CN117887616A - Bacillus belicus strain, biocontrol product and application - Google Patents

Abstract

The application discloses bacillus beleiensis strain, biocontrol product and application. The bacillus belicus strain is classified and named as bacillus belicus (Bacillus velezensis) BV171, and the preservation number is CCTCC M20231173. The bacillus beleiensis BV171 provided by the application can effectively inhibit the hypha growth and spore germination of fusarium erythropolis, can be applied to the development of biocontrol products, and has good application prospects in preventing and controlling plant rot caused by fusarium erythropolis.

Description

Bacillus belicus strain, biocontrol product and application

Technical Field

The application relates to the technical field of biological control of plant diseases, in particular to a bacillus beijerinckii strain, a biological control product and application.

Background

The luffa is one of main vegetables in summer and autumn in China, is also a good health care product in vegetables, and is praised as a melon and fruit medicinal material by people. However, in recent years, as the cultivation area of the towel gourd grows year by year, the problem of diseases caused by the growth of the towel gourd is also widely paid attention to. The loofah is threatened by various diseases from seedling emergence to fruit maturation, the yield and quality of the loofah are seriously affected, and the great economic loss is directly caused. Fungal diseases mainly include downy mildew, powdery mildew, anthracnose, root rot, fusarium wilt and the like. Wherein the pathogenic bacteria of root rot are fusarium solani, and the fusarium wilt is caused by the dedicated infection of fusarium oxysporum towel gourd.

Fusarium spp, a fungus of the phylum Deuteromycotina, is a worldwide distribution fungus that infects multiple plants, causing multiple diseases such as spike rot, root rot, stem rot, flower rot, etc., over 100 host plants, infects host plant vascular bundle systems, and produces toxins in the growth, development and metabolism processes to harm crops, causing crop wilting and death, affecting yield and quality. Among them, fusarium graminearum (Fusarium graminearum) is the most typical fusarium graminearum, and is the main pathogenic bacteria responsible for wheat scab (Fusarium headblight, FHB) and other cereal crop diseases.

In recent years, fusarium erythropolis (fusarium erythropolium) has been gradually found to cause the occurrence of various plant diseases as a worldwide distribution of pathogenic fungi. In 2004, black spots appear in walnut orchards in Argentina, and the pathogenic bacteria are finally determined to be Fusarium rubrum through separation and identification, which is the first report of walnut canker caused by Fusarium rubrum by Argentina. In 2012, ramdial et al found that fusarium rubefaciens caused large area rot in the fruit of pimento in north america. In 2015, sweet jujube rot caused by Fusarium rubrum is first discovered in Xinjiang construction weapons in China. In 2022, the fruits and leaves of the luffa are found to have symptoms of yellowing and rot in luffa field of Ningbo academy of agricultural sciences, and the pathogenic bacteria are determined to be Fusarium rubrum through separation and identification. At present, the fusarium rubrum infects more than 20 diseases, such as cotton stalk rot, cabbage brown spot, melon rot, soybean root rot, cucumber fruit rot and the like. And the occurrence of different degrees in various areas of the world seriously damages the agricultural production, and causes serious loss to economy in various areas.

At present, chemical control of fusarium rubrum can adopt medicines such as carbendazim, pyraclostrobin, epoxiconazole and the like, but long-term use of medicines can influence the quality safety of towel gourd and pollute the environment and harm human health, so that for diseases caused by fusarium rubrum, efficient and green control technology needs to be developed, the yield and quality of crops are improved, meanwhile, the use of chemical pesticides can be reduced, the ecological environment is protected, and the sustainable development of agriculture is promoted.

Disclosure of Invention

In view of the problems in the prior art, the application provides a bacillus belicus strain, a biocontrol product and an application, wherein the bacillus belicus strain can effectively inhibit the growth of fusarium erythropolis hyphae and prevent the fusarium erythropolis from expanding on towel gourd leaves; the biocontrol product developed by utilizing bacillus belicus strain has good application prospect.

In the application, bacillus belgium strains are separated from soil samples of luffa lands in Dongqian lake in area of Ningbo city in Zhejiang province, and are classified and named as bacillus belgium (Bacillus velezensis) BV171, and are preserved in China Center for Type Culture Collection (CCTCC) for 7 months and 3 days in 2023, wherein the preservation number is as follows: cctccc M20231173.

