CN117866994A - Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof - Google Patents

Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof Download PDF

Info

Publication number
CN117866994A
CN117866994A CN202311813350.5A CN202311813350A CN117866994A CN 117866994 A CN117866994 A CN 117866994A CN 202311813350 A CN202311813350 A CN 202311813350A CN 117866994 A CN117866994 A CN 117866994A
Authority
CN
China
Prior art keywords
eno
sequence
gfp
plasmid
fluorescence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311813350.5A
Other languages
Chinese (zh)
Inventor
张安定
王裕华
刘冉
夏坤龙
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202311813350.5A priority Critical patent/CN117866994A/en
Publication of CN117866994A publication Critical patent/CN117866994A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/185—Escherichia
    • C12R2001/19—Escherichia coli
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acid and application thereof, wherein the fluorescent reporter plasmid is based on pMDT18T plasmid, a promoter sequence +T10 sequence +sfGFP gene of streptococcus suis ENolase gene is inserted into a multi-cloning site region of the pMDT18T plasmid, and the nucleotide sequence connected with the three is shown as SEQ ID NO. 1. The invention can rapidly and simply analyze the combination of the transcription factor and the target DNA, does not need to express and purify the target protein in vitro for further analysis, easily reflects the relative combination capacity by detecting the change of fluorescence intensity, and is suitable for analyzing the combination of the transcription factor and the DNA in a large scale; and through flow cytometry sorting, the binding motif of the transcription factor can be rapidly identified, so that an important technology is provided for the construction of a global transcription regulation network.

