CN117866919A - Mutant Pfu DNA polymerase with high amplification activity - Google Patents

Abstract

The invention discloses a mutant Pfu DNA polymerase with high amplification activity, which belongs to the technical field of genetic engineering, mutation sites are screened from an amino acid sequence shown as SEQ ID NO.1 for mutation, reverse translation is carried out, a template is obtained through gene synthesis, then PCR amplification is carried out, a PCR product and a linearization carrier are subjected to seamless cloning, plasmids are extracted, an expression carrier of the mutant Pfu DNA polymerase is constructed and transformed into competent cells, cells are amplified and cultured and collected, cells are crushed at a low temperature, centrifuged, supernatant fluid is collected, magnetic beads are purified, and eluted and purified proteins are collected to obtain the mutant Pfu DNA polymerase; the mutant Pfu DNA polymerase has reverse transcription activity, can simultaneously carry out transcription and amplification in the PCR process, can omit an additional reverse transcription step, has higher amplification activity, and is beneficial to improving the amplification efficiency.

Description

Mutant Pfu DNA polymerase with high amplification activity

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a mutant Pfu DNA polymerase with high amplification activity.

Background

DNA polymerase is a type of protein that replicates DNA in an organism, and has the activity of catalyzing the polymerization of deoxyribonucleotides in the 5 '. Fwdarw.3' direction, and the main function in the body is to replicate the genome in each cell division cycle to preserve genetic information, and in this process, the replication of DNA and the recombination and repair of DNA are completed by DNA polymerase. The DNA replication is mainly completed by some replicative DNA polymerases with high continuous synthesis capability, and some non-replicative DNA polymerases are responsible for filling the gaps generated in DNA replication, recombination and damage repair, and the polymerase has poor continuous synthesis capability. In addition, there is a special DNA polymerase: reverse Transcriptases (RTs), which typically synthesize a DNA strand complementary to an RNA template in RNA viruses and assemble into host DNA, direct subsequent transcription and replication processes.

As one of the most widely used group B polymerases used at present, pfu DNA polymerase was first isolated and purified from Thermomyces (Pyrococcus furiosus) in 1991, and its 3 '. Fwdarw.5' exoenzyme activity was verified, as well as higher enzyme activity than Taq DNA polymerase. The molecular weight of PfuDNA polymerase is about 90kDa, having activity to catalyze the polymerization of deoxyribonucleotides in the 5'→3' direction, and 3'→5' proofreading activity, but not having reverse transcription activity. In genetic engineering, reverse transcriptase is an important enzyme and is an important means for obtaining a target gene. Although the prior studies disclose some Pfu DNA polymerase having reverse transcriptase activity, its amplification efficiency is not as good as that of ordinary reverse transcriptase.

Disclosure of Invention

The invention aims to provide a mutant Pfu DNA polymerase with high amplification activity, which solves the problem that the prepared Pfu DNA polymerase with reverse transcriptase activity has low amplification efficiency.

The aim of the invention can be achieved by the following technical scheme:

a mutant Pfu DNA polymerase with high amplification activity, which is prepared by the steps of:

step one: searching the amino acid sequence of Pfu DNA polymerase (accession NC_ 003413.1) through NCBI website, as shown in SEQ ID NO. 1; screening mutation sites for mutation, wherein the mutated amino acid sequence is shown as SEQ ID NO.2, and reverse translation is carried out to obtain a polynucleotide sequence of mutant Pfu DNA polymerase shown as SEQ ID NO. 3;

step two: designing PFu primers according to the polynucleotide sequence of the mutant Pfu DNA polymerase, synthesizing the polynucleotide sequence gene of the mutant Pfu DNA polymerase to obtain a template, performing PCR amplification, linearizing the pET23a vector by using NotI restriction endonuclease and SacI restriction endonuclease, and then performing glue recovery to obtain a linearization vector; seamlessly cloning the PCR product and the linearization vector, verifying that the plasmid is extracted correctly by colony PCR, and constructing an expression vector of mutant Pfu DNA polymerase;

step three: transforming the expression vector of the mutant Pfu DNA polymerase into competent cells E.coli BL21 (DE 3), collecting thalli after expansion culture, crushing at low temperature, centrifuging, collecting supernatant, purifying by magnetic beads, eluting and collecting purified protein to obtain the mutant Pfu DNA polymerase.