After the bacillus beijerinckii BV171 is cultured for 48 hours on an LB culture medium at the constant temperature of 30 ℃, the colony surface is rough and opaque, is wrinkled and white, and has slight viscosity when the inoculating loop is light touched.

The application also provides application of the bacillus belicus strain in antagonizing fusarium erythropolis, and the bacillus belicus BV171 can effectively inhibit hypha growth and spore germination of the fusarium erythropolis, and has good antagonism.

The application also provides application of the bacillus beijerinus strain in preventing and treating plant rot. For example, control of plant rot caused by infection with Fusarium rubrum; also for example, can be applied to towel gourd, and can prevent and treat towel gourd rot caused by infection of fusarium rubrum. The towel gourd variety is, for example, green prince.

The application also provides application of the bacillus beijerinus strain in preparing biocontrol products for preventing and treating plant rot. Specifically, the plant is a luffa, for example, the variety is green prince, and the biocontrol product is a biocontrol microbial agent, a biocontrol agent or a biopesticide.

The application also provides a biocontrol microbial agent, which comprises the suspension of the bacillus beijerinus strain.

Optionally, the concentration of bacillus belicus in the biocontrol agent is 1×10 ⁷ ～1×10 ⁸ CFU/mL。

The application also provides a preparation method of the biocontrol microbial agent, which comprises the following steps:

inoculating the bacillus bailii BV171 into LB culture solution to be cultured until the OD600 of the culture solution is 0.5-0.8, and obtaining seed solution; inoculating the seed solution into a fermentation medium for expansion culture to obtain the biocontrol microbial inoculum.

Optionally, the fermentation medium is an NA liquid medium, and the formulation of the NA liquid medium is as follows: 5g of peptone, 3g of beef extract, 2.5g of glucose, 5g of NaCl, and deionized water to a volume of 1L and a pH of 7.0.

Optionally, the seed liquid is inoculated in an amount of 1-2% (v/v).

Alternatively, the expansion culture is carried out in a shaking table, the temperature of the expansion culture is 30 ℃, the rotating speed is 180rpm, and the time is 72 hours.

Alternatively, the bacteria obtained after fermentation broth cultureSuspension concentration was 1X 10 ⁸ ～10 ¹⁰ cfu/mL. When in use, the bacterial suspension can be diluted and reused to achieve effective control effect, for example, diluted to 1 multiplied by 10 ⁷ ～1×10 ⁸ CFU/mL. The solvent used for dilution may be water, such as sterile water.

The application also provides a biocontrol agent, comprising the cell-free supernatant of the bacillus bailii fermentation broth.

Optionally, the preparation method of the cell-free supernatant comprises the following steps: and centrifuging and filtering the fermentation liquor of the bacillus beijerinus BV171 to obtain cell-free supernatant.

Alternatively, the speed of centrifugation is 10000rpm and the centrifugation time is 10min.

Alternatively, a 0.22 μm bacterial filter was used for filtration.

When the preparation method is applied, the initial cell-free supernatant is diluted according to the actual application condition, so that a good control effect is achieved.

Optionally, the volume concentration of the cell-free supernatant in the biocontrol agent is 1-10%. The present application also provides a method of controlling plant rot caused by infection with fusarium erythropolis, comprising: the biocontrol microbial agent or the biocontrol agent is sprayed to plants. Wherein the plant can be fructus Luffae, and the spraying part can be root and/or leaf of plant.

The application specifically provides the biocontrol microbial agent and application of the biocontrol microbial agent in preventing and controlling towel gourd rot caused by infection of fusarium erythropolis.

Optionally, the biocontrol microbial agent or the biocontrol agent is sprayed on the root and/or leaf of the luffa.

Optionally, the spraying mode is as follows: irrigating for the first time 20-25 days after sowing the towel gourd, and irrigating again after growing for 7-10 days, wherein the irrigation amount of each time is 50-70 mL/plant.

Alternatively, 1X 10 ⁸ ～1×10 ¹⁰ CFU/mL of bacterial suspension was diluted to 1X 10 ⁷ ～1×10 ⁸ CFU/mL as the biocontrol agent.

Optionally, diluting the cell-free supernatant to obtain 1-10% by volume of cell-free supernatant as the biocontrol agent.

Alternatively, the solvent used for dilution is water, such as sterile water.