Description

Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof
Technical Field
The invention relates to the technical field of microorganism, in particular to a fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acid and application thereof.
Background
The nature of transcriptional regulation is to promote and block transcription of RNA polymerase by binding transcriptional activators and transcriptional repressors to specific DNA sequences, and ultimately regulate the expression level of genes. The transcription factor regulation network is a global transcription factor regulation network of whole genome level drawn on the basis of systematic identification of transcription factor binding motifs, and is a basis for understanding the regulation of microbial vital activities, analyzing pathogenic mechanisms of pathogenic bacteria, identifying novel drug targets, and modifying industrial microorganisms to increase the production level of active substances. Except that escherichia coli mode bacteria and mycobacterium tuberculosis construct a global transcription regulation network through the traditional technologies such as chip-seq and the like, the global regulation network of other microorganisms is difficult to construct systematically until now due to the lack of simple analysis technologies. Therefore, a technique that is simple and easy to handle and that can analyze the binding of a microbial transcription factor to a target sequence relatively quantitatively is an important technique in this research field.
Currently, techniques for analyzing the binding of microbial transcription factors to target sequences include EMSA (gel migration experiments), SPR, BLI, etc., and the basic principle is to react the binding of the two by in vitro analysis of the migration level, optical interference, etc. of the expressed and purified protein when it binds to target DNA, after electrophoresis. The technology can quantitatively analyze the interaction acting force data in vitro, but needs to analyze after expressing the purified protein in vitro, is suitable for analyzing single transcription factors, and is not suitable for identifying the binding motif of the transcription factors in a large quantity in high throughput. CHIP-Seq is a technique for identifying specific transcription factor binding motifs, and can only qualitatively analyze the binding of transcription factors to DNA or identify the sequence of binding. Bacterial single hybridization is the direct analysis of the interaction of proteins and target DNA in bacteria, but is generally only suitable for analysis of transcription activator-initiated expression of resistance genes (reporter genes) to grow on resistant media. The technology has more non-specific reaction, is only suitable for analyzing strong binding and is only suitable for analyzing transcription activating factors.
Thus, there is a need in the art for a technique that is simple and easy to handle and that allows for relatively quantitative analysis of binding of microbial transcription factors (activation or inhibition) to target sequences. Therefore, the combination of transcription factors and DNA can be analyzed in large batch, and an important technology is provided for the construction of a global transcription regulation network.
Disclosure of Invention
Aiming at the lack of an efficient and simple analysis method when a transcription factor regulation network is constructed, the invention provides a fluorescent reporter plasmid p18T-eno-T10-GFP for analyzing and identifying the interaction of the transcription factor and nucleic acid and application thereof, and the invention utilizes the fluorescent reporter plasmid p18T-eno-T10-GFP to analyze the combination of a microorganism transcription factor (activation or inhibition) and a target sequence and the combination strength thereof relatively quantitatively through fluorescence intensity, and can also systematically identify the DNA sequence of the transcription factor combination. And further, the method is a basis for understanding the regulation and control of the vital activities of microorganisms, analyzing pathogenic mechanisms of pathogenic bacteria, identifying novel drug targets and modifying industrial microorganisms to improve the production level of active substances.
In order to achieve the above purpose, the technical scheme of the invention is as follows:
the invention provides a fluorescent reporter plasmid p18T-eno-T10-GFP for analyzing and identifying interaction between transcription factors and nucleic acid, which is characterized in that: the fluorescence report plasmid p18T-eno-T10-GFP is based on pMDT18T plasmid, and the promoter sequence +T10 sequence of streptococcus suis ENolase gene (T10 is 10 continuous thymine T) +sfGFP genes) is inserted into the region of the multiple cloning site of pMDT18T plasmid, and the nucleotide sequence of the connection of the three genes is shown as SEQ ID NO. 1.
Further, the promoter sequence of the streptococcus suis enoase gene +t10 sequence +sfgfp gene is inserted between sequence CAGTGAGCGCAACGCAATTAATGTGTTTCG and sequence GCTTGCATGCCTGCAGGTCGACGAT.
The invention also provides a construction method of the fluorescence report plasmid p18T-eno-T10-GFP, which comprises the following steps:
1) PCR amplification was performed using a commercial pMDT18T plasmid as a template and the following MDT 18T-sfGFP-linearization primer to obtain a vector sequence containing E.coli promoter, resistance gene fragment, and fragment of T7 promoter element,
pMDT 18T-sfGFP-linearization-F: TCTCTAGAGGATCCCCGGGTA, pMDT 18T-sfGFP-linearization-R: ATCGTCGACCTGCAGGCATGC;
