in the figure is the [ M-H ] ^- peak of hyaluronan nonasaccharide C ₅₉H₈₉N₅O₅₀.

Detailed Description

The technical scheme of the present invention is further described below with reference to examples, but the scope of the present invention is not limited thereto.

The details of the examples, which are not described in detail, are all in accordance with conventional techniques in the art; the experimental materials and reagents which are not described in detail are all common commercial products.

Pichia pastoris GS115 is sold by Shanghai ze Biotechnology Co., ltd, and is a common commercial product.

YDP medium: yeast extract 10g/L, peptone 20g/L, glucose 20g/L, and water in balance.

Initial expression medium BMGY: 10g/L of yeast extract, 20g/L of peptone, K ₂HPO₄ 3g/L,KH₂PO₄, 11.8g/L of yeast nitrogen source YNB without amino acid, 3.4g/L of ammonium sulfate, 10g/L of biotin 4X 10 ^-4 g/L, 10g/L of glycerin and the balance of water.

Induction of expression medium BMMY: yeast extract 10g/L, peptone 20g/L, K ₂HPO₄ 3g/L,KH₂PO₄ 11.8.8 g/L, YNB 3.4g/L, ammonium sulfate 10g/L, biotin 4X 10 ^-4 g/L, methanol 10mL/L, and the balance water.

BMGY medium: yeast extract 10g/L, peptone 20g/L, K ₂HPO₄ 3g/L,KH₂PO₄ 11.8.8 g/L, YNB 3.4g/L, ammonium sulfate 10g/L, biotin 4X 10 ⁴ g/L, glycerin 40g/L, and the balance water.

BSM medium: glycerol 40g/L,K2SO₄ 18g/L,KOH 4.13g/L,85％H3PO4 26.7mL/L,CaSO₄·2H₂ O 0.93g/L,MgSO₄·7H₂O 14.9g/L,4.4mL/L filters the sterilized PTM1, the balance water.

PTM1 formulation ：CuSO₄·5H₂O 6g/L,KI 0.09g/L,MnSO4·H₂O 3g/L,H₃BO₃ 0.02g/L,MoNa₂O₄·2H₂O 0.2g/L,CoCl₂·6H₂O 0.92g/L,ZnCl₂ 20g/L,FeSO₄·7H₂O 65g/L, biotin 0.2g/L, H ₂SO₄ 5.0mL/L, balance water.

Example 1

Recombinant fusion protein and encoding gene thereof

1. Recombinant fusion protein molecular design

The NCBI website is utilized to obtain an amino acid sequence 1 of leech hyaluronidase (GenBank: KJ 026763) and an amino acid sequence 2 of mountain big-tooth soldier ant hyaluronidase (GenBank: FX 985505.1), the respective signal peptide regions are respectively analyzed, the signal peptide-free part is selected, the sequence of the CDS coding region is connected with two gene sequences by using an amino acid sequence (GGGGS) ₃ flexible signal peptide, and the two gene sequences are spliced into a brand new hyaluronidase sequence containing 836 amino acids of an initiation codon.

2. Theoretical Properties of recombinant hyaluronidase fusion proteins

The molecular weight of the recombinant hyaluronidase fusion protein is 94.84kDa, and the isoelectric point is 8.56; the amino acid sequence of the recombinant hyaluronidase fusion protein is shown as SEQ ID NO. 1:

Example 2

Construction of fusion protein expression System

The flexible linker sequence is shown as SEQ ID NO. 2:

GGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCT ligates the two genes.

Designing a linker insert primer, and inserting the primer designed for SEQ ID NO.2 into two sections of genes for connection:

the forward primer is shown in SEQ ID NO. 3:

primer F1: ACGTCGAAGCCTGTAAGAAGGGTGGTGGTGGTTCTGGTGG A

The reverse primer is shown in SEQ ID NO. 4:

Primer R1: TGTGGAGAAGAACCTCTCAAAGTCTTAGAACCACCACCACCAGA A

The designed total gene sequence is shown as SEQ ID NO. 5.