Compared with the prior art, the application has the following beneficial effects:

(1) The bacillus belicus BV171 screened by the application shows that the mycelium and the supernatant thereof have better inhibition effect on the growth of fusarium erythropolis hyphae and spore germination in a flat plate antagonism test, and can be applied to biological control of plant rot caused by fusarium erythropolis.

(2) The BV171 of the bacillus belius strain screened by the application shows remarkable effect on preventing and controlling fusarium rubrum of in-vitro towel gourd leaves, effectively inhibits the spread of disease spots of germs on the surfaces of the towel gourd leaves, and has the prevention effect as high as 89.5%. Under the greenhouse potting test condition, the bacillus belay strain BV171 still shows an obvious control effect on the luffa plants, and prevents root atrophy and stem basal part disease spot expansion.

(3) The Bacillus bailii strain BV171 screened by the application is applied to the prevention and treatment of the rot disease of towel gourd, and can overcome a series of problems caused by the use of chemical pesticides, so that the pollution-free production of agricultural products is facilitated, farmers can avoid or reduce the use amount of other chemical pesticides, the cost of the farmers can be saved, and the product quality is improved.

Drawings

FIG. 1 is a colony morphology of Bacillus bailii strain BV171 of the present application;

FIG. 2 is a plate antagonistic activity assay of Bacillus belicus strain BV171 in application example 1;

FIG. 3 shows the concentration (EC) of the biocontrol agent in inhibiting growth of Fusarium erythropolis hyphae in application example 2 ₅₀ ) Testing;

FIG. 4 is a graph showing the activity of the biocontrol agent in inhibiting Fusarium erythropolis in application example 3;

FIG. 5 is a measurement of the activity of a biocontrol agent against Fusarium erythropolis in application example 4;

FIG. 6 is a graph showing the effect of the biocontrol microbial agent of application example 5 on the prevention and treatment of rot disease of towel gourd in vitro;

FIG. 7 is a graph showing the effect of the biocontrol agent of application example 6 on the control of rot disease of towel gourd caused by Fusarium rubrum on towel gourd.

Detailed Description

The following description of the embodiments of the present application will be made clearly and fully with reference to the specific embodiments and the accompanying drawings, in which it is apparent that the embodiments described are only some, but not all, of the embodiments of the present application. All other embodiments, which can be made by one of ordinary skill in the art without undue burden from the present disclosure, are within the scope of the present disclosure.

EXAMPLE 1 acquisition, isolation and characterization of Bacillus bailii BV171

Soil samples of the loofah field were collected from the east Qian lake town in region of Ningbo city, zhejiang province. Weighing 1g of soil sample, adding into a solution containing 10mL of sodium chloride (with the concentration of 0.7 mol/L), oscillating the solution for 1min to prepare a soil suspension, and diluting the soil solution to the concentration of 10 by using the sodium chloride solution with the concentration of 0.7mol/L ^-4 、10 ^-5 And 10 ^-6 Is a gradient of (a). Soil solutions of different gradients (100 μl/plate) were applied to LB plates. They were placed in a constant temperature incubator at 28℃for cultivation. The colonies were picked the next day for purification culture. The purified strain obtained was stored in a refrigerator at 4℃for further use. After activation of the purified colonies, they were streaked in sequence on WA plates (WA medium/L: peptone 5g, glucose 10g, gravy extract 3g, sodium chloride 5g, agar 20g, pH=7.0), after 24 hours, round 6mm diameter pieces of bacteria were inoculated at the center of the plates, which were punched from the outer edges of the colonies with a sterilized puncher, and after 4 days, the strain most remarkable in inhibition of growth of Fusarium roseum hyphae WAs selected as the biocontrol strain.

The bacterial colony surface of the strain on LB culture medium is rough and opaque, and the strain is wrinkled and white, and the inoculating loop is slightly sticky when light touch is carried out. See fig. 1.

For identification, the biocontrol bacterial 16S rDNA sequence was amplified by colony PCR method using bacterial 16S primers 16S-27f AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1), 16S-1492r AAGGAGGTGATCCAGCGCA (SEQ ID NO: 2), respectively. The PCR amplification reaction system was 25. Mu.L: ddH2O 8. Mu.L, taq Mix 12.5. Mu.L, 16S-27f primer 1. Mu.L, 16S-1492r primer 1. Mu.L, and DNA template 2.5. Mu.L. The PCR reaction procedure was 94℃for 5min;94℃30s,58℃30s,72℃60s,33 cycles; preserving at 16 ℃. The PCR amplified product was sent to Hangzhou qing biosciences for sequence analysis. The sequence result is shown in SEQ ID NO: 3.

The alignment of the sequences in NCBI showed the highest homology to Bacillus belicus (Bacillus velezensis), and was therefore classified as Bacillus belicus (Bacillus velezensis) BV171. The strain is preserved in China Center for Type Culture Collection (CCTCC) for 7 months and 3 days in 2023, and the preservation number is CCTCC M20231173.

Example 2 preparation of biocontrol microbial Agents and biocontrol Agents

(1) Preparing seed liquid: inoculating bacillus belicus into LB culture solution, shaking culture at 30 ℃ and 180r/min, sampling and measuring OD value at 600nm in an ultra-clean workbench after 12-16 hours, and zeroing by culture solution without bacteria in the OD measuring process; and (3) culturing until the OD value of the bacterial liquid is between 0.5 and 0.8 by shaking, thus obtaining the seed bacterial liquid.

(2) Preparation of fermentation liquor: taking 500 mu L of seed liquid, inoculating the seed liquid into 500mL of liquid NA culture medium, and shake culturing for 72h at 30 ℃ and 180rpm to obtain fermentation liquor.

The formulation (per liter) of liquid NA medium was: peptone, 5g; beef extract, 3g; glucose, 2.5g; naCl,5g; the pH was adjusted to 7.0.

(3) Preparation of a biocontrol microbial agent: diluting the fermentation broth by 10-100 times with sterile water to obtain a concentration of 1×10 ⁷ ～1×10 ⁸ CFU/mL of biocontrol microbial agent.

(4) Preparation of biocontrol agent: centrifuging the fermentation broth at 10000rpm for 10min, collecting supernatant, and filtering the supernatant with bacterial filter (0.22 μm) to obtain cell-free supernatant; diluting the cell-free supernatant with sterile water to obtain the biocontrol agent with the volume concentration of 1-10%.

Application example 1 determination of plate antagonistic Activity of Bacillus bailii BV171 against Fusarium erythropolis

(1) Test method

Inoculating Fusarium rubrum stored at 4deg.C onto PDA plate for activation, and uniformly punching into circular bacteria with diameter of 6mm from the outer edge of colony with sterilized puncher. Hyphal blocks were inoculated in the center of WA plates, bacillus bailii BV171 WAs inoculated at about 25mm of the center of four Zhou Ju plates, and negative control strain Bacillus aryabhattai Bacillus aryabhattai, sterile water and 0.5. Mu.g/mL tebuconazole were used as control groups for the test. Culturing at 25deg.C, measuring colony diameter when mycelium approaches to full plate, and calculating inhibition rate.

The inhibition ratio is calculated according to the following formula:

inhibition ratio=100 (R ₁ -R ₂ )/R ₁ ，R ₁ Is used for controlling the colony radius of pathogenic bacteria in the direction of sterile water; r is R ₂ Is the colony radius of pathogenic bacteria in the treatment direction.

(2) Analysis of results:

as shown in fig. 2, the plate antagonism assay showed that: bacillus bailii BV171 has a strong inhibition effect on the growth of fusarium erythropolis hyphae, and the hyphae inhibition rate is 70.4%; the tebuconazole with the concentration of 0.5 mug/mL has weak inhibition effect on the growth of fusarium erythropolis hyphae, and the hyphae inhibition rate is 42.0%; and the negative control strain and the sterile water have no antagonistic effect.

Application example 2 biocontrol microbial agent inhibiting Fusarium erythropolis hypha growth medium concentration (EC ₅₀ ) Test

(1) Test method

Using sterile water at 10 ¹ ，10 ² ，10 ³ ，10 ⁴ ，10 ⁵ Concentration gradient dilution of 1×10 ⁹ CFU/mL of bacterial liquid with the concentration of 1X 10 is obtained ⁸ ～1×10 ⁴ CFU/mL diluted bacterial solution WAs added to 50mL WA medium at 50℃in a gradient of 5mL each to prepare a final concentration of 10 ⁷ ～10 ³ BV171 bacterial liquid of CFU/mL is prepared to contain WA dull and stereotyped of biocontrol microbial inoculum. Fusarium erythropolis hyphae are inoculated in the center of a plate, when the WA plate hyphae without biocontrol bacteria cover the whole plate, the colony size of the biocontrol bacteria plate containing each gradient is measured, and the minimum is calculatedInhibitory concentration.

(2) Analysis of results

After 4 days of culture, the inhibition effect was as shown in FIG. 3, and the rate of inhibition of hyphae increased with increasing bacterial content in the plates. Statistical results show that the bacterial content of the flat plate and the inhibition rate show a linear relation, and Y= -0.40X+2.44 (R ² = 0.9569), wherein X is BV171 strain concentration Log ₁₀ CFU/mL, Y is colony diameter. Through formula calculation, when the BV171 bacterial load in the flat plate is about 10CFU/mL, the growth of fusarium erythropolis hyphae can be inhibited by 50 percent, namely the EC of BV171 to fusarium erythropolis ₅₀ ＝10CFU/mL。

Application example 3 determination of biocontrol agent for inhibiting Fusarium erythropolis hypha Activity

(1) Test method

Adding spores of Fusarium erythropolis into WA culture medium at 50deg.C until final spore concentration is 10 ⁵ And each ml. Wa medium containing Fusarium roseum spores WAs poured into 9cm diameter plates, each plate WAs poured with 20mL. After cooling and solidification, 3 wells were punched in the symmetrical position of the plate using a 7mm diameter punch, and 25. Mu.L of the biocontrol agent prepared in example 2 (10% by volume of cell-free supernatant) was added to each well, with the culture broth and 0.5. Mu.g/ml tebuconazole as control groups. The antagonistic circle size (from the center of the well) was observed after resting at 25 ℃.

(2) Analysis of results

As shown in FIG. 4, the biocontrol agent prepared by Bacillus bailii BV171 can effectively inhibit the growth of hyphae, the radius of inhibition zone is 11.5mm, and the radius of inhibition zone of 10 times concentrated sterile supernatant is 16.5mm.

Application example 4 determination of biocontrol agent for inhibiting Fusarium roseum spore germination Activity

(1) Test method

Taking the biocontrol agent prepared in the example 2 (the volume concentration of the cell-free supernatant is 10%), adding sucrose into the biocontrol agent to make the final concentration of the sucrose to 2%, and then adding spores of Fusarium rubrum. The control group was a 2% sucrose-containing broth. 10 μl of spore suspension in sucrose solution was placed on a slide, and each treatment was repeated 5 times. The slide glass is placed in a moisture preservation box, static culture is carried out at 25 ℃, the germination condition of spores of each treatment group is observed every 5 hours, and the germination rate is calculated.

(2) Analysis of results

As shown in FIG. 5, the biocontrol agent prepared by bacillus belicus BV171 can strongly inhibit germination of fusarium erythropolis spores, and the treated spores cannot form bud tubes, so that obvious malformations such as swelling, digestion and the like appear. After germination induction, the germination rate of each treatment group was counted 5 and 10 hours, respectively, and the results show that spores of BV171 treatment group still have no germination when the germination rate of the negative control group is 100%. The statistical results are shown in Table 1.

Table 1 Fusarium roseum spore germination rate for each treatment group

Application example 5 evaluation of in vitro control effect of biocontrol microbial agent on rot of towel gourd

(1) Test method

Fresh luffa leaves with similar growth vigor are taken, washed clean and dried by using sterile water, the leaves are placed in a tray with moist filter paper padded at the bottom, and moist cotton balls are used for covering the moist petioles. The treatment group adopts a spraying method, and the surface of the blade is sprayed and inoculated with 10 ⁸ CFU/mL (containing 0.05% Tween 20) of biocontrol microbial inoculum prepared by Bacillus bailii BV171 until water droplets flow (about 3-5 mL per leaf), and then placed in an incubator for moisturizing at 25 ℃ for 24 hours. The following day, 1mm deep wells were pricked with sterile toothpicks, and then inoculated with 5mm blocks of Fusarium rubrum to the wound sites, with blank PDA as a control. After inoculation, the loofah is placed in a 12h illumination incubator with 25 ℃ and 90% humidity for cultivation, and after 4d, the disease condition of the leaf blades is observed and the diameter of the disease spots is measured. The test is to set 10 towel gourd leaves in each group by inoculating a sterile agar block fungus disk, spraying biocontrol fungus liquid and inoculating Fusarium rubrum fungus disk and spraying sterile water as a control group. Plaque grading criteria: level 0: no disorder; stage 1: the disease spots are smaller than 1.5cm;2 stages: the disease spots are smaller than 3.5cm;3 stages: the disease spots are smaller than 5.5cm;4 stages: the lesion is larger than 5.5cm or most or all of the leaves are rotten.

Disease index (%) = Σ (number of diseased veins or leaves at each stage x relative number of stages)/(total veins or leaves x highest number of stages) ×100; control (%) = (average disease index of sterile water control-average disease index of treatment)/average disease index of sterile water control x 100.

(2) Analysis of results

Tests for preventing and controlling the red sickle disease of the towel gourd by using the biocontrol microbial inoculum in an illumination incubator show that the red sickle bacteria in the control group infects the towel gourd leaves, and the infested parts are in a yellow brown water stain shape. The biocontrol microbial inoculum in the treatment group can obviously inhibit the growth and pathogenicity of Fusarium rubrum on the leaves (figure 6), the morbidity is obviously lower than that of the control group, the disease index is only 5 percent, the control effect reaches 89.5 percent (Table 2), and the biocontrol microbial inoculum has better control effect on Fusarium rubrum.

Table 2 effects of each treatment group on prevention and treatment of sickle disease of towel gourd

Application example 6 evaluation of Effect of biocontrol microbial Agents on control of rot disease in Luffa

(1) Test method

Sowing the luffa seeds (the variety is green prince) in a hole tray containing nutrient soil, culturing for 20d, and selecting one-leaf one-heart luffa seedlings for treatment. The biocontrol microbial inoculum of the embodiment 2 is taken from the treatment group and the control group 1, and is irrigated to the root parts of the luffa seedlings of the treatment group, and 50mL of biocontrol microbial inoculum is irrigated to each luffa seedling; the control group 2 luffa seedlings are irrigated with 50mL of nutrient solution, and 15 strains are repeated in each group. After 24h, treatment and control groups 2 were inoculated with 50mL (1X 10) ⁵ conidium/mL) spore suspension of fusarium erythropolis. After the culture was continued for 7d, 50mL of the biocontrol microbial agent and the nutrient solution were applied to the treatment group and the control group, respectively. After 14d inoculation, the root soil is cleaned up, and the disease condition of the towel gourd is observed.

(2) Analysis of results

The test results are shown in FIG. 7, and after 14d inoculation, the plants of the control group 1 grow well and the root system is healthy. The plants in the control group 2 have obvious disease, sparse root system and brown rot symptoms at the basal part of the stem. The treated plants grow well, have no disease, have no brown rot symptoms of the basal part of the stem and have developed root systems.

The above examples only represent a few embodiments of the present application, which are described in more detail and are not to be construed as limiting the scope of the patent. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. Accordingly, the scope of protection of the present application shall be subject to the appended claims.

Claims (10)

1. Bacillus belicus strain, characterized by the classification designated Bacillus belicus (Bacillus velezensis) BV171 with the accession number CCTCC M20231173.

2. Use of a bacillus belgium strain according to claim 1 for antagonizing fusarium erythropolis.

3. Use of a bacillus belicus strain according to claim 1 for controlling rot of luffa.

4. Use of a bacillus belicus strain according to claim 1 for the preparation of a biocontrol product for controlling rot of towel gourd.

5. A biocontrol agent comprising a suspension of the bacillus beijerinus strain of claim 1.

6. The biocontrol microbial agent of claim 5, wherein the concentration of bacillus belicus in said biocontrol microbial agent is 1 x 10 ⁷ ～1×10 ⁸ CFU/mL。

7. A biocontrol agent comprising the cell-free supernatant of the bacillus bailii strain broth of claim 1.

8. The biocontrol agent of claim 7, wherein said cell-free supernatant is prepared by a process comprising:

inoculating activated bacillus bailii into a fermentation medium for expansion culture to obtain bacillus bailii strain fermentation liquor;

centrifuging and filtering the bacillus beijerinus strain fermentation liquor, and taking supernatant to obtain the cell-free supernatant.

9. The biocontrol agent of claim 7, wherein the cell-free supernatant in said biocontrol agent is at a volume concentration of 1-10%.

10. A method for controlling plant rot caused by fusarium erythropolis infection, characterized in that the biocontrol agent of claim 5 or the biocontrol agent of claim 7 is sprayed on the roots and/or leaves of luffa plants.