2) Synthesizing a section of sequence containing a promoter sequence, a T10 sequence and an sfGFP gene of streptococcus suis ENolase gene; the ENO-10T-GFP primer was used to amplify the binding sequence of the ENolase promoter+T10 sequence+sfGFP, wherein,
18T-ENO-10T-GFP-F：
CAATTAATGTGTTTCGCCAGAGGCTTTCTG，
18T-ENO-10T-GFP-R：
CAATTAATGTGTTTCGCCAGAGGCTTTCTG；
3) And (2) connecting the binding sequence of the ENolase promoter +T10+sfGFP obtained in the step (2) with the carrier sequence obtained in the step (1) by using an infusion technology, converting the connected product into an escherichia coli TOP10 strain, and constructing a reporter plasmid p18T-eno-T10-GFP by observing green fluorescence according to ampicillin antibiotic screening and a fluorometer to confirm the strain.
The invention also provides a method for analyzing the binding of transcription factors to target DNA sequences, comprising the steps of:
1) Constructing a gene corresponding to a transcription factor X (mainly a DNA binding domain thereof) to be analyzed behind a T7 promoter of the reporter plasmid p18T-eno-T10-GFP of claim 1 to obtain a plasmid p18T-eno-T10-GFP-X;
2) Replacing the target sequence Y to be analyzed with the T10 sequence in front of sfGFP of the reporter plasmid p18T-eno-T10-GFP-X in the step 1) to obtain the reporter plasmid p18T-eno-Y-GFP-X;
3) Transferring the reporter plasmid p18T-eno-Y-GFP-X obtained in the step 2) into an escherichia coli BL21 (DE 3) strain, and observing green fluorescence by using an ampicillin antibiotic screening and a fluorometer to confirm the strain;
4) Coli BL21 containing p18T-eno-Y-GFP-X plasmid was cultured on IPTG-free and IPTG-containing plates, respectively, and changes in fluorescence were observed for both:
if the fluorescence intensity of the colony added with the IPTG plate is obviously reduced compared with that of the colony without the IPTG, the transcription factor X can be combined with the target sequence Y, so that the eno-initiated expression of sfGFP is inhibited, and the fluorescence is reduced; alternatively, if the fluorescence intensity of colonies added to the IPTG plate does not exhibit a significant decrease in comparison with colonies without IPTG, it is indicated that the transcription factor X cannot bind to the target sequence Y, and thus the fluorescence intensity is not decreased.
The invention also provides application of the method in identifying the pathogenic mechanism of the transcription factor CcpA combined with the target motif and analyzing the streptococcus suis CcpA.
Preferably, the method for application is as follows:
1) Using streptococcus suis genome as a template, amplifying a gene of a transcription factor CcpA of streptococcus suis by using the following primer p 18T-CpA, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2; and constructing the sequence into the rear of the T7 promoter of the reporter plasmid p18T-eno-T10-GFP to obtain a plasmid p18T-eno-T10-GFP-ccpA, wherein,
p18T-CcpA-F:
GAAGGAGATATACCATGTTAAACACTGACGATACGG
p18T-CcpA-R:
GTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG
2) Respectively replacing the T10 sequences in the reporting plasmid p18T-eno-T10-GFP-ccpA in the step 1) with two target sequences Y1 and Y2 to be analyzed to respectively obtain p18T-eno-Y1-GFP-ccpA and p18T-eno-Y2-GFP-ccpA; wherein, the target sequence Y1 is TGAAAACGTTTT and the target sequence Y2 is AGAAAATGCTTACA;
3) The reporter plasmids p18T-eno-Y1-GFP-ccpA and p18T-eno-Y2-GFP-ccpA in the step 2) are respectively transferred into an escherichia coli BL21 (DE 3) strain, and obvious green fluorescence is observed through ampicillin antibiotic screening and a fluorometer to confirm that the construction of the detection strains is correct.
4) E.coli BL21 containing the p 18T-eno-Y1-GFP-CpA plasmid and E.coli BL21 containing the p 18T-eno-Y2-GFP-CpA plasmid were cultured on IPTG-free and IPTG-containing plates, respectively, and changes in fluorescence were observed:
if the fluorescence intensity of the colony added with the IPTG plate is obviously reduced compared with that of the colony without the IPTG, the transcription factor gene CcpA can be combined with the target sequence Y1 (TGAAAACGTTTT), so that the sfGFP expressed by eno is inhibited, and the fluorescence is reduced; alternatively, when the fluorescence intensity of colonies added to the IPTG plate does not exhibit a significant decrease compared to colonies without IPTG, it is indicated that the transcription factor gene CcpA cannot bind to the target sequence Y2 (TGAAAACGTTTT), and thus the fluorescence intensity is not decreased.
5) Searching for the Y1 sequence (TGAAAACGTTTT) on the whole genome of Streptococcus suis and combining with the function of the CcpA gene found that the glgC contained the Y1 (TGAAAACGTTTT) sequence, indicated that the glgC was its target gene, while the CcpA gene was found to regulate pathogenicity by regulating the expression of the glgC target gene (consistent with the reported CcpA binding motif), indicated that this technique could be used to analyze the interaction of transcription factors and nucleic acids.
The invention also provides a method for identifying a transcription factor binding motif, comprising the steps of:
1) Constructing a gene corresponding to a transcription factor X (mainly a DNA binding domain) to be analyzed into a T7 promoter of a reporter plasmid p18T-eno-T10-GFP according to claim 1 to obtain a plasmid p18T-eno-T10-GFP-X;
2) Randomly combining 8-15 nucleotides to form a plurality of DNA sequences N X (binding motif), wherein, X numbering 1, 2, 3, 4, 5 … … for the sequences;