Further, the mutation sites were screened as follows:

G149L、K465F、T515R、I549K、E646I、A684V、V764L

further, the PFu primer includes a forward primer Pfu-F (5 '. Fwdarw.3') and a reverse primer Pfu-R (5 '. Fwdarw.3'), the specific sequences are as follows:

Pfu-F：catcatcatcatcatagcagcggcattttagacgtgcattacataactg

Pfu-R：cggatctcactcgagttttttaatgttaagggaccaagttaggc

the invention has the beneficial effects that:

the mutant Pfu DNA polymerase has reverse transcription activity, can simultaneously carry out transcription and amplification in the PCR process, can omit an additional reverse transcription step, and is beneficial to improving the amplification efficiency; and the result of gel electrophoresis shows that the quantity of PCR products which are not subjected to the reverse transcription step is not reduced, which indicates that the mutant Pfu DNA polymerase has higher amplification activity.

Drawings

The invention is further described below with reference to the accompanying drawings.

FIG. 1 is a standard graph of the enzyme activity test of example 4 of the present invention;

FIG. 2 is a gel electrophoresis chart of the reverse transcription activity test of example 5 of the present invention.

Detailed Description

The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1: preparation of polynucleotides of mutant Pfu DNA polymerase

The amino acid sequence of Pfu DNA polymerase (accession NC-003413.1) was found by NCBI website as shown in SEQ ID NO. 1:

MILDVDYITEEGKPVIRLFKKENGKFKIEHDRTFRPYIYALLRDDSKIEEVKKITGERHGKIVRIVDVEKVEKKFLGKPITVWKLYLEHPQDVPTIREKVREHPAVVDIFEYDIPFAKRYLIDKGLIPMEGEEELKILAFDIETLYHEGEEFGKGPIIMISYADENEAKVITWKNIDLPYVEVVSSEREMIKRFLRIIREKDPDIIVTYNGDSFDFPYLAKRAEKLGIKLTIGRDGSEPKMQRIGDMTAVEVKGRIHFDLYHVITRTINLPTYTLEAVYEAIFGKPKEKVYADEIAKAWESGENLERVAKYSMEDAKATYELGKEFLPMEIQLSRLVGQPLWDVSRSSTGNLVEWFLLRKAYERNEVAPNKPSEEEYQRRLRESYTGGFVKEPEKGLWENIVYLDFRALYPSIIITHNVSPDTLNLEGCKNYDIAPQVGHKFCKDIPGFIPSLLGHLLEERQKIKTKMKETQDPIEKILLDYRQKAIKLLANSFYGYYGYAKARWYCKECAESVTAWGRKYIELVWKELEEKFGFKVLYIDTDGLYATIPGGESEEIKKKALEFVKYINSKLPGLLELEYEGFYKRGFFVTKKRYAVIDEEGKVITRGLEIVRRDWSEIAKETQARVLETILKHGDVEEAVRIVKEVIQKLANYEIPPEKLAIYEQITRPLHEYKAIGPHVAVAKKLAAKGVKIKPGMVIGYIVLRGDGPISNRAILAEEYDPKKHKYDAEYYIENQVLPAVLRILEGFGYRKEDLRYQKTRQVGLTSWLNIKKS

the number of the amino acid sequences is 775, the 1 st to 130 th amino acid at the N end and the 327 th to 368 th amino acid are N-terminal domains, the 131 th to 326 th amino acids are 3 '. Fwdarw.5' exonuclease activity domains, the 369 th to 450 th amino acids and the 501 th to 588 th amino acids are palm domains, the 451 th to 500 th amino acids are finger domains, and the 589 th to 775 th amino acids are thumb domains.

The mutation site of an amino acid is represented by the expression "letter-number-letter", the former letter representing the amino acid before mutation, the middle number representing the mutation position of the amino acid in the sequence, and the latter letter representing the amino acid after mutation.