According to the affinity of pichia pastoris, the nucleotide sequence of the recombinant fusion protein is obtained after codon optimization, the nucleotide sequence of the recombinant fusion protein is shown as SEQ ID NO.5, the nucleotide sequence of the recombinant fusion protein is entrusted to large gene company for complete gene synthesis, a Noruweizan seamless cloning kit (ClonExpress II One Step Cloning Kit) is adopted for homologous recombination, ecoRI and NotI are selected as enzyme cleavage sites to clone into a pichia pastoris expression vector pPIC9K, and then the recombinant fusion protein is transformed into E.coil DH5 alpha, and plasmid extraction is carried out. The recombinant expression vector pPIC9K-HAase-Fus (FUS refers to fusion and HAase refers to hyaluronidase) is obtained, and the construction of the target plasmid is successful through PCR verification and DNA sequencing comparison, as shown in figure 1.

The reaction system is as follows:

PCR reaction system: 1. Mu.L (about 20 ng) of recombinant fusion protein DNA template; PRIMESTAR MAX PREMIX (2X) 10. Mu.L; primer F2 (10. Mu.M) 1. Mu.L; primer R2: (10. Mu.M) 1. Mu.L; ddH ₂ O was added to 50. Mu.L.

Primer F2:5'-GCTGAAGCTTACGTAGAATTCATGAAGGAAATCGCTGTCACTATTG-3' seq ID No.6;

Primer R2:5'-AAGGCGAATTAATTCGCGGCCGCTTAATGCAAGGTAAACTTCTTAATAGCTG-3' SEQ ID No.7.

PCR reaction procedure: 98 ℃ for 3min;98 ℃ for 10s,55 ℃ for 10s,72 ℃ for 40s,38 cycles; 72 ℃ for 5min; preserving at 4 ℃; the target gene was obtained by this procedure.

Homologous recombination system: 2. Mu.L (about 100 ng) of gene; 2. Mu.L of carrier (about 160 ng); 5 XCE II Buffer 4. Mu.L, exnase II. Mu.L; ddH ₂ O was added to 20. Mu.L; reaction conditions: 30min at 37 ℃.

The recombinant plasmid pPIC9K-HAase-Fus is linearized by selecting a restriction endonuclease SalI, the product is purified and then transformed into the prepared P.pastoris GS115 expression host competent cells by an electrotransformation method, and the cells are coated on a histidine-deficient MD plate to screen positive transformants. Single colonies grown in histidine-deficient MD plates were picked to YPD plates containing 4mg/mL geneticin G418, and P.pastoris/pPIC9K-HAase-Fus strain was screened for high copy number recombinant hyaluronidase fusion protein genes using YPD plates containing 4mg/mL geneticin G418, see FIG. 2.

Example 3

Shake flask fermentation of p.pastoris/pPIC9K-HAase-Fus strain of recombinant hyaluronidase fusion protein gene

The shaking flask fermentation steps are as follows: the P.pastoris/pPIC9K-HAase-Fus strain was selected and inoculated into 50mL of YPD medium and cultured at 30℃and 200rpm for 24 hours to prepare a seed solution. The seed solution was inoculated into 50mL of BMGY as an initial expression medium at an inoculum size of 10% by volume so as to enrich the cells, and cultured at 200rpm at 30℃for 24 hours.

The cells were collected by centrifugation, washed with sterile water, and then replaced with 40mL of the induction expression medium BMMY, and cultured at 30℃and 200rpm, and 1% by volume of methanol (containing 1.2% (v/v) PTM 1) was added to the fermentation flask every 24 hours until induction expression was performed for 96 hours.

The enzyme activity detection method comprises the following steps: 0.8mL of HA (hyaluronic acid, 120 wDa) solution was mixed with 0.1mL of supernatant and 0.1mL of PBS (pH=7), reacted in a water bath at 37℃for 15min, immediately boiled for 5min to stop the reaction, and immediately after cooling, absorbance at 540nm wavelength was measured. The enzyme activity of the recombinant hyaluronidase of shake flask fermentation was calculated to be 95352U/mL.

And (3) performing polyacrylamide gel detection: mixing the shake flask fermentation supernatant with 5×polyacrylamide gel electrophoresis protein loading buffer, and boiling at 100deg.C for 10min. Cooling at room temperature, respectively sampling 3 groups of samples and protein molecular weight markers, placing an electrophoresis tank on ice, carrying out 150V electrophoresis for 50min, placing gel into clear water to wash for 15min, then placing the gel into coomassie brilliant blue staining solution, and carrying out shaking staining for 15min at room temperature; the gel was put into clear water, shake-rolled at 50rpm at room temperature to decolorize, and the protein bands were clear the next day for analysis.

The molecular weight of the target protein detected by polyacrylamide gel has obvious protein generation at the predicted size 94.84kDa, and is shown in figure 3; after purifying the protein, polyacrylamide gel detection is carried out again, and the single band in FIG. 4 shows that the protein band generated at 94.84kDa is the target protein, and the recombinant strain is verified to be capable of inducing expression of hyaluronidase.

Example 4

High-density fermentation of recombinant hyaluronidase fusion protein gene P.pastoris/pPIC9K-HAase-Fus strain fermenter level

And (3) selecting a single colony of the saccharomycete of P.pastoris/pPIC9K-HAase-Fus from a flat plate to a 50mLYPD liquid culture medium, performing strain activation, culturing at 30 ℃ and 200rpm for 24 hours, performing microscopic examination after the liquid is turbid, and obtaining the first-stage seed liquid after the strain form is confirmed to be correct.

Transferring the first-level seed liquid into 100mL BMGY culture medium with the liquid loading amount of 30 ℃ and 200rpm according to the inoculation amount with the volume fraction of 10%, culturing for 24, and carrying out microscopic examination to obtain the second-level seed liquid after the strain morphology is confirmed without errors.

The secondary seed liquid is inoculated into a 3L fermentation tank according to the inoculation amount of 10 percent of volume fraction, 1L BSM culture medium is initially filled in the fermentation tank, the initial temperature of fermentation is controlled at 30 ℃, the pH is regulated to 5.5 by using ammonia water, the initial stirring speed is 500rpm, the ventilation amount is 2.0vvm, and the dissolved oxygen on the tank is controlled to be more than 20 percent by regulating the stirring speed and the ventilation amount.

When glycerol in the BSM culture medium is exhausted (detected by a biosensing analyzer) after fermentation for about 20 hours, glycerol containing 1.2% (v/v) PTM1 is fed in the fermentation medium to promote secondary growth of the bacterial cells, and the dissolved oxygen is maintained at 20% -30% by carrying out 12 hours of glycerol feeding through dissolved oxygen association. When dissolved oxygen quickly rises again, the biological sensing analyzer is used again for detection, starvation culture is carried out for 1 hour after fed-batch glycerol is exhausted, then methanol containing 1.2% (v/v) PTM1 is used for induction, the temperature is set at 22 ℃, the rotating speed is 1000r, 5mL/h of methanol is used as an induction starting point, the change of the dissolved oxygen is monitored, the methanol is related to the dissolved oxygen, the dissolved oxygen is maintained at 20% -30% by feeding the methanol, the fermentation is carried out for 120 hours, sampling is carried out every 12 hours for measuring the enzyme activity, and the enzyme activity reaches the maximum 741638.37U/mL at 96 hours, which is shown in figure 5.

Example 5

Construction of engineering yeast strain for high-yield recombinant hyaluronidase fusion protein gene

Homologous recombination is carried out on the coding gene sequence SEQ ID NO.5 of the hyaluronidase fusion protein by adopting a nuuzan seamless cloning kit (ClonExpress IIOne Step Cloning Kit), ecoRI and NotI are selected as enzyme cutting sites to clone into a pGAPZ alpha A vector, the vector is transformed into E.coil DH5 alpha, and after bacterial examination and sequencing verification, the constructed pGAPZ alpha A-HAase-Fus sequence is correct, the recombinant expression plasmid pGAPZ alpha A-HAase-Fus is obtained.

The reaction system is as follows:

PCR reaction system: 1. Mu.L (about 20 ng) of recombinant fusion protein DNA template; PRIMESTAR MAX PREMIX (2X) 10. Mu.L; primer F3 (10. Mu.M) 1. Mu.L; primer R3: (10. Mu.M) 1. Mu.L; ddH ₂ O was added to 50. Mu.L.

Primer F3:5'-AGAGAGGCTGAAGCTGAATTCATGAAGGAAATCGCTGTCACTATTG-3' seq ID No.8;

Primer R3:

5'-tgttctagaaagctggcggccgcTTAATGCAAGGTAAACTTCTTAATAGCTG-3'SEQ ID NO.9。

The recombinant plasmid pGAPZalpha A-HAase-Fus is linearized by restriction enzyme AvrII and then is transferred into competent cells of P.pastoris GS115/pPIC9K-HAase-Fus, and the recombinant transformant is screened by YPD plates of 1g/L bleomycin (as shown in figure 6) to obtain a combined strain P.pastoris GS115/pPIC 9K-HAase-Fus/pGAPZalpha A-HAase-Fus with high copy number of hyaluronidase fusion protein genes.

Pastoris GS115/pPIC9K-HAase-Fus/pGAPZαA-HAase-Fus, also known as Pichia pastoris HAase (an) -His-9K-GS115, was deposited in China center for type culture Collection, with a deposit number of CCTCC NO: m20231485, storage date 2023, month 08 and 15.

Example 6

Shake flask fermentation of engineered yeast strains producing recombinant hyaluronidase fusion protein genes at high yield

The high-yield strain P.pastoris GS115/pPIC9K-HAase-Fus/pGAPZαA-HAase-Fus obtained in example 5 was subjected to shake flask-level fermentation culture in the same manner as in example 3, and the enzyme activity was determined to be 153386U/mL by the DNS method (according to the enzyme activity detection method in example 3).

The protein band of this high-yield strain (lane 3) was compared with the protein band of the control strain P.pastoris GS115/pPIC9K-HAase-Fus (lane 2), the band size of lane 3 was significantly larger than lane 2, and the protein expression level of this high-yield strain was significantly higher than that of P.pastoris GS115/pPIC9K-HAase-Fus, see FIG. 7.

The pure glycerol shake flask fermentation steps are as follows: the single clone was picked up and inoculated into 50mL of YPD medium, and cultured at 30℃and 200rpm for 24 hours to prepare a seed solution. The seed solution was inoculated into 50mL of BMGY as an initial expression medium at an inoculum size of 10% by volume so as to enrich the cells, and cultured at 200rpm at 30℃for 96 hours.

The results of polyacrylamide gel protein electrophoresis of the fermentation supernatants of the pure glycerol culture combination strains are shown in FIG. 7. Lane 4 shows that there is a distinct protein band around the theoretical molecular weight 94.84kDa, indicating that the combined strain can produce hyaluronidase from methanol as a carbon source and glycerol as a carbon source.

Example 7

High density fermentation of engineering yeast strain fermenter level for high production of hyaluronidase fusion proteins

The high-yield strain P.pastoris GS115/pPIC9K-HAase-Fus/pGAPZαA-HAase-Fus obtained in example 5 was subjected to high-density fermentation using methanol as a carbon source in the manner of example 4. The fermentation result is shown in FIG. 8, and the enzyme activity is 1243462.72U/mL at 96 h.

High-density fermentation by taking glycerol as a carbon source: and (3) selecting single saccharomycete colony of P.pastoris GS115/pPIC9K-HAase-Fus/pGAPZ alpha A-HAase-Fus from a flat plate to a 50mLYPD liquid culture medium, performing strain activation, culturing at 30 ℃ and 200rpm for 24 hours, performing microscopic examination after the liquid is turbid, and obtaining the first-stage seed liquid after the strain form is confirmed to be correct.

Transferring the first-level seed liquid to 100mL BMGY with the liquid loading amount of 30 ℃ and 200rpm according to the inoculation amount with the volume fraction of 10%, culturing for 24, and carrying out microscopic examination to obtain the second-level seed liquid after the strain morphology is confirmed without errors.

The secondary seed liquid is inoculated into a 3L fermentation tank according to the inoculation amount of 10 percent of volume fraction, 1L BSM culture medium is initially filled in the fermentation tank, the initial temperature of fermentation is controlled at 30 ℃, the pH is regulated to 5.5 by using ammonia water, the initial stirring speed is 500rpm, the ventilation amount is 2.0vvm, and the dissolved oxygen on the tank is controlled to be more than 20 percent by regulating the stirring speed and the ventilation amount. The pH is controlled to be 5.5 by automatically adding ammonia water in the fermentation process; when the glycerol in the BSM medium is exhausted (detected by a biosensing analyzer), glycerol starts to be fed in, 70% (v/v) glycerol containing 1.2% (v/v) PTM1 is added, dissolved oxygen DO is controlled to be more than 20%, and fermentation is carried out for 120 hours. The results of the fermentation are shown in FIG. 9, and the enzyme activity was measured at 96h as 510254.34U/mL according to the enzyme activity detection method in example 3.

Example 8

Preparation and detection of hyaluronic acid odd-numbered oligosaccharides

Hyaluronic acid powder with molecular weight of 5-10 wDa is dissolved in deionized water at concentration of 40mg/mL and fully dissolved overnight. Adding a fusion protease solution (supernatant prepared by methanol induction in example 7) with a final concentration of 5000U/mL, and respectively standing at 37 ℃ for enzymolysis: performing enzymolysis for 12h to obtain a product trisaccharide; performing enzymolysis for 10h to obtain a product pentasaccharide; performing enzymolysis for 8 hours to obtain a product heptasaccharide; and (3) performing enzymolysis for 4 hours to obtain the product, namely the nine sugar. The solution after the reaction was quenched by boiling water at 100℃was filtered through a 0.22 μm filter.

Subjecting the product to liquid chromatography-mass spectrometry analysis, chromatographic conditions: using Q Exactive ^TM Plus combined quadrupole Orbitrap ^TM mass spectrometer, the Column was HYPERSIL GOLDTM VanquishTM C Column (1.9 μm, 2.1x100 mm) with 0.1% aqueous formic acid (a) -acetonitrile (B) as mobile phase, 0.3mL/min flow rate and 30 ℃ Column temperature. Mass spectrometry conditions: the method comprises the steps of adopting a double-jet electrospray ion source and adopting a negative ion mode to scan, taking high-purity nitrogen as atomized ionized gas, setting the temperature of dry gas to be 350 ℃, setting the flow rate to be 11L/min, setting the atomization gas pressure to be 45psi, setting the temperature and the flow rate of sheath gas to be the same as those of the dry gas, setting the capillary voltage to be 4kV, setting the fragment voltage to be 120V, setting the cone hole voltage to be 60V, and setting the radio frequency voltage peak value (Octopole RF peak) to be 750V. Before the instrument is used, the instrument is corrected by tuning liquid, and reference liquid is continuously added in the use process for quality calibration.

The results are shown in the following figures, in particular:

The [ M-H ] -peak of hyaluronan trisaccharide C ₁₉H₂₉NO₁₈ is at mass-to-charge ratio 558.2059 in FIG. 10;

the [ M-H ] -peak of hyaluronan pentasaccharide C ₃₃H₅₁N₃O₂₈ at mass to charge ratio 937.6176 in FIG. 11;

The [ M-H ] -peak of hyaluronan heptasaccharide C ₄₆H₇₀N₄O₃₉ at mass to charge ratio 1302.4556 in FIG. 12;

The mass to charge ratio 1667.1687 in FIG. 13 is the [ M-H ] -peak of hyaluronan nonasaccharide C ₅₉H₈₉N₅O₅₀.

The invention carries out fusion design on genes of the leech hyaluronidase and the mountain big-tooth ant hyaluronidase for the first time, forms a new enzyme, namely the hyaluronidase fusion protease, and the inventor discovers that the pichia pastoris engineering bacteria not only can effectively express the fusion protein, but also has higher enzyme activity, has the advantages of the two enzymes, can hydrolyze beta (1-3) and beta (1-4) sites of the hyaluronic acid at the same time, and can effectively degrade the hyaluronic acid to generate odd hyaluronic acid oligosaccharides including trisaccharide, pentasaccharide, heptasaccharide, nonasaccharide and the like.

The Pichia pastoris engineering bacteria for high-yield hyaluronidase fusion protein provided by the invention obviously improves the enzyme activity of the fusion protein, the shake flask stage reaches 153386U/mL, the enzyme activity reaches 1243462.72U/mL after high-density fermentation in a fermentation tank, and meanwhile, the recombinant strain for high-yield hyaluronidase fusion protein can be induced by methanol or glycerol, and different inducers can be selected for fermentation in industrial production; the glycerol induction mode can greatly improve the safety in actual operation and reduce the harm to the environment.

Claims

1. A hyaluronidase fusion protein has an amino acid sequence shown in SEQ ID NO. 1.

2. The coding gene of the hyaluronidase fusion protein of claim 1, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO. 5.

3. The yeast engineering bacterium is characterized in that a coding gene of a hyaluronidase fusion protein is introduced into the yeast engineering bacterium, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 5.

4. The yeast engineering bacterium of claim 3, wherein the yeast is pichia pastoris.

5. Pichia pastoris (Pichia pastoris) named Pichia pastoris HAase (an) -His-9K-GS115 is preserved in China center for type culture Collection with a preservation address of China, university of Wuhan, and a preservation number of CCTCC NO: m20231485, storage date 2023, month 08 and 15.

6. The method for constructing yeast engineering bacteria according to claim 3 or 4, comprising the following steps:

(1) The coding gene sequence SEQ ID NO5 of the hyaluronidase fusion protein is subjected to homologous recombination

Is inserted between EcoRI and NotI cleavage sites in the pPIC9K vector to obtain recombinant plasmid pPIC9K-HAase-Fus;

(2) The coding gene sequence SEQ ID NO.5 of the hyaluronidase fusion protein is subjected to homologous recombination

The means of (1) is inserted into pGAPZ alpha A vector to obtain recombinant plasmid pGAPZ alpha A-HAase-Fus;

(3) The recombinant plasmid pPIC9K obtained in step (1) was subjected to the restriction enzyme SalI

HAase-Fus are subjected to linearization treatment to obtain linearization fragments, and are transformed into pichia pastoris competent cells, and engineering bacteria P, pastoris/pPIC9K-HAase-Fus of recombinant hyaluronidase fusion egg genes are obtained through screening;

(4) The recombinant plasmid pGAPZalpha A-

HAase-Fus are subjected to linearization treatment to obtain linearization fragments, and the linearization fragments are transformed into competent cells of engineering bacteria P.pastoris/pPIC 9K-HAase-Fus obtained in the step (3), and engineering bacteria P.pastoris/pPIC 9K-HAase-Fus/pGAPZ alpha A-HAase-Fus for obtaining recombinant hyaluronidase fusion egg genes are screened.

7. The method of claim 6, wherein in step (3), the pichia pastoris is pichia pastoris GS115.

8. The method according to claim 6, wherein in the step (3), after culturing in the MD medium, the culture medium containing geneticin G418 is used for the selection.

9. The method according to claim 6, wherein in the step (4), the selection is performed using a bleomycin-containing medium.

10. Use of the yeast engineering bacterium of claim 3 or 4, the Pichia pastoris HAase (an) -His-9K-GS115 of claim 5, for the preparation of a hyaluronidase fusion protein having an amino acid sequence as shown in SEQ ID No. 1.

11. Use of the yeast engineering bacterium of claim 3 or 4, pichia pastoris HAase (an) -His-9K-GS115 of claim 5 for degrading hyaluronic acid.

12. Use of the yeast engineering bacterium of claim 3 or 4, pichia pastoris HAase (an) -His-9K-GS115 of claim 5 for the production of an odd numbered hyaluronic acid oligosaccharide;

the odd-numbered hyaluronic acid oligosaccharides are trisaccharides, pentasaccharides, heptasaccharides and nonasaccharides.