each DNA sequence N X The T10 sequence of the reporter plasmid p18T-eno-T10-GFP-X of step 1) was replaced, respectively, to thereby report the plasmid p18T-eno-N X -GFP-X, thereby yielding a library of reporter plasmids containing binding motifs;
3) The plasmids p18T-eno-NX-GFP-X of the plasmid library are respectively and efficiently transformed into escherichia coli through electrotransformation, and strain libraries are prepared through screening of ampicillin resistance genes;
4) The strain library is induced by IPTG, and then the strain is analyzed by flow cytometry for the expression level of sfGFP fluorescence of the strain, and the strain with significantly reduced fluorescence is sorted.
5) The strain with obviously reduced fluorescence is subjected to expansion culture, then plasmid library contained in bacteria is extracted as a template, NX sequence in p18T-eno-NX-GFP-X is amplified in a PCR low cycle (10-15 cycles) and sequence characteristics are obtained through second generation sequencing,
extracting plasmids after expanding the strains which are not sorted, amplifying NX sequences in p18T-eno-NX-GFP-X in the same PCR low-cycle mode, obtaining the sequence abundance through second-generation sequencing, and taking the sequence abundance as a reference of plasmids of a starting library; comparing the two parts of sequencing results, if the sequencing results show that compared with the control, the fluorescence of the strain is obviously reduced, and the sequence is a target sequence combined with transcription factors.
The invention also provides application of the method in identifying the binding motif of the transcription factor XRE and constructing an XRE transcription factor regulation network.
Preferably, the method for application is as follows:
1) Amplifying transcription factor XRE (mainly DNA binding domain) gene for obviously regulating and controlling streptococcus suis virulence, wherein the nucleotide sequence is shown as SEQ ID NO. 3, and constructing the sequence into a T7 promoter of a reporter plasmid p18T-eno-T10-GFP according to claim 1 to obtain a plasmid p18T-eno-T10-GFP-XRE;
2) Amplification of p18T-eno-T10-GFP-XRE with primer 18T-random, multiple DNA sequences N will be formed from random combinations of 15 nucleotides X ，
Each DNA sequence N X The reporter plasmid p18T-eno-T10-GFP-XRE of step 1) was replaced with T10, respectively, to thereby report the plasmid p18T-eno-N X GFP-X, thereby obtaining a library of reporter plasmids containing binding motifs; wherein the method comprises the steps of
18T-random-F：
CAGGTTATTTTACNNNNNNNNNNTGAAAGAAATAATGTAAACGCCTTC，
18T-random-R：
CATTATTTCTTTCANNNNNNNNNNGTAAAATAACCTGTTTTTTCTTG；
3) The plasmids in the plasmid library are respectively and efficiently transformed into escherichia coli through electrotransformation, and strain libraries are prepared through screening of ampicillin resistance genes;
4) The strain library containing the plasmid library p18T-eno-N10-GFP-XRE was induced by IPTG, and then E.coli with significantly reduced expression level of sfGFP fluorescence was sorted by flow cytometry.
5) The sorted strains with significantly reduced fluorescence are subjected to amplification culture, then plasmid libraries contained in bacteria are extracted as templates, and the N10 sequences in p18T-eno-N10-GFP-X are amplified through PCR (polymerase chain reaction) low cycle (10-15 cycles) by using sequencing-random primers, and the sequence characteristics are obtained through second generation sequencing. Extracting plasmid after enlarging the strain which is not sorted, amplifying N10 sequence in p18T-eno-N10-GFP-X by PCR low circulation, obtaining the sequence abundance by second generation sequencing, taking the sequence abundance as a reference of the original library plasmid,
sequencing-random-F: GACAACTCCAGTGAAAAGTTC
sequencing-random-R: CTATGTAACAATTTTAAACTC
Finally, the sequence enriched in the significantly reduced fluorescence strain was ATGATTGCCT, indicating that it is the binding motif of XRE, by comparison of the significantly reduced fluorescence strain with the control phase sequencing results.
The XRE regulated target gene was further searched on the genome based on this motif, and 8740 was found to be its directly regulated target gene. Comparing the gene expression profile of the XRE deleted strain with the expression profile of the XRE and 8740 double gene deleted strain, the virulence related gene expression and phenotype affected by XRE are found to be recovered in the double gene deleted strain. It was demonstrated that XRE regulates a range of virulence gene expression by affecting 8740 gene expression, thereby regulating virulence.
The invention has the beneficial effects that:
the technology for analyzing the interaction of the microorganism transcription factor and the nucleic acid, which is provided by the invention, can be used for rapidly and simply analyzing the combination of the transcription factor and the target DNA, does not need to express and purify the target protein in vitro for analysis, can easily reflect the relative combination capacity by detecting the change of fluorescence intensity, and is suitable for analyzing the combination of the transcription factor and the DNA in a large scale; and through flow cytometry sorting, the binding motif of the transcription factor can be rapidly identified, so that an important technology is provided for the construction of a global transcription regulation network. And further lays a technical foundation for understanding the regulation and control of the microbial life activities, analyzing pathogenic mechanisms of pathogenic bacteria, identifying novel drug targets and modifying industrial microorganisms to improve the production level of active substances.