Downloading the three-dimensional structure of KOD DNA polymerase combined with dsDNA and the three-dimensional structure of RTX DNA polymerase combined with DNA/RNA through a PDB database (website address: www.rcsb.org), comparing the amino acid sequences of the two, determining mutation amino acid sites of the RTX DNA polymerase, carrying out homologous modeling on Pfu DNA polymerase by taking the structure of the KOD DNA polymerase as a template (website address: swissmodel. Expasy. Org), and screening the following mutation sites through structural comparison:

G149L (glycine to leucine), K465F (lysine to phenylalanine), T515R (threonine to arginine), I549K (isoleucine to lysine), E646I (glutamic acid to isoleucine), A684V (alanine to valine), V764L (valine to leucine)

The amino acid sequence after mutation is shown as SEQ ID NO. 2:

MILDVDYITEEGKPVIRLFKKENGKFKIEHDRTFRPYIYALLRDDSKIEEVKKITGERHGKIVRIVDVEKVEKKFLGKPITVWKLYLEHPQDVPTIREKVREHPAVVDIFEYDIPFAKRYLIDKGLIPMEGEEELKILAFDIETLYHELEEFGKGPIIMISYADENEAKVITWKNIDLPYVEVVSSEREMIKRFLRIIREKDPDIIVTYNGDSFDFPYLAKRAEKLGIKLTIGRDGSEPKMQRIGDMTAVEVKGRIHFDLYHVITRTINLPTYTLEAVYEAIFGKPKEKVYADEIAKAWESGENLERVAKYSMEDAKATYELGKEFLPMEIQLSRLVGQPLWDVSRSSTGNLVEWFLLRKAYERNEVAPNKPSEEEYQRRLRESYTGGFVKEPEKGLWENIVYLDFRALYPSIIITHNVSPDTLNLEGCKNYDIAPQVGHKFCKDIPGFIPSLLGHLLEERQKIFTKMKETQDPIEKILLDYRQKAIKLLANSFYGYYGYAKARWYCKECAESVRAWGRKYIELVWKELEEKFGFKVLYIDTDGLYATKPGGESEEIKKKALEFVKYINSKLPGLLELEYEGFYKRGFFVTKKRYAVIDEEGKVITRGLEIVRRDWSEIAKETQARVLETILKHGDVEEAVRIVKIVIQKLANYEIPPEKLAIYEQITRPLHEYKAIGPHVAVVKKLAAKGVKIKPGMVIGYIVLRGDGPISNRAILAEEYDPKKHKYDAEYYIENQVLPAVLRILEGFGYRKEDLRYQKTRQLGLTSWLNIKKS

and (3) reversely translating the mutated amino acid sequence to obtain a polynucleotide sequence of the mutant PfuDNA polymerase, wherein the polynucleotide sequence is shown as SEQ ID NO. 3:

