CN111996126B

CN111996126B - Violet purpurea capable of being used for preventing and treating root-knot nematode and application thereof

Info

Publication number: CN111996126B
Application number: CN202010839516.0A
Authority: CN
Inventors: 王科晶; 余昕彤; 曹鸿一; 王琳
Original assignee: Moon Guangzhou Biotech Co ltd
Current assignee: Moon Guangzhou Biotech Co ltd
Priority date: 2020-08-19
Filing date: 2020-08-19
Publication date: 2022-04-15
Anticipated expiration: 2040-08-19
Also published as: CN111996126A

Abstract

The present application provides an isolated strain of purple violet (purpurococcum lilacinum), compositions comprising the same and uses thereof for the control of root knot nematodes (Meloidogyne). The strain has strong spore production capacity, high viable count and good control effect, and can be used for controlling various plants.

Description

Violet purpurea capable of being used for preventing and treating root-knot nematode and application thereof

Technical Field

The application relates to the field of microbial control, in particular to lilac violet spore bacteria and application thereof in agricultural production.

Background

Root-Knot Nematodes (RKN), a melodogyne, have a wide host range, can infect over 3000 plants of 114 families, including monocotyledons, dicotyledons and herbaceous plants, are major pests in agriculture all over the world, can cause crop yield reduction of 10-20%, can reach more than 75% in severe cases, and cause economic loss estimated to be about $ 1180 million per year. RKN can form root knots in the roots of plants, preventing water and nutrient uptake and infected wounds can promote infection by pathogenic microorganisms. Meloidogyne incognita (Meloidogyne incognita) infects the roots of almost all cultivated plants, one of the most important species of RKN.

At present, chemical control, crop rotation and resistance breeding are mainly adopted for RKN control. However, chemical control faces problems of pollution, drug resistance, etc., and the resources of resistant varieties effective in agricultural production are limited. In contrast, biological pesticides are considered to be ideal substitute for future chemical pesticides due to the characteristics of high efficiency, low toxicity, low residue, no pollution, difficulty in generating drug resistance, easy availability of raw materials and the like.

The purple lilac spore fungus has been studied in the field of online pest control for several years, and can parasitize eggs and oocysts of root-knot nematodes and also parasitize females and larvae. Eggs are most susceptible to infection early in embryonic development, and hyphae or conidia can be directly punctured into them. Hyphae can smoothly grow in the oocysts of the root-knot nematodes, surround egg granules to infect the eggs, generate a special structure-attachment cell on the surfaces of the nematodes after the hyphae is contacted with the eggs, and digest egg shells by using mechanical pressure and extracellular secretion of chitinase and protease of fungi, so that the embryos are infected until the embryos are completely replaced by the hyphae.

However, the physiological characteristics, functional characteristics and the like of the rhodosporidium lilacinum strains of different sources are greatly different, and a high-efficiency strain which can be really, efficiently and widely applied and is suitable for industrial production is lacked. For example, patent CN102851219A discloses a wild Paecilomyces lilacinus E16 strain isolated from a banana plant retransmitted by nematodiasis, which has high pathogenicity only to banana root-knot nematode and has a single action object. For another example, patent CN107058120A discloses a purple lilac P136-1-1 strain subjected to ultraviolet mutagenesis, which can efficiently kill meloidogyne cucumerinum, but has low sporulation ability (5.9-10)⁸Spore/dish, 20 mL/dish) and has an anisotropy after ultraviolet mutagenesis treatment, which is difficult to meet the requirement of industrial production.

Based on the method, the invention aims to screen a wild type strain which has strong sporulation capacity, wide action object and high pathogenicity to root-knot nematodes and is suitable for industrial production.

Summary of The Invention

In a first aspect, the invention provides an isolated purplish lilac (purpurococcum lilacinum) strain, namely MN12228, with the collection number of CGMCC No.12773, which is collected in China general microbiological culture Collection center (CGMCC) at 2016, 7, 12 and the address of Beijing institute of microbiology, Beijing institute of microorganisms No. 3, West Lu No.1, of the Korean district, Beijing.

The present invention provides an isolated violet infestans strain having a sequence with at least 99.5%, at least 99.55%, at least 99.6%, at least 99.65%, at least 99.7%, at least 99.75%, at least 99.8%, at least 99.85%, at least 99.9%, at least 99.95% or 100% identity to SEQ ID No.1, and wherein said violet infestans strain confers a positive agronomic trait or benefit to a crop plant when said crop plant is treated with said violet infestans strain.

Positive agronomic traits or benefits are prevention, treatment, and severity of disease or symptoms caused by root-knot nematodes relative to control plants, such as reduced root knot, increased budding rate, more vigorous root growth, and significant reduction in soil nematodes, including plant parasitic nematodes such as root-knot nematodes, cyst nematodes, gold nematodes, and heterodera. Such positive agronomic traits or benefits may include increased plant growth, increased crop plant yield, and improved quality.

In some embodiments, wherein the isolated violet lilac strain is a progeny of the violet lilac strain MN12228 provided herein.

In some embodiments, a culture or population of a violet purple spore bacterial strain or isolate thereof is provided.

In a second aspect, there is provided a composition comprising a strain of the first aspect herein and an agriculturally acceptable carrier.

In some embodiments, the composition comprises 8-12 parts of a culture of lilac violet spore, 5-9 parts of dispersant NNO, 2-6 parts of SDS, 3-5 parts of nekal, 6-10 parts of potassium dihydrogen phosphate, and the balance to 100 parts of carrier diatomaceous earth.

In some embodiments, the composition comprises 8 parts of a culture of rhodosporidium lilacinum MN12228, 5 parts of dispersant NNO, 2 parts of SDS, 3 parts of nekal, 6 parts of potassium dihydrogen phosphate, made up to 100 parts with carrier diatomaceous earth. In some embodiments, the composition comprises 10 parts of a culture of rhodosporidium lilacinum MN12228, 7 parts of dispersant NNO, 4 parts of SDS, 4 parts of nekal, 8 parts of potassium dihydrogen phosphate, made up to 100 parts with carrier diatomaceous earth. In some embodiments, the composition comprises 12 parts of a culture of rhodosporidium lilacinum MN12228, 9 parts of dispersant NNO, 6 parts SDS, 5 parts nekal, 10 parts potassium dihydrogen phosphate, made up to 100 parts with carrier diatomaceous earth.

In a third aspect, there is provided a method of preventing, ameliorating or treating a crop plant root knot nematode (melodogyne) pest comprising: the compositions described herein are applied to a plant, plant parts such as roots or leaves, or plant seeds.

In some embodiments, the crop plant is any crop plant in need of prevention, alleviation or treatment of root knot nematode pests, such as cucumber, tomato, ginger, pepper, eggplant, leafy vegetables, banana, citrus.

Drawings

FIG. 1: a cucumber root growth diagram treated by a rhodosporidium lilacinum MN12228 microbial inoculum.

FIG. 2: and (3) a ginger bud growth vigor graph after treatment of the rhodosporidium lilacinum MN12228 microbial inoculum.

The separated purple lilac spore (purple lilacinum) strain of the invention, namely MN12228, has a preservation number of CGMCC No.12773, is preserved in China general microbiological culture Collection center (CGMCC) at 2016, 7, 12 and has the address of Beijing institute of microorganisms No. 3 Beijing of West Lu No.1 Hopkins of the Korean-yang district in Beijing.

Detailed Description

Example 1: purple lilac spore bacterium MN12228 separation

The viola lilacina MN12228 is obtained by separating from the field soil of Shaanxi-An wheat in Shaanxi, and is preserved in China general microbiological culture Collection center (CGMCC) in 2016, 7, 12 and with the preservation number of CGMCC 12773, wherein the accession number is CGMCC. The specific separation method is as follows: a10 g sample of soil was weighed, added to 90mL of sterilized water containing 0.1% Tween, and shake-cultured at 28 ℃ for 1 hr. Diluting the culture solution with water containing 0.1% Tween step by step to different gradients, then coating the gradient on a PDA solid culture medium (200 g of potato, 20 g of glucose, 15-20 g of agar and 1000 ml of distilled water), carrying out inverted culture in a constant temperature incubator at 28 ℃ for 4 days, picking out a single bacterial colony after 4 days, continuously inoculating the single bacterial colony on the PDA solid culture medium, carrying out inverted culture in the constant temperature incubator at 28 ℃ for 5 days, then observing the morphology of the bacterial colony, and observing the morphology of the bacterial colony by using an optical microscope (1000X).

And (3) morphological identification: the colony morphology was observed, and the cell morphology (1000X) was observed with an optical microscope.

And (3) molecular identification: the sequence of strain MN12228 was determined, and the results are shown below.

CCGATTGGTGACGCGGAGGGACATTACCGAGTTATACAACTCCCAAACCCACTGTGAACCTTACCTCAGTTGCCTCGGCGGGACCGCCCCGGCCGCCGCGCAAGCGGCGCCGGACTCCAAGGCGCCCGCCGCAGGGACCCAAAACTCTTTTGCATTACGCCCAACGGCGGGAATTTTTTCTCTGAGTGCATAAGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCCCCCGGGGGCCTCGGTGTTGGGGGACGGCACACCAGCCGCCCCCGAAATGCAGTGGCGACCTCGCCGCAGCCTCCCCTGCGTAGTAGCACACACCTCGCACCGGAGCGCGGAGACGGTCACGCCGTAAAACGCCCAACTTCTTAGAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA(SEQ ID NO.1)。

By ITS sequence homology analysis and BLAST homology comparison, the strain MN12228 can be identified as the purple lilac spore bacterium by combining morphological characteristics and sequence characteristics.

Example 2: determination of spore production capacity and viable count of lilium purple spore

Laboratory sporulation ability assay:

inoculating activated purple spore MN12228 into PDA culture medium, culturing at 25-28 deg.C for 7 days, washing out spores from the culture medium with sterile water to obtain spore suspension, counting with blood counting plate, and measuring spore concentration to 9.7 × 10⁹spore/mL is higher than the spore-forming ability of the strain disclosed in patent CN107058120A (5.9X 10)⁸Spore/dish20 mL/dish).

And (3) measuring the spore yield of the culture in the pilot plant:

wheat bran, ammonium sulfate and sucrose are mixed according to the weight ratio of 85: 10: 5 mixing into solid preparation, placing into a solid fermentation tank, adding 20% purified water (based on total weight), mixing, and sterilizing at 121 deg.C under high pressure for 20 min. Cooling, inoculating activated Rhodosporidium lilacinum strain MN12228 at an inoculation amount of 10% (volume percent) under aseptic condition, and performing at 25-28 deg.C in dark conditionThe pilot plant is used for the enlarged culture,the fermentation was terminated after 7 days of culture. And (3) scattering and uniformly mixing the purple violet spore bacteria fermentation product by using a stirring device to obtain the purple violet spore bacteria culture. The content of the purple violet spore in the purple spore bacteria culture can reach 1.8 multiplied by 10 when the blood count board is used for measuring the purple spore content¹⁰cfu/g culture, not less than the similar products on the market, and is suitable for industrial production.

The spore content of the existing similar products in the market is as follows:

the name of the product is: quick-acting nematode killer (Beijing Zhengnong agricultural science and technology Co., Ltd.), the number of effective live spores of Paecilomyces lilacinus is more than 1.0 multiplied by 10¹⁰Bacterial agent/g

The name of the product is: xinlonghuilan (Xinlong Biotech, Inc. of Jiangxi) Paecilomyces lilacinus with effective viable count > 2.0 × 10⁸Per gram of powder

Example 3: preparation of purple lilac spore bacterium MN12228 microbial inoculum

The lilac violet spore bacterium agent comprises the following components in parts by weight: 8-12 parts of purple lilac spore bacterium MN12228 culture, 5-9 parts of dispersant NNO, 2-6 parts of SDS, 3-5 parts of nekal, 6-10 parts of potassium dihydrogen phosphate and the balance of carrier diatomite to 100 parts. The spore content of the prepared lilac violet spore fungus agent is not less than 10⁸Per g, preferably 10⁹Per gram.

Table 1: the contents of all components of the microbial inoculum

Numbering	MN12228	NNO	SDS	Pull-apart powder	Potassium dihydrogen phosphate	Diatomite
							Group I	8	5	2	3	6	76
Group II	10	7	4	4	8	67
							Group III	12	9	6	5	10	58

Example 4: insecticidal activity of purple lilac spore bacterium MN12228 on second-instar larvae of Meloidogyne incognita

Diluting the prepared lilacinus violaceus microbial inoculum by 100 times with 0.1% tween sterile water, adding the diluted lilacinus violaceus microbial inoculum to a 24-hole sterile cell culture plate, adding 500 mu L of diluted lilacinus violaceus microbial inoculum and 100 second-instar larvae of root knot nematode into each hole, and counting the death conditions of the nematodes in each treatment at 24 hours respectively. The control group was 0.1% tween sterile water. Each treatment was repeated 5 times.

Table 2: pesticidal activity of lilac violet spore bacterium agent

As a result, the viola lilacina fungicide has more than 86.57% of nematicidal activity within 24 hours, the nematicidal activity can reach 94.4% at most (Table 2), and the dead nematodes are stimulated by 1 mol of sodium hydroxide without recovery.

The nematicidal activities of the bactericides of the group II and the bactericides of the group III are equivalent, the bactericides of the group II lilac violet spore bacteria are further preferably selected for carrying out the control test on the root-knot nematodes of crops, and the spore content of the bactericides is not lower than 10⁹Per gram.

Example 5: indoor biological control of cucumber root knot nematode by lilac violet spore bacterium agent

And (3) disinfecting the cucumber seeds, cleaning the cucumber seeds with sterile water, and sowing the seeds. Culturing cucumber seedlings in a greenhouse at 26-27 ℃ until the first true leaves are completely unfolded, transplanting 1 cucumber seedling in each pot, and transplanting 90 pots in total, wherein the cucumber seedlings are divided into two groups, namely a treatment group and a control group. The treatment group was irrigated with 15mL of a 100-fold diluted amethyst violet spore bacterial agent (group II) in 0.1% tween water, and the control group was irrigated with an equivalent amount of 0.1% tween sterile water. And after 24 hours of watering, inoculating 300 root-knot nematodes to each cucumber seedling, performing normal fertilizer and water management after inoculation, buckling and pouring out all the plants 45 days later, performing root-knot severity classification, recording the number of root knots on the root knots, and calculating the root-knot decline rate of each treatment.

TABLE 3 control effect of purple lilac spore fungus on meloidogyne cucumerinum

The results in table 3 and fig. 1 show that the root junction decline rate of the purple lilac spore product treatment group is 64.20%, and the average root junction number is significantly lower than that of the control group (P < 0.05).

Example 6: experiment of lilac purple spore bacterium agent on cherry tomato field plot

Cherry tomato range of test (planting time: 2019.09.27-2020.01)

6.1 test site: the test is carried out in a goichichthyol and town Xingteng test base in the area of wine fruit district in Guangzhou, Guangdong province, the test site has convenient traffic, fertile soil and sufficient illumination, the soil is red sandy soil, the previous crop of the test site is cucumber, and the root-knot nematode disease is serious.

6.2 Experimental cell planning and handling: the planting area is 180m²Dividing planting cells according to the specification of 4m multiplied by 4m, dividing the planting cells into 8 planting cells in total, keeping an interval of 1m between every two planting cells, planting 9 multiplied by 7 tomato seedlings in every planting cell at equal intervals, and irrigating the tomato seedlings with root fixing water during transplanting. After 7 days of transplanting, the 8 planting districts are randomly divided into two groups, namely a treatment group and a control group, 300mL of dilute solution of a viola violet spore fungicide (group II) diluted by 100 times of 0.1% Tween water is poured into each tomato seedling of the treatment group, the control group is applied with 0.1% Tween sterile water with the same amount, and compound fertilizers are applied 30 days after transplanting and at the early stage of flowering respectively.

6.3 test results

And counting the yield of the tomato fruits in each planting district at the beginning of the harvesting period. Sampling 20 tomato seedlings in each planting district, shoveling the root system completely by using a shovel, cleaning, filling into a sample bag, and counting the root knot index of the root system according to the following standard:

level 0: no root knot exists;

level 1: the root knot accounts for 1 to 25 percent of the whole root system;

and 2, stage: the root knot accounts for 26% -50% of the whole root system;

and 3, level: the root knot accounts for 51 to 75 percent of the total root system;

4, level: the root knot accounts for 76-100% of the total root system.

Compared with a control group, the tomato seedlings treated by the purple lilac spore bacterium agent have developed root systems, the root knot is obviously reduced, and the prevention and treatment effect of the root knot nematode reaches 84.39%. In addition, the effective control of the root-knot nematodes is beneficial to improving the tomato yield, the tomato yield of the treatment group planting cell is obviously improved, and the yield is increased by 39.32%.

TABLE 4 purple-violet spore fungus agent for preventing and treating tomato root-knot nematode

Example 7 purple lilac spore bacteria agent promoting ginger bud formation

The ginger root knot nematode disease is also called ginger pellagra, the quality and the yield of the diseased ginger are greatly influenced, the yield of the ginger is reduced by 10 to 20 percent under general conditions, and the yield of the serious ginger is reduced by more than 50 percent. According to the invention, through the test of the ginger suffering from the seed soaking skin disease, the purple lilac spore bacterium MN12228 can effectively prevent the root-knot nematode from damaging the ginger seeds, is favorable for promoting the generation of the ginger buds and improves the bud ratio of the ginger seeds.

7.1. The test method comprises the following steps:

7.1.1. test materials

(1) Ginger: ginger for treating Lai skin disease

(2) Treating fluid: diluting the group II lilac violet spore bacteria agent with 0.1% Tween-water by 50 times

(3) And others: seedling raising pots (10X 10cm), sterilized seedling raising soil and the like.

7.1.2 test procedure

(1) Ginger seed disinfection: cutting ginger with the skin-dependent disease into ginger blocks with the same weight, cleaning the ginger blocks with clear water, disinfecting the surfaces and the cuts of the ginger blocks with 75% of alcohol, washing the alcohol, and airing the ginger blocks to be used as ginger seeds;

(2) seed soaking: setting a treatment group and a control group, wherein each group selects 30 ginger seeds for seed soaking treatment, the treatment group is soaked in the treatment solution for 10-15min, and the control group is soaked in 0.1% Tween water for a long time;

(3) sowing: preparing 30 seedling raising pots in each group, respectively filling seedling raising soil sterilized at 121 ℃ for 60min, then putting a soaked ginger seed in each seedling raising pot, covering a layer of seedling raising soil, sealing the opening of each seedling raising pot by a preservative film, and then placing the seedling raising pots in a germination accelerating room at the temperature of 20-25 ℃ for accelerating germination.

The weight of the ginger is counted before soaking the seeds, and growth indexes such as weight expansion, budding rate, average bud length and the like of the ginger are counted after two weeks of sowing, so that the bud growth vigor is judged.

TABLE 5 influence of the lilac violet spore bacteria on the budding effect of ginger

Numbering	The weight of ginger pieces rises/percent	Germination rate/%	Average bud length/cm
				Treatment group	8.06±0.84	95.2±0.95	2.58±0.37
Control group	6.83±0.57	81.4±1.12	1.37±0.11

As can be seen from Table 5, the germination rate, the germination length and the ginger weight of the ginger processed by the lilac violet spore bacterial agent are all higher than those of the control group.

The purple rhodosporidium lilacinum strain is a wild type strain separated from the soil of a barley field, can be applied to cross-crop screening and application of crops such as cucumbers, tomatoes, ginger and the like, enriches the diversity of microorganisms among various crops, and promotes the mutual beneficial symbiosis between the microorganisms and the crops.

Claims

1. An isolated purple lilac spore fungus (purple lilac spore fungus)Purpureocillium lilacinum) The strain MN12228 has the preservation number of CGMCC number 12773, and has a sequence of SEQ ID NO. 1.

2. A culture of the purple violet spore bacterial strain of claim 1.

3. A population of the purple lilac spore bacterial strain of claim 1.

4. A composition comprising the strain of claim 1 and an agriculturally acceptable carrier.

5. The composition as claimed in claim 4, which comprises 8-12 parts by weight of the culture of the purple lilac spore bacterium MN12228, 5-9 parts by weight of dispersant NNO, 2-6 parts by weight of SDS, 3-5 parts by weight of nekal, 6-10 parts by weight of potassium dihydrogen phosphate, and the balance to 100 parts by weight of carrier diatomite.

6. The composition as claimed in claim 4, which comprises 8 parts by weight of the culture of the purple-violet spore bacterium MN12228, 5 parts by weight of the dispersant NNO, 2 parts by weight of SDS, 3 parts by weight of Nostoc commune, 6 parts by weight of potassium dihydrogen phosphate, made up to 100 parts by weight of the carrier diatomaceous earth, or 10 parts by weight of the culture of the purple-violet spore bacterium MN12228, 7 parts by weight of the dispersant NNO, 4 parts by weight of SDS, 4 parts by weight of Nostoc commune, 8 parts by weight of potassium dihydrogen phosphate, made up to 100 parts by weight of the carrier diatomaceous earth, or 12 parts by weight of the culture of the purple-violet spore bacterium MN12228, 9 parts by weight of the dispersant NNO, 6 parts by weight of SDS, 5 parts by weight of Nostoc commune, 10 parts by weight of potassium dihydrogen phosphate, made up to 100 parts by weight of the carrier diatomaceous earth.

7. A composition for preventing, relieving or treating root-knot nematode of cropsMeloidogyne) A method of combating pests, comprising: applying the composition of any one of claims 4-6 to a plant.

8. The method of claim 7, comprising applying the composition of any one of claims 4-6 to the roots, foliage, or seeds of a plant.

9. The method of claim 7 or 8, wherein the crop plant is cucumber, tomato, ginger, pepper, eggplant, leafy vegetables, banana, or citrus.