Drawings
FIG. 1 reports a plasmid map of plasmid p18T-eno-T10-GFP-X
FIG. 2 is a graph showing the results of example 2 analysis of binding of microbial transcription factors to their target motifs;
in the figure, a is a BL21 induction diagram without IPTG, and b is a BL211/WIPTG induction diagram;
a is p18T-eno-Y1-GFP-CcpA and B is p18T-eno-Y2-GFP-CcpA
C is p18T-eno-Y2-GFP-CcpA and D is p18T-eno-Y2-GFP-CcpA
E is p18T-eno-Y2-GFP-CcpA and F is p18T-eno-Y1-GFP-CcpA
FIG. 3 is a schematic representation of the high throughput identification of the binding motif of transcription factors of example 3.
In the figure, a is a plasmid map of a reporter plasmid p18T-eno-N10-GFP-X, b is an N10 insertion site map, and c is a map of transcription factor binding motifs identified for flow sorting in combination with high throughput sequencing.
Detailed Description
The present invention is described in further detail below in conjunction with specific embodiments for understanding by those skilled in the art.
Example 1
The fluorescence report plasmid p18T-eno-T10-GFP is based on pMDT18T plasmid, and the promoter sequence +T10 sequence of streptococcus suis ENolase gene (T10 is 10 continuous thymine T) +sfGFP gene) is inserted between CAGTGAGCGCAACGCAATTAATGTGTTTCG and GCTTGCATGCCTGCAGGTCGACGAT of the multiple cloning site region of pMDT18T plasmid, and the nucleotide sequence of the connection of the three is shown in SEQ ID NO: 1:
TATATTACTCTCCTTTGAGTTTAAAATTGTTACATAGCTATCATACCCTAAAAGAAGGGATTTTTCAAGAAAAAACAGGTTATTTTACNNNNNNNNNNNNNNNTGAAAGAAATAATGTAAACGCCTTCCTTTTCAAAGTTAACTGAGTATGTTATACTGAAACCATGAACGATTTAAATACTACCATACTACAGAAAGCCTCTGGCGAAACA (promoter sequence of Streptococcus suis ENolase gene) TTTTTTTTTTTTTGTATAGTTCATCCATGCCATGTGTAATCCCAGCAGCCGTTACAAACTCAAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTCGAAAGGGCAGATTGTGTGGACAGGTAATGGTTGTCTGGTAAAAGGACAGGGTCATCGCCAATTGGAGTATTTTGTTGATAATGATCAGCGAGTTGCACGCCGCCGTCTTCGATGTTGTGGCGGGTCTTGAAGTTGGCTTTGATGCCGTTCTTTTGCTTGTCGGCCATGATGTATACGTTGTGGGAGTTGTAGTTGTATTCCAACTTGTGGCCGAGGATGTTTCCGTCCTCCTTGAAATCGATTCCCTTAAGCTCGATCCTGTTGACGAGGGTGTCTCCCTCAAACTTGACTTCAGCACGTGTCTTGTAGTTCCCGTCGTCCTTGAAGAAGATGGTCCTCTCCTGCACGTATCCCTCAGGCATGGCGCTCTTGAAGAAGTCGTGCCGCTTCATATGATCTGGATATCTTGAAAAGCATTGAACACCATAAGTGAGAGTAGTGACAAGTGTTGGCCATGGAACAGGTAGTTTTCCAGTAGTGCAAATAAATTTAAGGGTAAGTTTTCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAAAATTTGTACCCATTAACATCACCATCTAATTCAACAAGAATTGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCAT (sfGFP gene).
The construction method of the report plasmid p18T-eno-T10-GFP comprises the following steps:
1) PCR amplification was performed using a commercial pMDT18T plasmid as a template and the following MDT 18T-sfGFP-linearization primer to obtain a vector sequence containing E.coli promoter, resistance gene fragment, and fragment of T7 promoter element,
pMDT 18T-sfGFP-linearization-F: TCTCTAGAGGATCCCCGGGTA, pMDT 18T-sfGFP-linearization-R: ATCGTCGACCTGCAGGCATGC;
2) Synthesizing a promoter sequence, a T10 sequence and an sfGFP gene sequence of the streptococcus suis ENolase gene; the ENolase promoter+T10 sequence+sfGFP binding sequence amplified using the 18T-ENO-10T-GFP primer,
18T-ENO-10T-GFP-F：
CAATTAATGTGTTTCGCCAGAGGCTTTCTG，
18T-ENO-10T-GFP-R：
CAATTAATGTGTTTCGCCAGAGGCTTTCTG；
3) And (2) connecting the binding sequence of the ENolase promoter +T10+sfGFP obtained in the step (2) with the carrier sequence obtained in the step (1) by using an infusion technology, converting the connected product into an escherichia coli TOP10 strain, and constructing a reporter plasmid p18T-eno-T10-GFP by observing green fluorescence according to ampicillin antibiotic screening and a fluorometer to confirm the strain.
The plasmid is transformed into escherichia coli BL21 (DE 3), and obvious green fluorescence can be seen by naked eyes or a green fluorescence detector under ultraviolet excitation. And the fluorescence does not change obviously under the IPTG induction condition. It is demonstrated that the fluorescence generated by sfGFP expressed by the plasmid after being transformed into escherichia coli is not influenced by the condition of IPTG induction, and the plasmid can be used for analyzing fluorescence change caused by the influence of binding DNA motif on sfGFP protein expression after the expression of IPTG induction transcription factor.
Example 2
The application of identifying the combination of the transcription factor CcpA and the target motif in analyzing the pathogenic mechanism of streptococcus suis CcpA is as follows:
1) The streptococcus suis genome is used as a template, and the nucleotide sequences of transcription factors CcpA and CcpA of streptococcus suis are shown in SEQ ID NO. 2:
TCACTTAGTTGATTTACGTACTTTGATTCCGTGGTTAAGAACTACCTCACGGTTTTCCAACTCTTCCTTGTGCATGATTTTGGTAAGCATGCGCATAGCAATTGCACCAATATCATATAGTGGCTGATTGATAGAGGTCAGGTTTGGACGGGTAAACTTAGTCACTAGGGAATCATCACTTGTGATGATTTCAAAATCTTCCGGAACCTTGATGCCCATATCACTGACACCGTTCAATAGACCTGCAGCAATCTCATCTTCTGCAACATAAGCTGCAGTTGCTCCGGCATTCAAAATACGTTCTGCTAGAGCGTAGCCTTCCTCGTATTTATACTTGGATTCAAAAACCAATCCTTCGTTAAACTCGATTCCGTTGTCCTTCAAGCCTTGTTTGTAGCCTGCAAAACGAACTTTACCGTTGATGTCATCTACAAGCGGCCCTGATACAAAGGCAATTTTCTTGTTGTTCTTAGCTAATAGATTGACTGCATCAACACTAGCGGCAGCGTAGTCAATATTGACGCTAGGTAATTGGTGCTCCAAGTCCACGGTACCAGCTAAAACAATCGGTGTACGTGAGCGTGAAAACTCCGCACGAATCTTGTCTGTCAAATGATAGCCCATGAAAATGATTCCGTCCACCTGTTTTGAGAATAGGGTATTTACCACATTGATTTCTTTCTCATCATTTTCATCACTGTTTGCTAGGACGATATTGTATTTGTACATATCGGCAATATCATCAATACCTTTGGCCAAGGTTGCAAAATAAGCATTAGCAATATTTGGAATCACAACCCCCACAGTGGTAGTCTTCTTGCTGGCCAATCCACGTGCAACAGCATTCGGACGATAATCCAAGCGGTCGATGACTTCTAATACTTTTTTACGAGTATTTTCCTTTACGTTTTTATTCCCATTTACCACGCGCGATACTGTCGCCATGGATACACCTGCTTCGCGGGCAACGTCATAAATCGTTACCGTATCGTCAGTGTTTAACAT