atgattctggatgtggattatattaccgaagaaggcaaaccggtgattcgcctgtttaaaaaagaaaacggcaaatttaaaattgaacatgatcgcacctttcgcccgtatatttatgcgctgctgcgcgatgatagcaaaattgaagaagtgaaaaaaattaccggcgaacgccatggcaaaattgtgcgcattgtggatgtggaaaaagtggaaaaaaaatttctgggcaaaccgattaccgtgtggaaactgtatctggaacatccgcaggatgtgccgaccattcgcgaaaaagtgcgcgaacatccggcggtggtggatatttttgaatatgatattccgtttgcgaaacgctatctgattgataaaggcctgattccgatggaaggcgaagaagaactgaaaattctggcgtttgatattgaaaccctgtatcatgaactggaagaatttggcaaaggcccgattattatgattagctatgcggatgaaaacgaagcgaaagtgattacctggaaaaacattgatctgccgtatgtggaagtggtgagcagcgaacgcgaaatgattaaacgctttctgcgcattattcgcgaaaaagatccggatattattgtgacctataacggcgatagctttgattttccgtatctggcgaaacgcgcggaaaaactgggcattaaactgaccattggccgcgatggcagcgaaccgaaaatgcagcgcattggcgatatgaccgcggtggaagtgaaaggccgcattcattttgatctgtatcatgtgattacccgcaccattaacctgccgacctataccctggaagcggtgtatgaagcgatttttggcaaaccgaaagaaaaagtgtatgcggatgaaattgcgaaagcgtgggaaagcggcgaaaacctggaacgcgtggcgaaatatagcatggaagatgcgaaagcgacctatgaactgggcaaagaatttctgccgatggaaattcagctgagccgcctggtgggccagccgctgtgggatgtgagccgcagcagcaccggcaacctggtggaatggtttctgctgcgcaaagcgtatgaacgcaacgaagtggcgccgaacaaaccgagcgaagaagaatatcagcgccgcctgcgcgaaagctataccggcggctttgtgaaagaaccggaaaaaggcctgtgggaaaacattgtgtatctggattttcgcgcgctgtatccgagcattattattacccataacgtgagcccggataccctgaacctggaaggctgcaaaaactatgatattgcgccgcaggtgggccataaattttgcaaagatattccgggctttattccgagcctgctgggccatctgctggaagaacgccagaaaatttttaccaaaatgaaagaaacccaggatccgattgaaaaaattctgctggattatcgccagaaagcgattaaactgctggcgaacagcttttatggctattatggctatgcgaaagcgcgctggtattgcaaagaatgcgcggaaagcgtgcgcgcgtggggccgcaaatatattgaactggtgtggaaagaactggaagaaaaatttggctttaaagtgctgtatattgataccgatggcctgtatgcgaccaaaccgggcggcgaaagcgaagaaattaaaaaaaaagcgctggaatttgtgaaatatattaacagcaaactgccgggcctgctggaactggaatatgaaggcttttataaacgcggcttttttgtgaccaaaaaacgctatgcggtgattgatgaagaaggcaaagtgattacccgcggcctggaaattgtgcgccgcgattggagcgaaattgcgaaagaaacccaggcgcgcgtgctggaaaccattctgaaacatggcgatgtggaagaagcggtgcgcattgtgaaaattgtgattcagaaactggcgaactatgaaattccgccggaaaaactggcgatttatgaacagattacccgcccgctgcatgaatataaagcgattggcccgcatgtggcggtggtgaaaaaactggcggcgaaaggcgtgaaaattaaaccgggcatggtgattggctatattgtgctgcgcggcgatggcccgattagcaaccgcgcgattctggcggaagaatatgatccgaaaaaacataaatatgatgcggaatattatattgaaaaccaggtgctgccggcggtgctgcgcattctggaaggctttggctatcgcaaagaagatctgcgctatcagaaaacccgccagctgggcctgaccagctggctgaacattaaaaaaagc

example 2: construction of expression vectors for mutant Pfu DNA polymerase

PFu primers, including a forward primer Pfu-F (5 '. Fwdarw.3') and a reverse primer Pfu-R (5 '. Fwdarw.3'), were designed based on the polynucleotide sequence of the mutant Pfu DNA polymerase, and specific sequences are as follows:

Pfu-F：catcatcatcatcatagcagcggcattttagacgtgcattacataactg

Pfu-R：cggatctcactcgagttttttaatgttaagggaccaagttaggc

the polynucleotide sequence gene of the mutant Pfu DNA polymerase was synthesized to obtain a template, and then PCR amplification (98 ℃,3min,68 ℃,15s,72 ℃,25 cycles, 5 min) was performed to obtain a PCR product. The PCR system is shown in Table 1:

TABLE 1

Component (A)	Volume of
		Stencil (1 ng/. Mu.L)	1μL
Pfu-F	0.5μL
		Pfu-R	0.5μL
Polymerase Mix	5μL
		Purified water	Make up to 10mu L

And linearizing the pET23a vector by using NotI restriction enzyme and SacI restriction enzyme, and then carrying out glue recovery to obtain the linearization vector. The PCR products and linearization vectors were seamlessly cloned using a general biosystems (Anhui) Co., ltd. Seamless cloning reagent, 2X GenRec Master mix (cat# CL 07010), and the reaction system is shown in Table 2:

TABLE 1

Reagent(s)	Addition amount of
		2×GenRec MasterMix	10μL
Linearization carrier	80ng
		PCR products	20ng
Sterile water	Make up to 20mu L

Reacting the mixed reaction system at a constant temperature of 50 ℃ for 30min, and placing the mixed reaction system on ice for 5min to obtain a reaction solution; placing chemically converted competent cells in a centrifuge tube and thawing on ice; 10. Mu.L of the reaction solution was added to competent cells and mixed well, and ice-bathed for 10min.

Placing the centrifuge tube in a water bath at 42 ℃ for heat shock for 90s, then rapidly carrying out ice bath for 3min to cool the cells, adding 600 mu L of sterile LB culture solution preheated to 37 ℃ into the centrifuge tube, and carrying out constant-temperature shaking culture at 37 ℃ for 60min.

The supernatant was centrifuged off, 100. Mu.L of fresh LB medium was aspirated for resuspension, and the bacterial solution was spread evenly on plates containing the appropriate antibiotics. The plate was inverted and incubated overnight at 37℃and then individual colonies were picked with a sterile gun or toothpick to 50. Mu.L LB medium and mixed well, and 1. Mu.L was used as PCR template for colony PCR using 2X Taq DNA Polymerase Master.

Bacterial colony PCR is used for verifying correct bacterial liquid to be cultivated in 100mL in an amplifying way, and then Plasmid extraction is carried out by using a Plasmid extraction Kit Plasmid Midi Kit of QIAGEN, so as to construct an expression vector of mutant Pfu DNA polymerase.

Example 3: expression of mutant Pfu DNA polymerase

Transforming the expression vector of the mutant Pfu DNA polymerase into E.coli BL21 (DE 3), and culturing the cells in an incubator at 37 ℃ for inversion overnight; multiple single transformed colonies were picked, inoculated into 400mL of liquid LA (LB, containing 100 μg/mL Amp) and subsequently fixed in a shaker at 37 ℃ at 220rpm for cultivation until od600=0.6; culturing the culture in a shaking table at 18 ℃ for 0.5h, adding IPTG with a final concentration of 1mM into the bacterial liquid in an aseptic environment of an ultra-clean workbench, and culturing in the shaking table at 18 ℃ for 18h at 220 rpm; after the induction was completed, the cells were collected by centrifugation at 6000rpm at 4℃for 10min, washed by resuspension of 30mL Pfu lysis Buffer (20 mM Tris-hydrochloric acid (pH 8.2), 0.1mM EDTA,100mM KCl) and stored at-80℃for further use by centrifugation at 7000rpm for 8 min.

Adding serine protease inhibitor with final concentration of 1mM into thallus, crushing at low temperature, centrifuging at 8000rpm and 4deg.C for 15min, collecting supernatant, purifying with magnetic beads, eluting, and collecting purified protein to obtain mutant Pfu DNA polymerase, and storing at-80deg.C for use.

Example 4: enzymatic detection of mutant Pfu DNA polymerase

The mutant Pfu DNA polymerase stored in example 3 was diluted to a concentration of 0 mU/. Mu.L, 10 mU/. Mu.L, 20 mU/. Mu.L, 50 mU/. Mu.L, 80 mU/. Mu.L, 100 mU/. Mu.L, 150 mU/. Mu.L by using Pfu storage Buffer (20 mM Tris-HCl (pH 8.2), 0.1mM EDTA,100mM KCl,1mM DTT,0.1% (V/V) N-P40,0.1% (V/V) Tween 20), respectively.

The following components were placed in a qPCR reaction tube and placed on ice: 10mu L2 XEvaEZ polymerase Activity cocktail, 9 mu L H ₂ Mixing O and 1 mu L of DNA polymerase sample gently to mix the reaction components thoroughly; the reaction tube was quickly placed in a real-time qPCR instrument. The isothermal procedure was run at 72℃for 60min, and fluorescence in channel 1 was measured every 30s. The experiment was repeated three times under each enzyme activity condition.

The slope of the initial linear portion of the curve was first calculated to determine the initial fluorescence acceleration for each polymerase dilution prior to fluorescence stabilization. Next, the slope generated at 0mU was subtracted from the initial slope of the standard DNA polymerase at each standard dilution, resulting in a net increase in enzyme activity. A standard curve is drawn by taking the enzyme activity as the X axis and the initial slope as the Y axis (refer to FIG. 1). Then, the slope of the mutant Pfu DNA polymerase was measured in the same manner, and the enzyme activity per unit mass was determined by a standard curve, and the final result was 5 mU/. Mu.L.

Example 5: reverse transcription Activity detection of mutant Pfu DNA polymerase

The following ingredients were added to the PCR tube:

5pmol of synthetic RNA (TEMP. A. RNA), 5pmol of the corresponding reverse primer (25 FAM), 0.4. Mu.g of mutant Pfu DNA polymerase, RNase Inhibitor

After being uniformly mixed, the mixture is subjected to thermal circulation, heated to 80 ℃ and maintained for one minute; annealing at a rate of 0.1 ℃/s until the temperature reaches 25 ℃; maintaining for 2 minutes; at this time, RNA forms a ternary complex with the enzyme and the primer, and then, is added to the mixed liquid after annealing: 10mM dNTPs 0.2. Mu.L, 1. Mu.L 10 XPCR Buffer, DEPC water were added to 10. Mu.L, and the reverse transcription system was placed in a thermal cycler and reacted at 72℃for 30s. Then rapidly cooling to 12 ℃, and reducing the activity termination reaction of the mutant Pfu DNA polymerase; next, a Blocker complementary to the RNA template is added to avoid the RNA template from affecting the detection result. An equal volume of 2X RNA loading buffer was added and incubated at 75℃for 5min. After the reaction, the product was separated by 20% denaturing polyacrylamide gel electrophoresis (nucleic acid PAGE) and visualized by a gel imaging instrument.

Referring to FIG. 2, M is Marker,1 is a positive control of PCR products after reverse transcription of commercial MMLV, 2 and 3 are control of PCR products of mutant Pfu DNA polymerase without reverse transcription step, and 4 and 5 are control of PCR products of mutant Pfu DNA polymerase with reverse transcription step.

The result shows that the prepared mutant Pfu DNA polymerase can simultaneously carry out transcription and amplification in the PCR process, can omit an additional reverse transcription step and has higher amplification activity.

It should be noted that in this document, terms such as "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made therein without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Claims (6)

1. A mutant Pfu DNA polymerase with high amplification activity, which is prepared by the steps of:

step one: screening mutation sites from the amino acid sequence shown as SEQ ID NO.1 for mutation and reverse translation to obtain a polynucleotide sequence of mutant Pfu DNA polymerase shown as SEQ ID NO. 3;

step two: designing PFu primers according to the polynucleotide sequence of the mutant Pfu DNA polymerase, synthesizing the polynucleotide sequence gene of the mutant Pfu DNA polymerase to obtain a template, then carrying out PCR amplification, linearizing the pET23a vector to obtain a linearization vector, seamlessly cloning a PCR product and the linearization vector, and verifying correct extraction of plasmids by colony PCR to construct an expression vector of the mutant Pfu DNA polymerase;

step three: transforming the expression vector of the mutant Pfu DNA polymerase into competent cells of the escherichia coli, performing amplification culture and collection of thalli, crushing at a low temperature, centrifuging, collecting supernatant, purifying by using magnetic beads, eluting, and collecting purified protein to obtain the mutant Pfu DNA polymerase.

2. The mutant Pfu DNA polymerase of claim 1, wherein the mutation site is G149L, K465F, T515R, I549K, E646I, A V and V764L.

3. The mutant Pfu DNA polymerase with high amplification activity as set forth in claim 1, wherein the amino acid sequence after mutation is shown in SEQ ID NO. 2.

4. The mutant Pfu DNA polymerase of claim 1, wherein said PFu primer comprises a forward primer Pfu-F and a reverse primer Pfu-R.

5. The mutant Pfu DNA polymerase with high amplification activity according to claim 4, wherein the sequence of Pfu-F is as follows:

Catcatcatcatcatagcagcggcattttagacgtgcattacataactg。

6. the mutant Pfu DNA polymerase with high amplification activity according to claim 4, wherein the sequence of Pfu-R is as follows:

Cggatctcactcgagttttttaatgttaagggaccaagttaggc。