and the following primer p18T-CcpA was used to amplify the Streptococcus suis genome and the above sequence was constructed behind the T7 promoter of the reporter plasmid p18T-eno-T10-GFP obtained in example 1 to obtain the plasmid p18T-eno-T10-GFP-ccpA, wherein,
p18T-CcpA-F:
AAGGAGATATACCATGTTAAACACTGACGATACGG
p18T-CcpA-R:
TTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG
2) Respectively replacing the T10 sequences in the reporting plasmid p18T-eno-T10-GFP-ccpA in the step 1) with two target sequences Y1 and Y2 to be analyzed to respectively obtain p18T-eno-Y1-GFP-ccpA and p18T-eno-Y2-GFP-ccpA; wherein, the target sequence Y1 is TGAAAACGTTTT and the target sequence Y2 is AGAAAATGCTTACA;
3) The reporter plasmids p18T-eno-Y1-GFP-ccpA and p18T-eno-Y2-GFP-ccpA in the step 2) are respectively transferred into an escherichia coli BL21 (DE 3) strain, and obvious green fluorescence is observed through ampicillin antibiotic screening and a fluorometer to confirm that the construction of the detection strains is correct.
4) E.coli BL21 containing the p 18T-eno-Y1-GFP-CpA plasmid and E.coli BL21 containing the p 18T-eno-Y2-GFP-CpA plasmid were cultured on IPTG-free and IPTG-containing plates, respectively, and changes in fluorescence were observed:
if the fluorescence intensity of the colony added with the IPTG plate is obviously reduced compared with that of the colony without the IPTG, the transcription factor gene CcpA can be combined with the target sequence Y1 (TGAAAACGTTTT), so that the sfGFP expressed by eno is inhibited, and the fluorescence is reduced; when the fluorescence intensity of the colony added with the IPTG plate is not significantly reduced compared with that of the colony without the IPTG, it is indicated that the transcription factor gene CcpA cannot bind to the target sequence Y2 (TGAAAACGTTTT), and thus the fluorescence intensity is not reduced.
Searching for the Y1 sequence (TGAAAACGTTTT) on the whole genome of Streptococcus suis and combining with the function of the CcpA gene found that the glgC contained the Y1 (TGAAAACGTTTT) sequence, indicated that the glgC was its target gene, while the CcpA gene was found to regulate pathogenicity by regulating the expression of the glgC target gene (consistent with the reported CcpA binding motif), indicated that this technique could be used to analyze the interaction of transcription factors and nucleic acids.
Example 3
The use of the binding motif of transcription factor XRE identified and used in the construction of XRE transcription factor regulatory networks as shown in figure 3, the method of use being as follows:
1) Amplifying transcription factor XRE (mainly DNA binding domain) gene for obviously regulating and controlling streptococcus suis virulence, wherein the nucleotide sequence is shown as SEQ ID NO. 3, constructing the sequence into a T7 promoter of a reporter plasmid p18T-eno-T10-GFP obtained in example 1 to obtain a plasmid p18T-eno-T10-GFP-XRE;
2) The amplification of p18T-eno-T10-GFP-XRE with primer 18T-random will result in a plurality of DNA sequences NX from a random combination of 15 nucleotides,
respectively replacing T10 in the reporter plasmid p18T-eno-T10-GFP-XRE of the step 1) by each DNA sequence NX, so as to obtain the reporter plasmid p18T-eno-NX-GFP-X, and thus obtaining a reporter plasmid library containing a binding motif; wherein the method comprises the steps of
18T-random-F：
CAGGTTATTTTACNNNNNNNNNNTGAAAGAAATAATGTAAACGCCTTC
18T-random-R：
CATTATTTCTTTCANNNNNNNNNNGTAAAATAACCTGTTTTTTCTTG
3) The plasmids in the plasmid library are respectively and efficiently transformed into escherichia coli through electrotransformation, and strain libraries are prepared through screening of ampicillin resistance genes;
4) The strain library containing the plasmid library p18T-eno-N10-GFP-XRE was induced by IPTG, and then E.coli with significantly reduced expression level of sfGFP fluorescence was sorted by flow cytometry.
5) The sorted strains with significantly reduced fluorescence are subjected to amplification culture, then plasmid libraries contained in bacteria are extracted as templates, and the N10 sequences in p18T-eno-N10-GFP-X are amplified through PCR (polymerase chain reaction) low cycle (10-15 cycles) by using sequencing-random primers, and the sequence characteristics are obtained through second generation sequencing. Extracting plasmid after enlarging the strain which is not sorted, amplifying N10 sequence in p18T-eno-N10-GFP-X by PCR low circulation, obtaining the sequence abundance by second generation sequencing, taking the sequence abundance as a reference of the original library plasmid,
sequencing-random-F: GACAACTCCAGTGAAAAGTTC
sequencing-random-R: CTATGTAACAATTTTAAACTC
Finally, the sequence enriched in the significantly reduced fluorescence strain was ATGATTGCCT, indicating that it is the binding motif of XRE, by comparison of the significantly reduced fluorescence strain with the control phase sequencing results.
XRE regulated target genes were searched on the genome based on this motif, and 8740 was found to be its directly regulated target gene. Comparing the gene expression profile of the XRE deleted strain with the expression profile of the XRE and 8740 double gene deleted strain, the virulence related gene expression and phenotype affected by XRE are found to be recovered in the double gene deleted strain. It was demonstrated that XRE regulates a range of virulence gene expression by affecting 8740 gene expression, thereby regulating virulence.
Other parts not described in detail are prior art. Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims (9)

1. A fluorescent reporter plasmid p18T-eno-T10-GFP for analyzing and identifying the interaction of transcription factors with nucleic acids, characterized by: the fluorescent reporter plasmid p18T-eno-T10-GFP is based on pMDT18T plasmid, and the promoter sequence +T10 sequence +sfGFP gene of streptococcus suis ENolase gene is inserted into the region of the multiple cloning site of pMDT18T plasmid, and the nucleotide sequence of the connection of the three is shown as SEQ ID NO. 1.
2. The fluorescence reporter plasmid p18T-eno-T10-GFP of claim 1, wherein: the promoter sequence of the streptococcus suis enoase gene + T10 sequence + sfGFP gene sequence is inserted between sequence CAGTGAGCGCAACGCAATTAATGTGTTTCG and sequence GCTTGCATGCCTGCAGGTCGACGAT.
3. A method for constructing a fluorescence reporter plasmid p18T-eno-T10-GFP according to claim 1, characterized by: the method comprises the following steps:
1) PCR amplification was performed using the pMDT18T plasmid as a template and the following MDT 18T-sfGFP-linearization primer to obtain a vector sequence containing E.coli promoter, resistance gene fragment, and fragment of T7 promoter element,
pMDT 18T-sfGFP-linearization-F: TCTCTAGAGGATCCCCGGGTA the number of the individual pieces of the plastic,
pMDT 18T-sfGFP-linearization-R: ATCGTCGACCTGCAGGCATGC;
2) Synthesizing a section of sequence containing a promoter sequence, a T10 sequence and an sfGFP gene of streptococcus suis ENolase gene; the ENO-10T-GFP primer was used to amplify the binding sequence of the ENolase promoter+T10 sequence+sfGFP,
18T-ENO-10T-GFP-F：
CAATTAATGTGTTTCGCCAGAGGCTTTCTG，
18T-ENO-10T-GFP-R：
CAATTAATGTGTTTCGCCAGAGGCTTTCTG；
3) And (2) connecting the combined sequence of the ENolase promoter +T10+sfGFP gene obtained in the step (2) with the carrier sequence obtained in the step (1) by using an infusion technology, converting the connected product into an escherichia coli TOP10 strain, and constructing a reporter plasmid p18T-eno-T10-GFP by observing green fluorescence according to ampicillin antibiotic screening and a fluorometer to confirm the strain.
4. A method for analyzing binding of a transcription factor to a target DNA sequence, comprising: the method comprises the following steps:
1) Constructing a gene corresponding to the transcription factor X to be analyzed behind the T7 promoter of the reporter plasmid p18T-eno-T10-GFP of claim 1 to obtain a plasmid p18T-eno-T10-GFP-X;
2) Replacing the target sequence Y to be analyzed with the T10 sequence in front of sfGFP of the reporter plasmid p18T-eno-T10-GFP-X in the step 1) to obtain the reporter plasmid p18T-eno-Y-GFP-X;
3) Transferring the reporter plasmid p18T-eno-Y-GFP-X obtained in the step 2) into an escherichia coli BL21 (DE 3) strain, and observing green fluorescence by using an ampicillin antibiotic screening and a fluorometer to confirm the strain;
4) Coli BL21 containing p18T-eno-Y-GFP-X plasmid was cultured on IPTG-free and IPTG-containing plates, respectively, and changes in fluorescence were observed for both:
if the fluorescence intensity of the colony added with the IPTG plate is obviously reduced compared with that of the colony without the IPTG, the transcription factor X can be combined with the target sequence Y, so that the eno-initiated expression of sfGFP is inhibited, and the fluorescence is reduced; alternatively, if the fluorescence intensity of colonies added to the IPTG plate does not exhibit a significant decrease in comparison with colonies without IPTG, it is indicated that the transcription factor X cannot bind to the target sequence Y, and thus the fluorescence intensity is not decreased.
5. Use of the method of claim 3 for identifying the pathogenic mechanism of the binding of transcription factor CcpA to target motif resolving streptococcus suis CcpA.
6. The use according to claim 5, characterized in that: the application method comprises the following steps:
1) Using streptococcus suis genome as a template, amplifying a gene of a transcription factor CcpA of streptococcus suis by using the following primer p 18T-CpA, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 2; and constructing the above sequence behind the T7 promoter of the reporter plasmid p18T-eno-T10-GFP of claim 1 to obtain the plasmid p18T-eno-T10-GFP-ccpA, wherein,
p18T-CcpA-F：GAAGGAGATATACCATGTTAAACACTGACGATACGG，
p18T-CcpA-R：GTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG；
2) Respectively replacing the T10 sequences in the reporting plasmid p18T-eno-T10-GFP-ccpA in the step 1) with two target sequences Y1 and Y2 to be analyzed to respectively obtain p18T-eno-Y1-GFP-ccpA and p18T-eno-Y2-GFP-ccpA; wherein, the target sequence Y1 is TGAAAACGTTTT and the target sequence Y2 is AGAAAATGCTTACA;
3) Transferring the reporter plasmids p18T-eno-Y1-GFP-ccpA and p18T-eno-Y2-GFP-ccpA in the step 2) into an escherichia coli BL21 (DE 3) strain respectively, observing obvious green fluorescence through ampicillin antibiotic screening and a fluorometer, and confirming that the construction of the detection strains is correct;
4) E.coli BL21 containing the p 18T-eno-Y1-GFP-CpA plasmid and E.coli BL21 containing the p 18T-eno-Y2-GFP-CpA plasmid were cultured on IPTG-free and IPTG-containing plates, respectively, and changes in fluorescence were observed:
if the fluorescence intensity of the colony added with the IPTG plate is obviously reduced compared with that of the colony without the IPTG, the transcription factor gene CcpA can be combined with the target sequence Y1, so that the eno-initiated expression of sfGFP is inhibited, and the fluorescence is reduced;
alternatively, when the fluorescence intensity of colonies added with IPTG plates does not exhibit a significant decrease compared to colonies without IPTG, it is indicated that the transcription factor gene CcpA cannot bind to the target sequence Y2, and thus the fluorescence intensity is not decreased.
7. A method of identifying a transcription factor binding motif, comprising: the method comprises the following steps:
1) Constructing a gene corresponding to the transcription factor X to be analyzed into a T7 promoter of the reporter plasmid p18T-eno-T10-GFP of claim 1 to obtain a plasmid p18T-eno-T10-GFP-X;
2) Randomly combining 8-15 nucleotides to form a plurality of DNA sequences N X Wherein, the method comprises the steps of, wherein, X numbering 1, 2, 3, 4, 5 … … for the sequences;
each DNA sequence N X The T10 sequence of the reporter plasmid p18T-eno-T10-GFP-X of step 1) was replaced, respectively, to thereby report the plasmid p18T-eno-N X -GFP-X, thereby yielding a library of reporter plasmids containing binding motifs;
3) Plasmid p18T-eno-N of the plasmid library X Efficient transformation of GFP-X into E.coli by electrotransformation, respectivelyIn (3) preparing a strain library by screening an ampicillin resistance gene;
4) Inducing the strain library through IPTG, analyzing the expression level of sfGFP fluorescence of the strain through flow cytometry, and sorting the strain with obviously reduced fluorescence;
5) Amplifying and culturing the strain with obviously reduced fluorescence, extracting plasmid library contained in bacteria as template, and PCR low-cycle amplifying p18T-eno-N X N in GFP-X X Sequence, sequence characteristics thereof are obtained by second generation sequencing,
at the same time, the strains which are not sorted are amplified and then plasmids are extracted, and the p18T-eno-N is amplified in a low cycle by the same PCR X N in GFP-X X The sequence is obtained through second generation sequencing, and the sequence abundance is used as a reference of a starting library plasmid; comparing the two parts of sequencing results, if the sequencing results show that compared with the control, the fluorescence of the strain is obviously reduced, and the sequence is a target sequence combined with transcription factors.
8. Use of the method of claim 7 for identifying binding motifs of transcription factors XRE and for constructing XRE transcription factor regulatory networks.
9. The use according to claim 8, characterized in that: the application method comprises the following steps:
1) Amplifying a gene of a transcription factor XRE for remarkably regulating and controlling the virulence of streptococcus suis, wherein the nucleotide sequence is shown as SEQ ID NO. 3, and constructing the sequence into a T7 promoter of a reporter plasmid p18T-eno-T10-GFP according to claim 1 to obtain a plasmid p18T-eno-T10-GFP-XRE;
2) Amplification of p18T-eno-T10-GFP-XRE with primer 18T-random, multiple DNA sequences N will be formed from random combinations of 15 nucleotides X ，
Each DNA sequence N X The reporter plasmid p18T-eno-T10-GFP-XRE of step 1) was replaced with T10, respectively, to thereby report the plasmid p18T-eno-N X GFP-X, thereby obtaining a library of reporter plasmids containing binding motifs; wherein the method comprises the steps of
18T-random-F：
CAGGTTATTTTACNNNNNNNNNNTGAAAGAAATAATGTAAACGCCTTC，
18T-random-R：
CATTATTTCTTTCANNNNNNNNNNGTAAAATAACCTGTTTTTTCTTG；
3) The plasmids in the plasmid library are respectively and efficiently transformed into escherichia coli through electrotransformation, and strain libraries are prepared through screening of ampicillin resistance genes;
4) Inducing a strain library containing a plasmid library p18T-eno-N10-GFP-XRE by IPTG, and then sorting escherichia coli with significantly reduced expression level of sfGFP fluorescence by a flow cytometry;
5) Performing amplification culture on the strain with obviously reduced fluorescence, extracting a plasmid library contained in bacteria as a template, performing PCR low-cycle amplification on an N10 sequence in p18T-eno-N10-GFP-X by using a sequencing-random primer, and performing second-generation sequencing to obtain sequence characteristics; extracting plasmid after enlarging the strain which is not sorted, amplifying N10 sequence in p18T-eno-N10-GFP-X by PCR low circulation, obtaining the sequence abundance by second generation sequencing, taking the sequence abundance as a reference of the original library plasmid,
sequencing-random-F: GACAACTCCAGTGAAAAGTTC the number of the individual pieces of the plastic,
sequencing-random-R: CTATGTAACAATTTTAAACTC;
finally, the sequence enriched in the significantly reduced fluorescence strain was ATGATTGCCT, indicating that it is the binding motif of XRE, by comparison of the significantly reduced fluorescence strain with the control phase sequencing results.
CN202311813350.5A 2023-12-27 2023-12-27 Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof Pending CN117866994A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311813350.5A CN117866994A (en) 2023-12-27 2023-12-27 Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311813350.5A CN117866994A (en) 2023-12-27 2023-12-27 Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof

Publications (1)

Publication Number Publication Date
CN117866994A true CN117866994A (en) 2024-04-12

Family

ID=90580423

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311813350.5A Pending CN117866994A (en) 2023-12-27 2023-12-27 Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof

Country Status (1)

Country Link
CN (1) CN117866994A (en)

Similar Documents

Publication Publication Date Title
Bailey et al. Effects of synonymous mutations beyond codon bias: the evidence for adaptive synonymous substitutions from microbial evolution experiments
US6054278A (en) Ribosomal RNA gene polymorphism based microorganism identification
US20230242891A1 (en) Novel crispr dna and rna targeting enzymes and systems
JP2976406B2 (en) Nucleic acid probe
Beaume et al. Orientation and expression of methicillin-resistant Staphylococcus aureus small RNAs by direct multiplexed measurements using the nCounter of NanoString technology
US20230175078A1 (en) Rna detection and transcription-dependent editing with reprogrammed tracrrnas
Phok et al. Identification of CRISPR and riboswitch related RNAs among novel noncoding RNAs of the euryarchaeon Pyrococcus abyssi
US20220315913A1 (en) Novel crispr dna targeting enzymes and systems
Smolina et al. Detection of low-copy-number genomic DNA sequences in individual bacterial cells by using peptide nucleic acid-assisted rolling-circle amplification and fluorescence in situ hybridization
US20230016656A1 (en) Novel crispr dna targeting enzymes and systems
Coronel-Tellez et al. sRNA-controlled iron sparing response in Staphylococci
CA3153005A1 (en) Novel crispr dna targeting enzymes and systems
US20200392589A1 (en) Methods and systems for proteomic profiling and characterization
Gangras et al. Cloning and identification of recombinant argonaute-bound small RNAs using next-generation sequencing
CN117866994A (en) Fluorescent reporter plasmid for analyzing and identifying interaction of transcription factors and nucleic acids and application thereof
US6759195B1 (en) Method of differential display of prokaryotic messenger RNA by RTPCR
WO2008122097A1 (en) Synthesis of standards for detection and quantification of nucleic acids and kit
US7947440B2 (en) Method for determining the specific growth rate of a distinct cell population within a non-homogeneous system
WO2020209987A9 (en) High-throughput methods to characterize phage receptors and rational formulation of phage cocktails
CN112760308A (en) LdCsm-dCsm3 mutant complex, detection system containing complex and application of complex in RNA detection
Liao et al. New Method for Genome-Scale Functional Genomic Study in Bacteria with Superior Performance: CRISPR Interference Screen
Carrera et al. Artificial plasmid engineered to simulate multiple biological threat agents
Hollister et al. Nucleic Acid-Based Methods of Analysis
US20230374492A1 (en) Process for selection of aptamers, riboswitches and desoxyriboswitches
US7276358B1 (en) Rapid quantification of butyric acid-producing bacteria using real-time PCR

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination