CN117821575A

CN117821575A - Method for detecting DNA methylation level and application thereof

Info

Publication number: CN117821575A
Application number: CN202410252879.2A
Authority: CN
Inventors: 汪彪; 余丽萍; 吴强
Original assignee: Naonda Nanjing Biological Technology Co ltd
Current assignee: Naonda Nanjing Biological Technology Co ltd
Priority date: 2024-03-06
Filing date: 2024-03-06
Publication date: 2024-04-05

Abstract

The invention provides a detection method and application of DNA methylation level. The detection method comprises the following steps: connecting a linker at the end of the sample DNA to obtain a linker-linked DNA; equally dividing the linker connecting DNA into a linker connecting DNA1 and a linker connecting DNA2, and carrying out enzyme digestion on the linker connecting DNA1 by using methylation sensitive restriction enzyme to obtain a methylation enzyme digestion fragment; respectively carrying out PCR amplification on the methylation enzyme digestion fragments and the adaptor-ligated DNA2 to correspondingly obtain a methylation enzyme digestion-amplification library and a negative control-amplification library; capturing target fragments in the target fragments to obtain a captured positive library and a captured negative library; sequencing analysis is carried out on the positive library and the negative library to obtain DNA methylation level. The method can solve the problem that the methylation level of a large number of potential DNA methylation sites is difficult to accurately detect in the prior art, and is suitable for the field of DNA methylation detection.

Description

Method for detecting DNA methylation level and application thereof

Technical Field

The invention relates to the field of DNA methylation detection, in particular to a detection method and application of DNA methylation level.

Background

Methylated DNA refers to 5-methylcytosine (5 mC) which is formed by adding a methyl group to the 5' C position of cytosine by the action of a DNA methyltransferase (DNMT). Since the gene sequence is not changed, PCR or sequencing cannot accurately detect methylation-related information. Currently, the most commonly used is the bisulfite conversion method (BS conversion), i.e., the deamination of unmethylated cytosine (C) in DNA to uracil (U) by bisulfite, while methylated cytosine remains unchanged, and finally, the methylation level of CpG sites can be determined by comparing the sequence information obtained by PCR detection or high throughput sequencing with a reference genome. Common techniques for BS conversion include: methylation-specific PCR (MSP), quantitative Methylation-specific PCR (Quantitative Methylation-specific PCR, qMSP), whole Genome Bisulfite Sequencing (WGBS), reduced apparent bisulfite sequencing (Reduced representation bis μLfie sequencing, RRBS).

In the BS conversion method, MSP can only carry out qualitative analysis on methylation levels of certain sites, qMSP can quantify the methylation levels of the sites, but whether MSP or qMSP is adopted, the number of the targeted sites is very small, cpG sites on a primer or a probe can only be detected, methylation information can be provided too little, flux is low, and the accuracy and the sensitivity of early screening detection are limited.

BS-seq, whether WGBS or RRBS, has very low conversion rate of pool building due to DNA damage and degradation caused by bisulfite, resulting in DNA fragmentation and loss. Especially, the liquid biopsy cfDNA content of early screen diagnosis is low, and available methylation information is hardly obtained after BS conversion. In addition, BS libraries also exhibited significant GC bias and were overly focused on methylated regions.

NEB company (New England Biolabs) successfully developed a new method for detecting 5mC and 5hmC simultaneously based on Enzymatic transformation, NEBNEext Enzymatic transformation methylation library kit (EM-seq). EM-seq uses enzymatic conversion instead of bisulfite conversion to minimize DNA damage. BS-seq and EM-seq are based on transformation principle, and by comparing the genome after sequencing, the number of transformed c→t (complementary strand g→a) is counted and compared with the number of untransformed C, thereby obtaining the methylation level of the site.

Although EM-seq reduces DNA damage, the time for library construction is longer, the experimental steps are complicated, and information loss can be caused by multiple purifications. Both BS-seq and EM-seq cause base transition (c→t) of unmethylated sites, so that mutation information of genome cannot be detected simultaneously, and c→t caused by mutation and c→t caused by transformation can only be detected by matching positive and negative chains through a belief generating method, and cannot be distinguished accurately, thereby causing false positive.

Methylation restriction enzymes (Methylation sensitive restriction enzymes, MSRE) are a class of restriction enzymes that are sensitive to the inclusion of methylated bases in their recognition sites. MSRE is capable of cleaving at a cleavage site, and if the cleavage site contains a methylated base, it is unable to cleave DNA. Based on the methylation sensitive nature of MSRE, there are related techniques to detect methylation levels: methylation sensitive restriction enzyme quantitative PCR (MSRE-qPCR) and methylation sensitive restriction enzyme sequencing technology (MSRE-seq). MSRE-qPCR is used for extracting DNA, performing enzyme digestion on the DNA by using MSRE, and obtaining the copy number after enzyme digestion according to Ct value in a qPCR mode by designing corresponding primers so as to estimate the methylation level. MSRE-seq is obtained by cutting genomic DNA with MSRE, connecting sequencing adaptor to the cut product with the sticky end obtained by cutting, and performing NGS sequencing on the whole genome layer, thereby calculating methylation information (DOI: 10.1038/s 41598-023-40611-w), but still has the problems of omission and preference.

MSRE-qPCR can only detect a small number of sites, and similar to the MSP-qPCR, the reliability of early screening detection is greatly limited. MSRE-seq lacks standard procedures for mature site screening, pooling and mutation co-detection, and no reliable methylation level analysis method exists. Both MSRE-qPCR and MSRE-seq are difficult to meet the need for DNA methylation level detection for a large number of specific sites.

Disclosure of Invention

The invention mainly aims to provide a detection method and application of DNA methylation level, which are used for solving the problem that the methylation level of a large number of potential DNA methylation sites is difficult to accurately detect in the prior art.

In order to achieve the above object, according to a first aspect of the present invention, there is provided a method for detecting a methylation level of DNA, the method comprising: a) Connecting a linker at the end of the sample DNA to obtain a linker-linked DNA; b) Equally dividing the linker connecting DNA into a linker connecting DNA1 and a linker connecting DNA2, and carrying out enzyme digestion on the linker connecting DNA1 by using methylation sensitive restriction enzyme to obtain a methylation enzyme digestion fragment; c) Respectively carrying out PCR amplification on the methylation enzyme digestion fragments and the adaptor-ligated DNA2 to correspondingly obtain a methylation enzyme digestion-amplification library and a negative control-amplification library; d) Capturing target fragments in the methylation enzyme digestion-amplification library and the negative control-amplification library respectively to obtain a captured positive library and a captured negative library respectively; e) And respectively carrying out PCR amplification and on-machine sequencing on the captured positive library and the captured negative library, and analyzing the sequencing result to obtain the DNA methylation level of the sample DNA.

Further, the target fragment includes a methylation level detection region and a homogenization region; preferably, the methylation level detection region is a DNA fragment containing a position in the sample DNA that can be cleaved by a methylation sensitive restriction enzyme; preferably, the region of homogeneity is a DNA fragment in the sample DNA that does not contain a position that can be cleaved by a methylation sensitive restriction enzyme.

Further, d) comprises: capturing the target fragment by using a capture probe or capturing the target fragment by using a primer capable of specifically binding to the linker for PCR, thereby obtaining a capture positive library and a capture negative library, respectively.

Further, capture probes include MSRE probes and homogenization probes; wherein, MSRE probe is used for target capturing methylation level detection region, and homogeneity probe is used for target capturing homogeneity region.

Further, the methylation level detection region is located in a CpG enrichment region of a promoter region of the sample DNA; preferably, the length of the methylation level detection region is 100-250 bp, and the methylation level detection region and the front-back extension 100bp range each contain at least 2 MSRE sites which can be digested by methylation sensitive restriction enzymes; preferably, the GC content of the homogenizing region is 40% -60% and the length is 50-200 bp, and the homogenizing region and the extension of each of the front and back regions is 100bp free of MSRE sites that can be digested by methylation sensitive restriction enzymes.

Further, the analytical sequencing results in e) in the detection method include: e1 Obtaining the average sequencing depth κ for each MSRE site in the capture positive library from the sequencing results _MSRE The method comprises the steps of carrying out a first treatment on the surface of the Obtaining from the sequencing results an average sequencing depth ζ of each of the homogenization regions in the capture positive library _MSRE Calculating the average value of sequencing depth of all the homogenization areasThe method comprises the steps of carrying out a first treatment on the surface of the Calculating the relative depth +.>；/>Positively correlated with DNA methylation levels; preferably, the analytical sequencing result in e) in the detection method further comprises: e2 Obtaining from the sequencing results the average sequencing depth κ for each MSRE site in the capture negative library _CK The method comprises the steps of carrying out a first treatment on the surface of the Obtaining from the sequencing results an average sequencing depth ζ of each of the homogenization regions in the capture positive library _CK Calculating the average value of sequencing depth of all the homogenization areasThe method comprises the steps of carrying out a first treatment on the surface of the Calculating the relative depth +.>The method comprises the steps of carrying out a first treatment on the surface of the e3 Calculating methylation level of each MSRE site +.>。

Further, the sample DNA also contains DNA without methylation modification; the target fragment also comprises an enzyme digestion efficiency evaluation region; the capture probes further comprise cleavage efficiency evaluation probes; preferably, the cleavage efficiency evaluation region comprises a cleavage region of DNA without methylation modification and a negative control region of DNA without methylation modification; the digestion efficiency evaluation probe comprises a digestion probe A for capturing a digestion region of the DNA without methylation modification and a digestion probe B for capturing a negative control region of the DNA without methylation modification; preferably, the length of the cleavage region of the DNA without methylation modification is 100-250 bp, containing at least 2 MSRE sites that can be cleaved by a methylation sensitive restriction enzyme; preferably, the GC content of the negative control region of the DNA without methylation modification is 40% -60% and the length is 80-200 bp, and the negative control region of the DNA without methylation modification and the extension of the negative control region in the front-back direction of 100 bp each do not contain MSRE sites which can be digested by methylation sensitive restriction enzymes; preferably, the DNA without methylation modification comprises lambda DNA.

Further, analyzing the sequencing result to obtain the digestion efficiency before obtaining the DNA methylation level of the sample DNA; if the enzyme digestion efficiency is more than or equal to 98%, continuing to analyze the sequencing result to obtain the DNA methylation level of the sample DNA; if the enzyme digestion efficiency is less than 98%, stopping the detection method; preferably, the calculation of the cleavage efficiency comprises: obtaining the sequencing depth epsilon of the MSRE loci in the enzyme cutting region of the DNA without methylation modification from the sequencing result, and calculating the average sequencing depth of all the MSRE lociThe method comprises the steps of carrying out a first treatment on the surface of the Obtaining the sequencing depth gamma of the negative control region of the DNA without methylation modification from the sequencing result, and calculating the average sequencing depth +.>The method comprises the steps of carrying out a first treatment on the surface of the Calculating cleavage efficiency->。

Further, methylation sensitive restriction enzymes include HpaI, hpaII, hhaI or AciI; preferably, the sample DNA comprises a gDNA sample or a cfDNA sample.

Further, the capture probe is a biotin-modified probe; preferably, the biotin-modified probe has a length of 30-120 bp; preferably, the capture probes further comprise mutation detection probes, including probes for detecting base substitutions, base insertions, base deletions, chromosomal copy number variation analysis, microsatellite instability, or fusion genes; more preferably, the mutation detection probe does not contain an MSRE site which can be digested by a methylation sensitive restriction enzyme within 100bp of each of the front and rear of the targeting region; preferably, the capture probe is a μCaler cube probe.

In order to achieve the above object, according to a second aspect of the present invention, there is provided the use of the above-described method for detecting the methylation level of DNA in a sample.

By applying the technical scheme of the invention, the methylation sensitive restriction enzyme is utilized to carry out enzyme digestion on potential methylation sites in sample DNA, the digested fragments are captured and sequenced, and the detection of the DNA methylation levels of a plurality of methylation sites can be realized at the same time according to the sequencing depth.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention. In the drawings:

FIG. 1 is a schematic view showing a methylation level detection region, a homogenization region, and a cleavage efficiency evaluation region in accordance with an embodiment of the present invention; the schematic diagram of the positional relationship between the methylation level detection region and the MSRE site is shown in FIG. 1A, the schematic diagram of the positional relationship between the homogenization region and the MSRE site is shown in FIG. 1B, and the schematic diagram of the positional relationship between the cleavage efficiency evaluation region and the MSRE site is shown in FIG. 1C.

Figure 2 shows a graph of methylation level results for all MSRE sites of 0%, 10%, 50%, 100% standards in example 2 according to the invention.

Figure 3 shows statistical results of MSRE methylation levels for 0%, 10%, 50%, 100% standards in example 2 according to the invention.

Figure 4 shows statistical results of methylation levels of all MSRE sites for 0.1%, 1%, 5% hypomethylation standards in example 2 according to the invention.

Fig. 5 shows a cluster heat map of methylation levels of colorectal cancer tumor samples BS and MSREs in example 3 according to the invention.

Fig. 6 shows a graph of the results of methylation depth of colorectal cancer tumor samples BS and MSRE in example 3 according to the present invention.

Detailed Description

It should be noted that, in the case of no conflict, the embodiments and features in the embodiments may be combined with each other. The present invention will be described in detail with reference to examples.

Term interpretation:

DNA methylation: under the action of DNA methylation transferase, a methyl group is covalently bonded at the cytosine number 5 carbon position of the genome CpG dinucleotide, and the methylation degree of a promoter region and a CpG island in the genome influences gene expression and is an important mark for occurrence and development of cancers.

MSRE (Methylation sensitive restriction enzymes): methylation sensitive restriction enzymes. MSRE is capable of recognizing and cleaving DNA sequences of specific sequences that are not methylated at CpG sites; if methylation occurs at this site, MSRE is unable to cleave the sequence.

In this application, MSRE site refers to a position in a DNA sequence that can be digested by MSRE, and MSRE probe refers to a probe that can target capture of the MSRE site.

As mentioned in the background art, although the methods for DNA methylation detection in the prior art include BS-seq, EM-seq, MSRE-qPCR and the like, the detection of methylation sites can be realized by using the methods, but the detection accuracy is low, the experimental steps are complex, and the detection of methylation levels of a large number of sites is difficult to realize simultaneously. Thus, the inventors have tried to develop a novel method for detecting the methylation level of DNA on the basis of MSRE-seq in the present application, and thus proposed a series of protection schemes of the present application.

In a first exemplary embodiment of the present application, there is provided a method for detecting a methylation level of DNA, the method comprising: a) The end of the sample DNA is connected with a linker to obtain a linker-linked DNA; b) Equally dividing the linker connecting DNA into a linker connecting DNA1 and a linker connecting DNA2, and carrying out enzyme digestion on the linker connecting DNA1 by using Methylation Sensitive Restriction Enzyme (MSRE) to obtain a methylation enzyme digestion fragment; c) Respectively carrying out PCR amplification on the methylation enzyme digestion fragments and the adaptor-ligated DNA2 to correspondingly obtain a methylation enzyme digestion-amplification library and a negative control-amplification library; d) Respectively carrying out hybridization capture on target fragments in the methylation digestion-amplification library and the negative control-amplification library to respectively obtain a captured positive library and a captured negative library; e) And respectively carrying out PCR amplification and on-machine sequencing on the captured positive library and the captured negative library, and analyzing the sequencing result to obtain the DNA methylation level of the sample DNA.

In the detection method, the adaptor-ligated DNA is divided into the adaptor-ligated DNA1 and the adaptor-ligated DNA2 on average (i.e. in equal quantity), the adaptor-ligated DNA1 is subjected to enzyme digestion by using MSRE to obtain a methylated digestion fragment, and then PCR amplification and capture are performed to obtain a captured positive library; the adaptor-ligated DNA2 was directly subjected to PCR amplification and capture without cleavage to obtain a capture negative library (i.e., a blank control). By setting a blank control test, the correction of the systematic error is realized, and the accuracy of detecting the DNA methylation level is improved. Preferably, the method further comprises disrupting the sequence to obtain a sample DNA of an appropriate length prior to ligating the adaptor to the end of the sample DNA.

Using the above-described method for detecting DNA methylation levels, a large number of known potential methylation sites in sample DNA, including but not limited to those derived from humans, animals, plants or microorganisms, can be simultaneously detected, enabling detection of DNA methylation levels in sample DNA.

In a preferred embodiment, the target fragment comprises a methylation level detection region (target region) and a homogenization region (control region); preferably, the methylation level detection region is a DNA fragment in the sample DNA that contains a position (i.e., an MSRE site) that can be cleaved by a methylation sensitive restriction enzyme; preferably, the region of homogeneity is a DNA fragment in the sample DNA that does not contain a position that can be cleaved by a methylation sensitive restriction enzyme.

In the capturing step, capturing the target fragment can be realized by using a capture probe capable of specifically binding to the target sequence; or the PCR is carried out on the primer capable of being specifically combined with the linker, so that the capture of the target fragment is realized, the universal primer of the linker is used for amplification, and the problem of template preference of the target amplified directly by the PCR is avoided.

In the application, the MSRE site is captured and the homogeneous region is captured at the same time, so that the subsequent correction of data is facilitated, and the influence of the preferences of different sequences in PCR and/or sequencing on the detection result is reduced.

In a preferred embodiment, d) comprises: capturing the target fragment by using a capture probe or capturing the target fragment by using a primer capable of specifically binding to the linker for PCR, thereby obtaining a capture positive library and a capture negative library, respectively.

The target fragment includes a methylation level detection region and a homogenization region, and correspondingly, the capture probe includes a MSRE probe capable of targeting the MSRE site and a homogenization probe capable of targeting the homogenization region. In the detection method, the homogeneous region which does not contain the MSRE locus is captured at the same time, so that the target fragments in the methylation digestion-amplification library and the negative control-amplification library can be hybridized and captured by utilizing the capture probes.

For methylation digestion-amplified libraries, since sites in the fragment that are not methylated are already cleaved by the MSRE, the cleaved sequence cannot be captured by the capture probe, and the remaining MSRE sites are the sites where methylation occurs (in practice there will be a small number of sites that are not cleaved due to digestion efficiency). The sequence information in the final capture positive library is the MSRE site and the homogenization region where methylation occurs.

For the negative control-amplified library, since the MSRE digestion step is not performed, the fragments are mixed with sites that are methylated and sites that are not methylated, and the sequence information in the finally obtained capture negative library is all MSRE sites and homogeneous regions.

In a preferred embodiment, the methylation level detection region is located in a CpG-rich region of the promoter region of the sample DNA; preferably, the methylation level detection region has a length of 100-250 bp, and the methylation level detection region and the forward and backward extension each have at least 2 MSRE sites within the range of 100 bp that can be digested by a methylation sensitive restriction enzyme; preferably, the GC content of the homogenizing region is 40% -60% and the length is 50-200 bp, and the homogenizing region and the extension of each of the front and back regions is 100 bp free of MSRE sites that can be digested by methylation sensitive restriction enzymes.

In the above detection method, if the above requirements are to be satisfied for the selection of the methylation level detection region and the homogenization region, the detection method can obtain a more accurate detection result. At least 2 MSRE sites exist in the methylation level detection region and the front and rear (5 'end and 3' end) extension 100 bp ranges respectively, so that the methylation level detection region can be efficiently digested by MSRE; the homogenization region and the extension range of 100 bp before and after each contain no MSRE site which can be digested by methylation sensitive restriction enzyme, so that fragments can be prevented from being captured due to the fact that the homogenization region is digested by MSRE.

The positional relationship between the cleavage efficiency evaluation region and the MSRE site in the methylation level detection region is shown in FIG. 1A, and the positional relationship between the homogenization region and the MSRE site is shown in FIG. 1B.

In a preferred embodiment, the analytical sequencing results in e) of the detection method comprise:

e1 Obtaining the average sequencing depth κ for each MSRE site in the capture positive library from the sequencing results _MSRE The method comprises the steps of carrying out a first treatment on the surface of the Obtaining from the sequencing results an average sequencing depth ζ of each of the homogenization regions in the capture positive library _MSRE Calculating the average value of sequencing depth of all the homogenization areas The method comprises the steps of carrying out a first treatment on the surface of the Calculation of each MSRE siteIs the relative depth of (2)，/>Has a positive correlation with the level of DNA methylation.

In the method of e 1) above, the site where methylation modification occurs will give rise to a sequencing depth, whereas the site where no methylation modification occurs will theoretically have a sequencing depth of 0. I.e. relative depthThe larger indicates a higher level of DNA methylation in the sample DNA. The methylation level can be estimated according to the sequencing depth.

Preferably, the analytical sequencing result in e) in the detection method further comprises:

e2 Obtaining from the sequencing results the average sequencing depth κ for each MSRE site in the capture negative library _CK The method comprises the steps of carrying out a first treatment on the surface of the Obtaining from the sequencing results an average sequencing depth ζ of each of the homogenization regions in the capture positive library _CK Calculating the average value of sequencing depth of all the homogenization areasThe method comprises the steps of carrying out a first treatment on the surface of the Calculating the relative depth +.>；

e3 Calculating the methylation level of each MSRE site。

In the analytical sequencing results of the above detection method, for each MSRE site, the average sequencing depth κ is obtained from the sequencing results of the captured positive library _MSRE Average sequencing depth κ from sequencing results of captured negative library _CK . Since the average amount of the adaptor-ligated DNA was divided into 2 parts before cleavage, and the methods used in the subsequent steps of PCR amplification, hybridization capture, and on-machine sequencing were the same, the method of the present invention was not limited to this κ _MSRE And kappa (kappa) _CK The differences (including but not limited to differences or ratios) can reflect the effect of MSRE digestion on sequencing results, i.e., how much methylation of the MSRE site is.

For each of the homogenization areas, the average sequencing depth ζ of one of the homogenization areas is obtained from the sequencing results of the captured positive library _MSRE Further calculating the average sequencing depth of all the homogenized regions. The same calculation was performed on the sequencing results of the captured negative library to obtain ζ _CK And. Since the homogenization region is not affected by MSRE cleavage, in theoryEqual toHowever, in actual operation, since conditions such as capturing and PCR are different from each other in different systems, they are used in methylation calculationAndlevel of para-methylationAnd correction is performed, so that errors are reduced, and the detection accuracy is improved.

In a preferred embodiment, the sample DNA further comprises DNA without methylation modification; the target fragment also comprises an enzyme digestion efficiency evaluation region; the capture probes further comprise cleavage efficiency evaluation probes; preferably, the cleavage efficiency evaluation region includes a cleavage region (lambda cut region) of the DNA without methylation modification and a negative control region (lambda control region) of the DNA without methylation modification; the digestion efficiency evaluation probe comprises a digestion probe A for capturing a digestion region of the DNA without methylation modification and a digestion probe B for capturing a negative control region of the DNA without methylation modification; preferably, the length of the cleavage region of the DNA without methylation modification is 100-250 bp, containing at least 2 MSRE sites that can be cleaved by a methylation sensitive restriction enzyme; preferably, the GC content of the negative control region of the DNA without methylation modification is 40% -60% and the length is 80-200 bp, and the negative control region of the DNA without methylation modification and the extension of the negative control region in the front-back direction of 100 bp each do not contain MSRE sites that can be digested by methylation sensitive restriction enzymes.

In the detection method, the detection of the MSRE digestion efficiency is realized by additionally adding DNA containing MSRE sites and not having methylation modification into sample DNA. The above-mentioned methylation-free modified DNA includes a lambda cut region containing an MSRE site and a lambda control region not containing an MSRE site. Correspondingly, the capture probe contains a cleavage probe A capable of capturing the lambda cut region and a cleavage probe B capable of capturing the lambda control region. The positional relationship between the cleavage efficiency evaluation region and the MSRE site is shown as C in FIG. 1.

In a preferred embodiment, sequencing results are analyzed for cleavage efficiency prior to obtaining the DNA methylation level of the sample DNA; if the enzyme digestion efficiency is more than or equal to 98%, continuing to analyze the sequencing result to obtain the DNA methylation level of the sample DNA; if the enzyme digestion efficiency is less than 98%, stopping the detection method; preferably, the calculation of the cleavage efficiency comprises: obtaining the sequencing depth epsilon of the MSRE loci in the enzyme cutting region of the DNA without methylation modification from the sequencing result, and calculating the average sequencing depth of all the MSRE lociThe method comprises the steps of carrying out a first treatment on the surface of the Obtaining the sequencing depth gamma of the negative control region of the DNA without methylation modification from the sequencing result, and calculating the average sequencing depth +. >The method comprises the steps of carrying out a first treatment on the surface of the Calculating the enzyme digestion efficiency。

In order to ensure that the digestion of the MSRE is normally carried out, so that the obtained DNA methylation level is accurate, in the detection method, after the sequencing result is obtained, the digestion efficiency is calculated first, when the digestion efficiency is more than or equal to 98%, the digestion of the MSRE is normally carried out, so that most of MSRE sites which are not methylated can be cut, and at the moment, the sequencing result is continuously analyzed to obtain the DNA methylation level of the sample DNA, wherein the DNA methylation level has high reliability. If the cleavage efficiency is less than 98%, it indicates that a part of non-cleaved MSRE sites which are not methylated are mixed in the methylation cleavage fragments, and the sequencing data are greatly affected by the sites, so that the real DNA methylation situation cannot be reflected.

In a preferred embodiment, the DNA without methylation modification comprises lambda DNA (lambda DNA).

Lambda DNA is DNA in lambda phage and is a common DNA substrate on the market. The lambda DNA does not contain methylation modification, and can be used as DNA without methylation modification in the above detection method. Methylation modification of the genome of lambda DNA is not generated, and the depth of lambda cut regions is 0 in theory after enzyme digestion.

In a preferred embodiment, methylation sensitive restriction enzymes include, but are not limited to HpaI, hpaII, hhaI or AciI; preferably, the sample DNA comprises a gDNA sample or a cfDNA sample.

In the detection method, methylation Sensitive Restriction Enzyme (MSRE) can be flexibly selected, so that the cleavage of different methylation sites is realized. In the actual detection method, the methylation level detection region, the MSRE probe, and the like need to be adjusted correspondingly with the change of the MSRE.

Using the above detection method, methylation level detection can be performed simultaneously for a number of potential sites known to be capable of methylation mutation. As long as the multiple potential sites can be digested by the same MSRE, the methylation level detection of the multiple potential sites can be completed in one experiment process by designing methylation level detection regions, MSRE probes and other regions.

In a preferred embodiment, the capture probe is a biotin-modified probe; preferably, the biotin-modified probe has a length of 30-120 bp; preferably, the capture probes further comprise mutation detection probes, including but not limited to probes for detecting base substitutions, base insertions, base deletions, chromosomal copy number variation analysis, microsatellite instability, or fusion genes; more preferably, the mutation detection probe does not contain an MSRE site which can be digested by a methylation sensitive restriction enzyme within 100bp of each of the front and rear of the targeting region; preferably, the capture probe is a μCaler cube probe.

In the detection method, when the capture probe is used for capturing the target fragment, the capture probe can also contain a mutation detection probe, and the mutation detection probe is used for synchronously capturing the mutation positions such as base substitution, base insertion, base deletion, chromosome copy number mutation analysis, microsatellite instability or fusion genes possibly existing in the sample DNA, so that the mutation information of the sample DNA can be obtained during on-machine sequencing, and the DNA methylation level and mutation co-detection can be realized. Preferably, the MSRE site is not contained near the target area of the mutation detection probe, so that the mutation detection probe is prevented from being digested near the target area, the capturing efficiency of the mutation site is influenced, and the detection accuracy of the mutation is influenced.

In a second exemplary embodiment of the present application, there is provided the use of a method for detecting the methylation level of DNA as described above for detecting the methylation level of a sample DNA.

The advantageous effects of the present application will be explained in further detail below in connection with specific examples.

Example 1

The invention is suitable for detecting methylation level and mutation signals of target areas of gDNA samples and cfDNA samples after interruption (especially physical interruption). Lambda DNA (without methylation modification) is added into the sample for enzyme digestion efficiency evaluation, the fragmented sample is subjected to library establishment, the tail end is repaired and A tail is added, after the end is connected, one group of restriction enzymes comprising HpaI, hpaII, hhaI, aciI and the like are used for enzyme digestion by using methylation sensitive restriction enzymes, and the other group of restriction enzymes is not subjected to enzyme digestion treatment, so that the control group (CK group) is obtained. PCR amplification was performed on each of the two sets of products, and Index sequences were added. The amplified product was captured by liquid phase hybridization using a probe. The captured library was sequenced by an illumina sequencer.

The Library construction procedure described above in this application uses NadPrep DNA universal Library construction Kit (1002212) from NadPrep Biotech, and μCaler Library Prep & Hybrid Kit (1105201), and the specific experimental procedure is as follows.

The experimental steps are as follows:

step one: sample fragmentation

gDNA sample fragmentation was performed according to various laboratory conditions using a Covaris ™ series DNA sonicator, cfDNA was not required to be fragmented. gDNA or cfDNA samples after the fragments, according to copy number 1:1 lambda DNA (E7123A, NEB) was added.

Step two: end repair and addition of A tail

1. Taking out the End Repair & A-stirring Buffer for melting at normal temperature, mixing uniformly, placing on ice for standby, naturally melting on the End Repair & A-stirring Enzyme ice, mixing uniformly, and centrifuging instantly for standby.

2. The reaction system formulation was performed in a PCR tube placed on ice according to table 1 below:

TABLE 1

。

3. The following reaction procedure was started on the PCR instrument, and the PCR tube was placed into the PCR instrument when the isothermal temperature stabilized to 20 ℃ and the procedure of table 2 was performed.

TABLE 2

。

Step three: joint connection

1. Taking out the Ligation Buffer for melting at normal temperature, mixing uniformly, placing on ice for standby, naturally melting on DNA Ligation ice, mixing uniformly, and centrifuging instantly for standby.

2. The PCR tube of the second step was taken out from the PCR instrument, placed on an ice box, and prepared according to the following Table 3:

TABLE 3 Table 3

。

3. Mixing uniformly, instantaneous centrifuging to make all the reaction liquid be placed at the bottom of PCR tube, starting the following reaction procedure on PCR instrument, holding at 20 deg.C for 15 min and 4 deg.C, when the isothermal temperature is stabilized to 20 deg.C, placing the reaction tube into PCR instrument.

Step four: purification of the product

Purification recovery was performed using 0.5×beans, the purification scheme is as follows:

and adding 20 mu L of NadPrep SP Beads into the reaction product, uniformly mixing, and incubating for 10 min at 20-25 ℃.

The PCR tube was centrifuged transiently and placed on a magnetic rack for 5 min until the liquid was completely clear, and the supernatant was discarded.

150 mu L of 80% ethanol is slowly added along the side wall of the PCR tube, the magnetic beads are not disturbed, the mixture is stood for 30 and s, and the supernatant is removed.

The above purification steps were repeated once.

The PCR tube was placed on a magnetic rack after transient centrifugation, and a small amount of residual ethanol was removed, taking care not to attract the magnetic beads. And opening the PCR tube cover, and standing at 20-25 ℃ for about 2-3 min until the ethanol is completely volatilized.

The PCR tube was removed, 44. Mu. L Nuclease Free Water (nuclease-free water) was added to the PCR tube, and the beads were suspended uniformly using a pipette and incubated at 25℃for 2 min.

The PCR tube was centrifuged transiently and placed on a magnetic rack for 2 min until the liquid was completely clear, and the supernatant was carefully transferred to a new PCR tube.

Step five: enzyme digestion with methylation sensitive restriction enzyme

1. The purified product was divided into MSRE group and CK group at 1:1, MSRE group was carried out according to the following procedure, CK group to sixth procedure.

2. The MeEnzyme and MeBuffer (NEB methylation sensitive restriction enzyme, M0217S) were taken out, naturally dissolved on ice, uniformly mixed, and instantly centrifuged for use.

3. The reaction system was prepared in a PCR tube of 0.2. 0.2 ml on ice according to the following table, and the system is shown in Table 4 below.

TABLE 4 Table 4

。

4. The PCR tube was placed in a PCR instrument at 37℃for 1 h and 80℃for 20 min.

5. The recovery was performed by cleavage purification using 1 XBeads, see step four, eluting with 20. Mu. L NucleaseFree water.

Step six: PCR amplification of products

Taking out 2× HiFi PCR Master Mix and NadPrep cube, placing on ice, naturally melting, mixing, and centrifuging instantly.

PCR amplification Mix was formulated in 0.2 mL PCR tubes placed on ice according to table 5 below:

TABLE 5

。

The PCR tubes were placed in a PCR instrument to initiate the procedure shown in table 6 below:

TABLE 6

。

The cycle numbers are shown in table 7:

TABLE 7

。

4. Purification recovery was performed using 1×Beads, purification procedure see step four, 20 μ L NucleaseFree water elution.

Step seven: library hybridization

1. The hybridization reaction system was prepared as follows in Table 8:

TABLE 8

。

2. Vortex mixing the mixture 10 above s, instantaneous centrifuging, and collecting the reaction mixture to the bottom of PCR tube.

3. The PCR tube was placed in a PCR instrument and the following reaction procedure was initiated: 98 ℃ for 2 min;60 ℃ 1 h.

Step eight: library capture and elution

And (3) cleaning magnetic beads:

1. streptavidin Beads was vortexed 15, 15 s to ensure complete mixing.

2. Mix wash n×25 μ L Streptavidin Beads in 0.2 mL centrifuge tube (n is the number of captured libraries and n < 5).

3. Streptavidin Beads the solution was allowed to stand on a magnetic rack for about 2 min until the solution was completely clear and the supernatant was discarded.

4. The centrifuge tube is removed from the magnetic rack, 100 mu L of preheated Wash buffer A is added, and the mixture is gently blown and sucked for more than 10 times.

5. The centrifuge tube is placed on a magnetic rack for standing for about 2 min, and the supernatant is removed after the liquid is completely clarified.

6. Steps 4 and 5 are repeated once.

7. The tube was centrifuged instantaneously, and Wash buffer A at the bottom of the tube was completely discarded by a 10. Mu.L tip.

8. N×8 μl μhyb#l was resuspended Streptavidin Beads and gently flushed and mixed more than 10 times.

Capturing magnetic beads:

1. after the hybridization reaction of 1 h, the mixture enters a capturing link, and the PCR instrument is preheated to 60 ℃.

2. The PCR tube was placed in a PCR instrument, 8. Mu.L of the resuspended Streptavidin Beads was immediately added to each hybridization reaction solution, gently sucked and mixed for more than 10 times, and incubated at 60℃for 10 min.

3. After incubation, the PCR tube was removed from the PCR apparatus and placed on a magnetic rack for 2 min, and the supernatant was removed after the liquid was completely clarified.

Eluting:

1. the PCR tube was removed from the magnetic rack, 150. Mu.L of preheated Wash Buffer A was added, and the mixture was gently sucked and mixed for more than 10 times.

2. The PCR tube was placed on a magnetic rack for 2 min, and the supernatant was removed after the liquid was completely clarified.

3. The PCR tube was removed from the magnetic rack, 100. Mu.L of preheated Wash Buffer A was added, gently sucked and mixed for more than 10 times, and the reaction solution was transferred to a new PCR tube.

4. The PCR tube was placed in a PCR instrument and incubated at 60℃for 3 min.

5. After incubation, the PCR tube was removed from the PCR apparatus and placed on a magnetic rack for 2 min, and the supernatant was removed after the liquid was completely clarified.

6. 150. Mu.L of Wash Buffer B placed at room temperature is added into the PCR tube, and the mixture is gently blown and sucked for more than 10 times.

7. The PCR tube was placed on a magnetic rack for 2 min, and the supernatant was removed after the liquid was completely clarified.

8. 22.5 mu L Nuclease Free Water was added and the beads were gently flushed more than 10 times to resuspend.

Step nine: hybrid Capture library PCR amplification

Taking out 2X HiFi PCR Master Mix and NadPrep Amplification Primer Mix II, naturally melting on ice, mixing by a pipette or a vortex mixer, and centrifuging instantly for later use.

Preparing a PCR reaction system according to the following table 9, and adding the prepared PCR reaction system into the PCR reaction tube in the step eight:

TABLE 9

。

The PCR tube was placed in a PCR apparatus and the procedure shown in Table 10 below was started, with the hot cap temperature set at 105 ℃.

Table 10

。/>

The cycle numbers are shown in table 11:

TABLE 11

。

The Panel size is the size of the methylation level detection region (target region).

Purification recovery was performed using 1×bead, see step four, eluting with 20 μ L NucleaseFree water.

The library was quantified based on the fluorescent dye method (Qubit) and analyzed for library fragment distribution (Agilent 2100 Bioanalyzer or similar products).

The library meeting the standard is sent to an illumina sequencer for sequencing, and the raw letter analysis of the machine-starting data is described in the following analysis flow section.

The analysis flow is as follows:

the machine-down data were compared with a reference genome comprising genomic sequence and lambda DNA sequence, and the reads depth was counted after comparison. The statistical region includes the average depth of the MSRE sites within the target region and lambda cut region, and the average depth of the homogenization region and lambda control region. The cleavage efficiency was calculated as follows: the average depth of MSRE loci in lambda cut region is epsilon, and the average value of the depths of all MSRE loci is calculated first The average depth of lambda control region is γ, and the average +.>Final cleavage efficiency->The general enzyme digestion efficiency is more than or equal to 98 percent. the methylation level of the target region MSRE site was calculated as follows: firstly, carrying out homogenization treatment on each of an MSRE group and a CK group, wherein the average depth of MSRE sites is kappa, the average depth of a homogenization region is zeta, and the average value of the depths of all regions is calculated>Calculating the relative depth of each MSRE siteObtaining the methylation level of each MSRE locus by comparing the relative depth of the MSRE locus and the corresponding locus of the CK locus。

EXAMPLE 2 Co-detection of mutations and methylation Using standards

The experimental procedure is as follows: MSRE libraries and CK libraries were constructed using OGTM800 standard (Pan-tumor 800 gDNA standard, cyanine, GW-OGTM 800) and lambda DNA, and the library building procedure was as described in example 1. Amplification products were captured hybridized using mu Caler hybrid Capture system, using a total of four panels of 10K Me Panel, normalized Panel, OGTM800 Panel, lambda Panel. Wherein 10K Me Panel covers MSRE cleavage site, normalized Panel is used for homogenization, OGTM800 Panel is used for mutation detection analysis, and lambda Panel is used for evaluation of cleavage efficiency. The captured library was sequenced by an illumina platform sequencer.

The probe sequences of the 10K Me Panel, normalized Panel and lambda Panel are shown in SEQ ID NO: 1-370. The OGTM800 Panel is designed according to the known mutation sites in the OGTM800 standard, and the target region does not contain MSRE sites which can be digested by methylation sensitive restriction enzymes within 100bp range before and after the target region, so that the probe capable of capturing the known mutation sites is obtained.

Probe sequence (5 '-3'):

SEQ ID NO：1：gccagcgccatagcccttaggactatcggtcacat；SEQ ID NO：2：ctcgcgctcctgctccggctcctccatcttggcct；SEQ ID NO：3：ggagcagagcgaggtgtgtgcctccttaccgcctt；SEQ ID NO：4：gtgcactggacgtccttccccagcagccagttgag；SEQ ID NO：5：agacggaggctggtggtgcagcaggcaggcaagac；SEQ ID NO：6：gatgccggggactacagctgcgaggccaggggcca；SEQ ID NO：7：gcacagcgttgtgcatccaggtctagcgtgtcttc；SEQ ID NO：8：ctgtcttctgtggatgaggtatatgaatttatccc；SEQ ID NO：9：cgagacctcccagagcccgtggttccctggagcca；SEQ ID NO：10：tacgaagggttcctgctctgtgggcagctcacgaa；SEQ ID NO：11：caataatgcacatggagaaagttcacctacaataa；SEQ ID NO：12：tgtattggtaacattttatatcgaattcctgttct；SEQ ID NO：13：agatgtcccctccctgtccgtccccgcacctggag；SEQ ID NO：14：tggtggtgcatgcccgaacccagcacttccttgaa；SEQ ID NO：15：caactggccaacctagagcccccctggtaaaagct；SEQ ID NO：16：tcttggtggaatagatgttaattagtttttttatt；SEQ ID NO：17：ggaaacaattctgtgttcaccctcaccctgcaggc；SEQ ID NO：18：ggcctctcagccatcaagacaccgtatcctacctc；SEQ ID NO：19：acgtgctgagcgcacgcacgtggcgcctgctcacc；SEQ ID NO：20：gatgctgctccagcgcccgcgcgagttgcggatcg；SEQ ID NO：21：gtagttgacaaatacatttagtgatgtcttacttt；SEQ ID NO：22：atctcctaccagtgtatccttcacgacagacgcac；SEQ ID NO：23：cgagcgatgatgacaccaaatccatgtgtccaccc；SEQ ID NO：24：gggacccaggagggcacagccaaggaatgagccct；SEQ ID NO：25：ctcctggtcagcagcctcttagagaacctgctgga；SEQ ID NO：26：tatagaaccatcatcatgcaagatgagagcaagga；SEQ ID NO：27：gaacagtaaacagtggttctgactggtgaaatgat；SEQ ID NO：28：gttgaaaggaccagcactttatttattgctttagc；SEQ ID NO：29：agcctgcacgggagtcagaggcactcagcaatgcc；SEQ ID NO：30：tggctctgttacgaacggctgaaatcaaaacccct；SEQ ID NO：31：tcaccgtgttctccagaccatgcatgttcctccgc；SEQ ID NO：32：accgccccttcagggatggggctgtaggagtcaag；SEQ ID NO：33：tctcggtgtctccccaggtgcaagtgcaacctgca；SEQ ID NO：34：gccaacctgtgctccatgcgcgagggcagcctgca；SEQ ID NO：35：aagcccactcttctactccccgaacgtgccttccc；SEQ ID NO：36：ctctgacggcgacagtagctccgtggacagcgatg；SEQ ID NO：37：ctggaggagcacggaaaagacctggaaatcatgca；SEQ ID NO：38：atcctcaccagggtgaatgacagagttgccaggca；SEQ ID NO：39：gcataggagtaggccagccagcggaacacgtggtc；SEQ ID NO：40：tcgggggtgggggtgtgttcctgcgtcttccaggg；SEQ ID NO：41：cgggaatgccgagtaagtgttaattttatggtccc；SEQ ID NO：42：atcacttctggaaaatgaatagatagatgtgtggg；SEQ ID NO：43：gtgcctcaatgatcttttttccccaccttcatttt；SEQ ID NO：44：cttcagcggcatctgctagctcgtctacccctgtt；SEQ ID NO：45：catgttttagggaactctgccctataaacactcat；SEQ ID NO：46：ggtttctctctatgttgcagtccctctgtcgtgaa；SEQ ID NO：47：cggcattcctgtggtagtggcctgagaacacgact；SEQ ID NO：48：tgacacctgcagagaagggaaaaagtcattagggg；SEQ ID NO：49：acatgtccctgcgtcacaggcacctgcagagcccc；SEQ ID NO：50：tgtgtaaggcgttccggcacgtcaaggtggacaca；SEQ ID NO：51：tgaagatacaaacaaccacagcagcctgcacttac；SEQ ID NO：52：gtgtggtcatcttcttcttccccttctagcacgac；SEQ ID NO：53：acgttgcatcgaccctctccactccgcggaagtag；SEQ ID NO：54：cgacaccgtctgatgtgttgcgcaggtggtggcat；SEQ ID NO：55：cattgggatggagggtggggaaggagtcaccctgg；SEQ ID NO：56：cctcctccgcctgacttacttgatcctaaagtcat；SEQ ID NO：57：ctcccagggctccttggcctcctccgcggtgacct；SEQ ID NO：58：gggacacagggccgcatgagcctgggcggggtcag；SEQ ID NO：59：cgccctccgaggagggcccgggcggggtgggcgcc；SEQ ID NO：60：cgtcctcaggctccaggctgggaggagagagcgtt；SEQ ID NO：61：gctgggagtggagctgggggtcagaagagcaagca；SEQ ID NO：62：aacgaaattgatcaaacttagactgcttcacctgt；SEQ ID NO：63：gcgtggacaggcagcgccgcagtgacgtctccatg；SEQ ID NO：64：tggagtcctccagcggcttcaggcggttcagcttc；SEQ ID NO：65：atgtgaccgatagtcctaagggctatggcgctggc；SEQ ID NO：66：aggccaagatggaggagccggagcaggagcgcgag；SEQ ID NO：67：aaggcggtaaggaggcacacacctcgctctgctcc；SEQ ID NO：68：ctcaactggctgctggggaaggacgtccagtgcac；SEQ ID NO：69：gtcttgcctgcctgctgcaccaccagcctccgtct；SEQ ID NO：70：tggcccctggcctcgcagctgtagtccccggcatc；SEQ ID NO：71：gaagacacgctagacctggatgcacaacgctgtgc；SEQ ID NO：72：ctttgggataaattcatatacctcatccacagaag；SEQ ID NO：73：tggctccagggaaccacgggctctgggaggtctcg；SEQ ID NO：74：ttcgtgagctgcccacagagcaggaacccttcgta；SEQ ID NO：75：cctctttattgtaggtgaactttctccatgtgcat；SEQ ID NO：76：aacatagaacaggaattcgatataaaatgttacca；SEQ ID NO：77：ctccaggtgcggggacggacagggaggggacatct；SEQ ID NO：78：ttcaaggaagtgctgggttcgggcatgcaccacca；SEQ ID NO：79：agcttttaccaggggggctctaggttggccagttg；SEQ ID NO：80：agagtaataaaaaaactaattaacatctattccac；SEQ ID NO：81：gcctgcagggtgagggtgaacacagaattgtttcc；SEQ ID NO：82：gaggtaggatacggtgtcttgatggctgagaggcc；SEQ ID NO：83：ggtgagcaggcgccacgtgcgtgcgctcagcacgt；SEQ ID NO：84：cgatccgcaactcgcgcgggcgctggagcagcatc；SEQ ID NO：85：ccaaaaaagtaagacatcactaaatgtatttgtca；SEQ ID NO：86：gtgcgtctgtcgtgaaggatacactggtaggagat；SEQ ID NO：87：gggtggacacatggatttggtgtcatcatcgctcg；SEQ ID NO：88：agggctcattccttggctgtgccctcctgggtccc；SEQ ID NO：89：tccagcaggttctctaagaggctgctgaccaggag；SEQ ID NO：90：ctccttgctctcatcttgcatgatgatggttctat；SEQ ID NO：91：taactatcatttcaccagtcagaaccactgtttac；SEQ ID NO：92：aaatggctaaagcaataaataaagtgctggtcctt；SEQ ID NO：93：ggcattgctgagtgcctctgactcccgtgcaggct；SEQ ID NO：94：aggggttttgatttcagccgttcgtaacagagcca；SEQ ID NO：95：gcggaggaacatgcatggtctggagaacacggtga；SEQ ID NO：96：cttgactcctacagccccatccctgaaggggcggt；SEQ ID NO：97：tgcaggttgcacttgcacctggggagacaccgaga；SEQ ID NO：98：tgcaggctgccctcgcgcatggagcacaggttggc；SEQ ID NO：99：gggaaggcacgttcggggagtagaagagtgggctt；SEQ ID NO：100：catcgctgtccacggagctactgtcgccgtcagag；SEQ ID NO：101：tgcatgatttccaggtcttttccgtgctcctccag；SEQ ID NO：102：tgcctggcaactctgtcattcaccctggtgaggat；SEQ ID NO：103：gaccacgtgttccgctggctggcctactcctatgc；SEQ ID NO：104：ccctggaagacgcaggaacacacccccacccccga；SEQ ID NO：105：gggaccataaaattaacacttactcggcattcccg；SEQ ID NO：106：taaagcccacacatctatctattcattttccagaa；SEQ ID NO：107：aagaaaaatgaaggtggggaaaaaagatcattgag；SEQ ID NO：108：aacaggggtagacgagctagcagatgccgctgaag；SEQ ID NO：109：atctatgagtgtttatagggcagagttccctaaaa；SEQ ID NO：110：ttcacgacagagggactgcaacatagagagaaacc；SEQ ID NO：111：agtcgtgttctcaggccactaccacaggaatgccg；SEQ ID NO：112：cccctaatgactttttcccttctctgcaggtgtca；SEQ ID NO：113：ggggctctgcaggtgcctgtgacgcagggacatgt；SEQ ID NO：114：tgtgtccaccttgacgtgccggaacgccttacaca；SEQ ID NO：115：gtaagtgcaggctgctgtggttgtttgtatcttca；SEQ ID NO：116：gtcgtgctagaaggggaagaagaagatgaccacac；SEQ ID NO：117：ctacttccgcggagtggagagggtcgatgcaacgt；SEQ ID NO：118：atgccaccacctgcgcaacacatcagacggtgtcg；SEQ ID NO：119：ccagggtgactccttccccaccctccatcccaatg；SEQ ID NO：120：atgactttaggatcaagtaagtcaggcggaggagg；SEQ ID NO：121：aggtcaccgcggaggaggccaaggagccctgggag；SEQ ID NO：122：ctgaccccgcccaggctcatgcggccctgtgtccc；SEQ ID NO：123：ggcgcccaccccgcccgggccctcctcggagggcg；SEQ ID NO：124：aacgctctctcctcccagcctggagcctgaggacg；SEQ ID NO：125：tgcttgctcttctgacccccagctccactcccagc；SEQ ID NO：126：gagacaggtgaagcagtctaagtttgatcaatttc；SEQ ID NO：127：catggagacgtcactgcggcgctgcctgtccacgc；SEQ ID NO：128：gaagctgaaccgcctgaagccgctggaggactcca；SEQ ID NO：129：gcagtggcggctgccgggaggatgtgccgccttct；SEQ ID NO：130：agggctgccaggacgcgagccactgaggagccgct；SEQ ID NO：131：ccaggttgccctcgccctggtagcaggactgcagg；SEQ ID NO：132：gcatggacaggaaggttggaacctgtgtcatggag；SEQ ID NO：133：gggtctccttccgcctgcacatcacaggtgggttt；SEQ ID NO：134：ctccagcttgaaagtgcatgtagaggccaagggct；SEQ ID NO：135：atagtcacgtgggaagtgatggcagtgaaggattt；SEQ ID NO：136：ccaaaagaagatcacaattacagtgcaagtagcat；SEQ ID NO：137：cggatgaggcaaaggtttgcatcttagagttagtt；SEQ ID NO：138：tgtgcacactgtggcttccctgttaaagctctacc；SEQ ID NO：139：agataaatattaatcgtaaactattagactgcctc；SEQ ID NO：140：ggagttaaaaggcacaagtcatggcagcctccatt；SEQ ID NO：141：cagcgtagatccggtgccgagcccagctgtccatg；SEQ ID NO：142：gggcagtgagctcaggccagactgaagcaaccaca；SEQ ID NO：143：agtgggcttcctgaatgagtatcttcattttgttc；SEQ ID NO：144：cctcaaatgcctgcagtttgcccgggagtcgtctc；SEQ ID NO：145：gtgcgcagtgcggtttggcctggggttggcatctt；SEQ ID NO：146：gcagttccggtacgacaactaccgactacaccagc；SEQ ID NO：147：gctgcgcggctccctggtgtgcacgcaaatcagcg；SEQ ID NO：148：ttgctggtgccggcgctcgcgctcttcctcctggg；SEQ ID NO：149：attatttctcatgcagtggccaccattcttacagg；SEQ ID NO：150：cagcccttaaattcaacagttttgtcttggcttta；SEQ ID NO：151：ggggtgacgcttcagggcagagctgccttttaatt；SEQ ID NO：152：gggtggccttggagcgaagtgaagccaacatcaag；SEQ ID NO：153：ccgtatgagctgcactgtgaacgtgctggtatgtg；SEQ ID NO：154：acacaaatacctctccagctctggggaggtcttcg；SEQ ID NO：155：gcatacaaacctgaagagagaatttccctgggtgt；SEQ ID NO：156：attttagaaaattataagttgattccatatataga；SEQ ID NO：157：ggcttctcctatgcttgtattctgattgatagtct；SEQ ID NO：158：cgcaactggtcagatggtcaggaacgctggaaacc；SEQ ID NO：159：ctgggagaagggtgtggtgaggcccagcaccttct；SEQ ID NO：160：catgggtgctgggtcaaaattgaagaggtcgaagt；SEQ ID NO：161：gcgagtgcgagcacaacaccaccggccccgactgc；SEQ ID NO：162：ggccaggctgcccacaagctctctgacatctctgc；SEQ ID NO：163：agcatcgagcaggaaatccggacatttttggccct；SEQ ID NO：164：cggcccctgtagagggcagtgacgggtccctgtcc；SEQ ID NO：165：ttgagtctcagtctgatgacccacacttccatgag；SEQ ID NO：166：aagaggctcctggtttgtgcaagccctctgctcca；SEQ ID NO：167：accgcaccaggtcgtaggggtacgccaccaccagc；SEQ ID NO：168：cctcctccgggcgtctgtcatgaggcggtgtgtgg；SEQ ID NO：169：gatgaggttcttgagtggggcatattggcctggat；SEQ ID NO：170：tcttgcagaaggccagcggattttaaccaagagct；SEQ ID NO：171：attgtctccaccagatagtgagtatcattttcttc；SEQ ID NO：172：ccagggttgttgcttccatttttttttcattcagt；SEQ ID NO：173：caagcaacgacgtcgaggagttgcctccattctgc；SEQ ID NO：174：tgtatcactacaatttgaaattatgatggaagaag；SEQ ID NO：175：cgaggacttccattaggtaacctagggtctccagc；SEQ ID NO：176：gatgacaccaccatgtcgaggttctggtaggtacc；SEQ ID NO：177：gagccagcctgaggccctctccaggatcttggtgc；SEQ ID NO：178：cacacgcggagctccactcctgccacccctgactc；SEQ ID NO：179：agtgatacagcattcctgattcagtagcgatcact；SEQ ID NO：180：taagcattcatattgggtcaggaactatgccaggt；SEQ ID NO：181：gtcgtcgatccggtaagccgtctgtttgtcactca；SEQ ID NO：182：tgacatcgaaatcacagccgtggcgtgtgcctgac；SEQ ID NO：183：gcagccagcttggcattgtcaatttgtacaatcag；SEQ ID NO：184：ggaagaaatgacaatgattccctcactcaacaagt；SEQ ID NO：185：ccggcaacccgagcgaaagctgcgcccggcggccg；SEQ ID NO：186：tgtggctgcagtgcgtcagcgacaaagcgtagcca；SEQ ID NO：187：aggcgcggaggctgcccacggcccctccatcctgc；SEQ ID NO：188：gtcggggtcgcgccgtccacctcggcctccgcggg；SEQ ID NO：189：tgaacactagcgtctcctcgcagccctcttgcagc；SEQ ID NO：190：cctgccagtgtcctgacattatccagatataaatg；SEQ ID NO：191：gcataagcgtgccaggctagcaatggtgggcagcc；SEQ ID NO：192：cccaccatgccacccacgcccagaagagtcaggtc；SEQ ID NO：193：agaaggcggcacatcctcccggcagccgccactgc；SEQ ID NO：194：agcggctcctcagtggctcgcgtcctggcagccct；SEQ ID NO：195：cctgcagtcctgctaccagggcgagggcaacctgg；SEQ ID NO：196：ctccatgacacaggttccaaccttcctgtccatgc；SEQ ID NO：197：aaacccacctgtgatgtgcaggcggaaggagaccc；SEQ ID NO：198：agcccttggcctctacatgcactttcaagctggag；SEQ ID NO：199：aaatccttcactgccatcacttcccacgtgactat；SEQ ID NO：200：ccatgctacttgcactgtaattgtgatcttctttt；SEQ ID NO：201：aactaactctaagatgcaaacctttgcctcatccg；SEQ ID NO：202：ggtagagctttaacagggaagccacagtgtgcaca；SEQ ID NO：203：agattgaggcagtctaatagtttacgattaatatt；SEQ ID NO：204：aatggaggctgccatgacttgtgccttttaactcc；SEQ ID NO：205：catggacagctgggctcggcaccggatctacgctg；SEQ ID NO：206：tgtggttgcttcagtctggcctgagctcactgccc；SEQ ID NO：207：gaatgaacaaaatgaagatactcattcaggaagcc；SEQ ID NO：208：gagacgactcccgggcaaactgcaggcatttgagg；SEQ ID NO：209：aagatgccaaccccaggccaaaccgcactgcgcac；SEQ ID NO：210：gctggtgtagtcggtagttgtcgtaccggaactgc；SEQ ID NO：211：cgctgatttgcgtgcacaccagggagccgcgcagc；SEQ ID NO：212：cccaggaggaagagcgcgagcgccggcaccagcaa；SEQ ID NO：213：cctgtaagaatggtggccactgcatgagaaataat；SEQ ID NO：214：agctaaagccaagacaaaactgttgaatttaaggg；SEQ ID NO：215：aattaaaaggcagctctgccctgaagcgtcacccc；SEQ ID NO：216：cttgatgttggcttcacttcgctccaaggccaccc；SEQ ID NO：217：cacataccagcacgttcacagtgcagctcatacgg；SEQ ID NO：218：cgaagacctccccagagctggagaggtatttgtgt；SEQ ID NO：219：acacccagggaaattctctcttcaggtttgtatgc；SEQ ID NO：220：attattctatatatggaatcaacttataattttct；SEQ ID NO：221：cagactatcaatcagaatacaagcataggagaagc；SEQ ID NO：222：ggtttccagcgttcctgaccatctgaccagttgcg；SEQ ID NO：223：agaaggtgctgggcctcaccacacccttctcccag；SEQ ID NO：224：acttcgacctcttcaattttgacccagcacccatg；SEQ ID NO：225：gcagtcggggccggtggtgttgtgctcgcactcgc；SEQ ID NO：226：gcagagatgtcagagagcttgtgggcagcctggcc；SEQ ID NO：227：agggccaaaaatgtccggatttcctgctcgatgct；SEQ ID NO：228：ggacagggacccgtcactgccctctacaggggccg；SEQ ID NO：229：ctcatggaagtgtgggtcatcagactgagactcaa；SEQ ID NO：230：tggagcagagggcttgcacaaaccaggagcctctt；SEQ ID NO：231：gctggtggtggcgtacccctacgacctggtgcggt；SEQ ID NO：232：ccacacaccgcctcatgacagacgcccggaggagg；SEQ ID NO：233：atccaggccaatatgccccactcaagaacctcatc；SEQ ID NO：234：agctcttggttaaaatccgctggccttctgcaaga；SEQ ID NO：235：ggatgaagaaaatgatactcactatctggtggaga；SEQ ID NO：236：cagatactgaatgaaaaaaaaatggaagcaacaac；SEQ ID NO：237：gcagaatggaggcaactcctcgacgtcgttgcttg；SEQ ID NO：238：aacaccttcttccatcataatttcaaattgtagtg；SEQ ID NO：239：gctggagaccctaggttacctaatggaagtcctcg；SEQ ID NO：240：ggtacctaccagaacctcgacatggtggtgtcatc；SEQ ID NO：241：gcaccaagatcctggagagggcctcaggctggctc；SEQ ID NO：242：gagtcaggggtggcaggagtggagctccgcgtgtg；SEQ ID NO：243：agtgatcgctactgaatcaggaatgctgtatcact；SEQ ID NO：244：acctggcatagttcctgacccaatatgaatgctta；SEQ ID NO：245：tgagtgacaaacagacggcttaccggatcgacgac；SEQ ID NO：246：gtcaggcacacgccacggctgtgatttcgatgtca；SEQ ID NO：247：ctgattgtacaaattgacaatgccaagctggctgc；SEQ ID NO：248：caaatacttgttgagtgagggaatcattgtcattt；SEQ ID NO：249：cggccgccgggcgcagctttcgctcgggttgccgg；SEQ ID NO：250：tggctacgctttgtcgctgacgcactgcagccaca；SEQ ID NO：251：gcaggatggaggggccgtgggcagcctccgcgcct；SEQ ID NO：252：cccgcggaggccgaggtggacggcgcgaccccgac；SEQ ID NO：253：gctgcaagagggctgcgaggagacgctagtgttca；SEQ ID NO：254：tcatttatatctggataatgtcaggacactggcag；SEQ ID NO：255：ggctgcccaccattgctagcctggcacgcttatgc；SEQ ID NO：256：gacctgactcttctgggcgtgggtggcatggtggg；SEQ ID NO：257：ttgggacggcgaacagaagacacactgcttcaagg；SEQ ID NO：258：cgcacgcggcacctgctacgcgagtggtacctgca；SEQ ID NO：259：atccataccctaaccccagcaaaaaacgtgagctc；SEQ ID NO：260：ccaggcaaccggactgacccctacgcaggtgggca；SEQ ID NO：261：tggttcaaaaaccgccgacaaagggaccgagcggc；SEQ ID NO：262：cagccaagaacaggtcggtacctagaggcctccgc；SEQ ID NO：263：tttgagcgcaccggggaggaggcgggtggaggcac；SEQ ID NO：264：taagggcgccagaggtgcctccacccgcctcctcc；SEQ ID NO：265：ggtgcgctcaaagcgcggaggcctctaggtaccga；SEQ ID NO：266：tgttcttggctgcagccgctcggtccctttgtcgg；SEQ ID NO：267：gtttttgaaccagttgcccacctgcgtaggggtca；SEQ ID NO：268：ccggttgcctgggcgagctcacgttttttgctggg；SEQ ID NO：269：tagggtatggatcctgcaggtaccactcgcgtagc；SEQ ID NO：270：gtgccgcgtgcgctccttgaagcagtgtgtcttct；SEQ ID NO：271：cggtggtcgtggtgggggtgttagctgcaggggtg；SEQ ID NO：272：ctcggtgggtgggagttggtggcctctcgctggtg；SEQ ID NO：273：atgggactcgcatgttcgccctgcgcccctcggct；SEQ ID NO：274：tgagcccacaggccgggatcctgcctgccagccgc；SEQ ID NO：275：gcgctgccgtttaacccttgcaggcgcagagcgcg；SEQ ID NO：276：gtatttgggcagccaaacaaagttctctgtcaccg；SEQ ID NO：277：gcgctctgcgcctgcaagggttaaacggcagcgca；SEQ ID NO：278：cggctggcaggcaggatcccggcctgtgggctcaa；SEQ ID NO：279：gccgaggggcgcagggcgaacatgcgagtcccatg；SEQ ID NO：280：accagcgagaggccaccaactcccacccaccgagg；SEQ ID NO：281：cgccccgagcaggaccgggattctcactaagcggg；SEQ ID NO：282：cgcgcgctttcaggaccactcgggcacgtggcagg；SEQ ID NO：283：ccgcggactatccctgtgacaggaaaaggtacggg；SEQ ID NO：284：atttggcaaactaaggcacagagcctcaggcggaa；SEQ ID NO：285：cggcttgtaccggccgaagggccatccgggtcagg；SEQ ID NO：286：gtgcgcctgacccggatggcccttcggccggtaca；SEQ ID NO：287：cggcgccttcccagcttccgcctgaggctctgtgc；SEQ ID NO：288：tagtttgccaaatggcccgtaccttttcctgtcac；SEQ ID NO：289：cgggcgtgcaagcgacctgccacgtgcccgagtgg；SEQ ID NO：290：cccgcttagtgagaatcccggtcctgctcggggcg；SEQ ID NO：291：tgcctcgcaatgctcagcttcgcattgcttttcct；SEQ ID NO：292：tccctgccctgcatcaaccgcccagcagtttacag；SEQ ID NO：293：cccgcatcccattcccgcatcctgaccccgcatcc；SEQ ID NO：294：attctgcatccccgcctctccctcacaatcccacc；SEQ ID NO：295：tgccggccgtagctccaccgcccagcatcatcctg；SEQ ID NO：296：accctgtctctgggcaggatgatgctgggcggtgg；SEQ ID NO：297：ctacggccggcaggggtgggattgtgagggagagg；SEQ ID NO：298：gggatgcagaattgggatgcggggtcaggatgcgg；SEQ ID NO：299：atgggatgcggggcctgtaaactgctgggcggttg；SEQ ID NO：300：gcagggcagggacgaggaaaagcaatgcgaagctg；SEQ ID NO：301：ggagcaccaactccgtgtcgggagtgcagaaacca；SEQ ID NO：302：ggcgggagcaggcgcaggaggaggaagcgagcgcc；SEQ ID NO：303：cgagccccgagcccgagtccccgagcctgagccgc；SEQ ID NO：304：tcgctgcggtactctgctccggattcgtgtgcgcg；SEQ ID NO：305：ctgcgccgagcgctgggcaggaggcttcgttttgc；SEQ ID NO：306：ttgcaaccagggcaaaacgaagcctcctgcccagc；SEQ ID NO：307：tcggcgcagcccgcgcacacgaatccggagcagag；SEQ ID NO：308：ccgcagcgattgcggctcaggctcggggactcggg；SEQ ID NO：309：gggcgctcgcttcctcctcctgcgcctgctcccgc；SEQ ID NO：310：gcgccctctcacttgttggtttctgcactcccgac；SEQ ID NO：311：tatacccattgctcacgaaaaaaaatgtccttgtc；SEQ ID NO：312：agggatgaatcgcttggtgtacctcatctactgcg；SEQ ID NO：313：aacttgacctttctctcccatattgcagtcgcggc；SEQ ID NO：314：gatggaactaaattaataggcatcaccgaaaattc；SEQ ID NO：315：aatgtgcaataggaagaaaatgatctatatttttt；SEQ ID NO：316：tcctatatcaccacaaaatggacatttttcacctg；SEQ ID NO：317：gcttgtttcatcaggtgaaaaatgtccattttgtg；SEQ ID NO：318：ataggacagacaaaaaatatagatcattttcttcc；SEQ ID NO：319：cacattatcctgaattttcggtgatgcctattaat；SEQ ID NO：320：tccatcgtgccgcgactgcaatatgggagagaaag；SEQ ID NO：321：caagttttcgcagtagatgaggtacaccaagcgat；SEQ ID NO：322：atccctatatcgacaaggacattttttttcgtgag；SEQ ID NO：323：gctggcggcaaatgagcagaaatttaagtttgatc；SEQ ID NO：324：ctgtttctgcgtctctttttccgtgagagctatcc；SEQ ID NO：325：tcaccacggagaaagtctatctctcacaaattccg；SEQ ID NO：326：actggtaaacatggcgctgtacgtttcgccgattg；SEQ ID NO：327：tccggtgaggttatccgttcccgtggcggctccac；SEQ ID NO：328：ctgaatttacgccgggatatgtcaagccgaagcat；SEQ ID NO：329：gtcatctgcggattcacttcatgcttcggcttgac；SEQ ID NO：330：atcccggcgtaaattcagaggtggagccgccacgg；SEQ ID NO：331：acggataacctcaccggaaacaatcggcgaaacgt；SEQ ID NO：332：agcgccatgtttaccagtcccggaatttgtgagag；SEQ ID NO：333：agactttctccgtggtgaagggatagctctcacgg；SEQ ID NO：334：aaagagacgcagaaacagcggatcaaacttaaatt；SEQ ID NO：335：agagtcagcgatgttcctgaaaaccgaatcatttg；SEQ ID NO：336：cataacggtgtgaccgtcacgctttctgaactgtc；SEQ ID NO：337：ccctgcagcgcattgagcatctcgccctgatgaaa；SEQ ID NO：338：gcaggcagaacaggcggagtcagacagcaaccgga；SEQ ID NO：339：tttactgtggaagacgccatcagaaccggcgcgtt；SEQ ID NO：340：tggtggcgatgtccctgtggcataaccatccgcag；SEQ ID NO：341：atggacggcatctgcgtcttctgcggatggttatg；SEQ ID NO：342：acagggacatcgccaccagaaacgcgccggttctg；SEQ ID NO：343：ggcgtcttccacagtaaacttccggttgctgtctg；SEQ ID NO：344：tccgcctgttctgcctgccgtttcatcagggcgag；SEQ ID NO：345：gctcaatgcgctgcagggctgacagttcagaaagc；SEQ ID NO：346：gacggtcacaccgttatgttcaaatgattcggttt；SEQ ID NO：347：aacggtggtccggcgtaaggtttacgcccgttttc；SEQ ID NO：348：gatgcggtgaacttcgtcaacggaaacagttacgc；SEQ ID NO：349：atccggagcaggaggtgatcagccgctggcgcatt；SEQ ID NO：350：gcagtgcagcgaactgagcgcggtgagtgcctcct；SEQ ID NO：351：gtactgtccacgccgacggaaacggatggcgctgt；SEQ ID NO：352：ttccgggacgtatcatgctggccaacacctgcacc；SEQ ID NO：353：tcgtcaccgcgataggtccaggtgcaggtgttggc；SEQ ID NO：354：gcatgatacgtcccggaaaaacagcgccatccgtt；SEQ ID NO：355：cgtcggcgtggacagtacaaaggaggcactcaccg；SEQ ID NO：356：ctcagttcgctgcactgctcaatgcgccagcggct；SEQ ID NO：357：tcacctcctgctccggatcggcgtaactgtttccg；SEQ ID NO：358：gacgaagttcaccgcatccagaaaacgggcgtaaa；SEQ ID NO：359：agatgctcgacacgctgcagaacacgcagctgcag；SEQ ID NO：360：cgccattgtgaaggcgatgtatgccgccaccattg；SEQ ID NO：361：agtgagctggatacgcagtcagcgatggattttat；SEQ ID NO：362：tgggcgcgaacagtcaggagcagcgggaaaggctg；SEQ ID NO：363：cggctggattggtgaaattgccgcgtattacgccg；SEQ ID NO：364：gcgccggtccggctgggaggcgcaaaagtaccgca；SEQ ID NO：365：gtgagtcacccggcatcaggtgcggtacttttgcg；SEQ ID NO：366：tcccagccggaccggcgctgcggcgtaatacgcgg；SEQ ID NO：367：atttcaccaatccagccggtcagcctttcccgctg；SEQ ID NO：368：cctgactgttcgcgcccagaataaaatccatcgct；SEQ ID NO：369：ctgcgtatccagctcactctcaatggtggcggcat；SEQ ID NO：370：atcgccttcacaatggcgctctgcagctgcgtgtt。

analysis of results: sample 1 and sample 2 are repeated experiments. Wherein the OGTM-CK experimental group (CK 1 and CK 2) is used as a control, and methylation sensitive restriction enzyme is not used for enzyme digestion, and the group of samples can be used for mutation detection analysis. OGTM-MSRE (MSRE 1 and MSRE 2) is a digestion group, methylation sensitive restriction enzymes are used for digestion, the OGTM800 Panel of the flow design does not contain methylation sensitive restriction enzyme digestion sites, and the group of samples can be used for methylation and mutation detection analysis. Specific methylation level and cleavage efficiency assays are described in the analytical procedure of example 1. Table 12 shows the average depths of lambda cut and lambda control regions for two samples in the 0% standard, resulting in a cleavage efficiency of about 98.81% for sample 1, 98.66% for sample 2, and > 98% for all standards. Fig. 2 shows methylation levels of all MSRE sites for 0%, 10%, 50%, 100% standards, and fig. 3 shows overall MSRE methylation levels (2 replicates) with good reproducibility between groups as expected for standards. Figure 4 shows the methylation levels of all MSRE sites of 0.1%, 1%, 5% hypomethylation standards, which were expected and graded. Table 13 shows that the detected mutation frequencies and the theoretical mutation frequencies are different, the total mutation frequencies are covered by 15 mutation types, the mutation types comprise 11 mutation sites, 2 fusion sites and 2 copy number variation (base insertion and deletion), mutation detection mutation sites common to cancers are involved, the corresponding mutation frequencies are different from 1% to 7%, and the actual mutation frequencies are basically consistent with the theoretical mutation frequencies.

TABLE 12 average depth and cleavage efficiency of lambda cut and lambda control

。

TABLE 13 theoretical mutation frequencies of standards and corresponding summary tables of detection frequencies

。

Example 3: MSRE methylation detection using clinical samples

The experimental procedure is as follows: after DNA extraction of paraffin sections (FFPE) of 11 tumor samples of colorectal cancer, MSRE libraries and CK libraries were constructed, for the library building procedure see example 1. The amplified product was captured by hybridization using mu Caler hybrid Capture system, 3 Panel total of 10K Me Panel, normalized Panel, lambda Panel were captured simultaneously, and the probe sequence was as shown in SEQ ID NO: 1-370. Wherein 10K Me Panel covers the MSRE cleavage site, normalized Panel was used for homogenization, and lambda Panel was used for evaluation of cleavage efficiency. The captured library was sequenced by an illumina platform sequencer.

In addition, the extracted DNA of FFPE, which is a tumor sample of 11 colorectal cancers, was reconstructed into BS transformation libraries in addition to the MSRE and CK libraries, and BS transformation was compared with MSRE methylation data, and the experimental procedure for the construction of BS libraries was as follows: performing end repair and methylation linker ligation on FFPE DNA, converting a linker ligation product, converting the linker ligation product by using a bisulfite conversion module, performing PCR amplification by using an amplification enzyme (KAPA HiFi HotStart Uracil Mix) capable of recognizing U bases, and quantifying a methylation library by using a Qubit quantification reagent. The hybridization capture kit is NadPrep Hybrid Capture Reagents, a methylation library meeting the requirements is selected, hybridization, streptavidin magnetic bead capture and elution are carried out, PCR amplification is carried out after elution is finished, magnetic bead purification is carried out on amplified products, and the purified products are sent to an Illumina platform sequencer for sequencing.

Analysis of results: specific methylation level and cleavage efficiency assays are described in the analytical procedure of example 1. 11, the cleavage efficiency of the colorectal cancer clinical sample MSRE is more than 98 percent. Fig. 5 shows the methylation levels of MSRE and BS transformation at the same site in colorectal cancer tumor samples, and the MSRE and BS methylation levels of all samples were clustered together by the respective samples, indicating that the methylation level of MSRE was substantially identical to the methylation level of gold-standard BS transformation. Fig. 6 shows that 11 BS transformation of colorectal cancer tumor samples and the methylation depth of MSREs, where the methylation levels were substantially identical, the methylation depth of MSREs in the same samples was higher than that of BS. The above results demonstrate that MSRE has less DNA damage, more methylation information is obtained, and higher confidence in methylation levels than BS transformation.

From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects:

for the problem of DNA damage caused by the transformation of the bisulfite in the BS-seq in the prior art, the detection method of the application adopts an MSRE enzyme digestion mode to acquire the methylation level, so that the loss of methylation information and GC bias can be well prevented. In addition, the method has simple library construction steps, less time consumption and no need of detection by a base conversion method, and can realize mutation co-detection of the genome.

For the problem that no mature MSRE-seq flow exists at present, the invention establishes an MSRE probe design method, introduces a homogenization probe and an enzyme digestion efficiency evaluation probe, and obtains relative depth by carrying out homogenization by using the depth of a homogenization area through statistics of the reads depth, so that a CK group is compared with an MSRE group to obtain more accurate MSRE methylation level. Further, the present invention establishes a cleavage efficiency evaluation probe that determines cleavage efficiency by introducing lambda DNA using a depth comparison of lambda cut region and lambda control region.

In the case of substantially identical methylation levels, the sequencing depth for methylation using the detection methods of the present application is higher than the depth of BS in the same sample. Compared with the traditional BS transformation, the detection method has smaller damage to DNA, more methylation information is obtained, and the reliability of the methylation level is higher.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting the methylation level of DNA, comprising:

a) Connecting a linker at the end of the sample DNA to obtain a linker-linked DNA;

b) The linker connecting DNA is equally divided into a linker connecting DNA1 and a linker connecting DNA2,

enzyme cutting is carried out on the adaptor-ligated DNA1 by using methylation sensitive restriction enzyme to obtain a methylation enzyme cut segment;

c) Respectively carrying out PCR amplification on the methylation enzyme digestion fragment and the adaptor-ligated DNA2 to correspondingly obtain a methylation enzyme digestion-amplification library and a negative control-amplification library;

d) Capturing target fragments in the methylation enzyme digestion-amplification library and the negative control-amplification library respectively to obtain a captured positive library and a captured negative library respectively;

e) And respectively carrying out PCR amplification and on-machine sequencing on the capture positive library and the capture negative library, and analyzing the sequencing result to obtain the DNA methylation level of the sample DNA.

2. The method of claim 1, wherein the target fragment comprises a methylation level detection region and a homogenization region;

the methylation level detection region is a DNA fragment containing a position which can be digested by the methylation sensitive restriction enzyme in the sample DNA;

The homogenizing region is a DNA fragment which does not contain a position which can be digested by the methylation sensitive restriction enzyme in the sample DNA.

3. The method of claim 2, wherein d) comprises: capturing the target fragment by using a capturing probe or capturing the target fragment by using a primer capable of specifically binding to the linker for PCR, thereby obtaining a capturing positive library and a capturing negative library respectively.

4. The method of detection according to claim 3, wherein the capture probes comprise MSRE probes and homogenization probes;

wherein the MSRE probe is used for targeted capture of the methylation level detection region,

the homogenization probe is used for targeted capture of the homogenization region.

5. The method of claim 2, wherein the methylation level detection region is located in a CpG rich region of a promoter region of the sample DNA.

6. The method according to claim 5, wherein the methylation level detection region has a length of 100 to 250 bp, and the methylation level detection region and the extension of each of the methylation level detection region comprise at least 2 MSRE sites that can be digested by the methylation sensitive restriction enzyme.

7. The method according to claim 2, wherein the GC content of the homogenizing region is 40% -60% and the length is 50-200 bp, and the homogenizing region and the extension of each of the front and rear regions is 100 bp, and does not contain an MSRE site which can be digested by the methylation sensitive restriction enzyme.

8. The method of claim 2, wherein the analytical sequencing results in e) of the method of detecting comprises:

e1 Obtaining from the sequencing results an average sequencing depth κ for each MSRE site in the capture positive library _MSRE ；

Obtaining from said sequencing result an average sequencing depth ζ of each of said homogenization areas in said capture positive library _MSRE Calculating the average value of the sequencing depth of all the homogenization areas；

Calculating the relative depth of each MSRE locus；

Is positively correlated with the DNA methylation level.

9. The method of claim 8, wherein the analytical sequencing result in e) of the method of detecting further comprises:

e2 Obtaining from the sequencing results an average sequencing depth κ for each of the MSRE sites in the capture negative library _CK ；

Obtaining from said sequencing result an average sequencing depth ζ of each of said homogenization areas in said capture positive library _CK Calculating the average value of the sequencing depth of all the homogenization areas；

Calculating the relative depth of each MSRE locus；

e3 Calculating the methylation level of each of said MSRE sites。

10. The method according to claim 4, wherein the sample DNA further contains DNA having no methylation modification;

the target fragment further comprises an enzyme digestion efficiency evaluation region;

the capture probes further comprise cleavage efficiency evaluation probes.

11. The method according to claim 10, wherein the cleavage efficiency evaluation region comprises a cleavage region of DNA without methylation modification and a negative control region of DNA without methylation modification;

the cleavage efficiency evaluation probe includes a cleavage probe A for capturing a cleavage region of the methylation-free modified DNA and a cleavage probe B for capturing a negative control region of the methylation-free modified DNA.

12. The method according to claim 11, wherein the methylation-free modified DNA cleavage region has a length of 100-250 bp and contains at least 2 MSRE sites that can be cleaved by the methylation sensitive restriction enzyme.

13. The method according to claim 11, wherein the methylation-free DNA negative control region has a GC content of 40% -60% and a length of 80-200 bp, and wherein the methylation-free DNA negative control region and the extension of 100 bp each do not contain an MSRE site that can be digested by the methylation sensitive restriction enzyme.

14. The method of claim 10, wherein the DNA without methylation modification comprises lambda DNA.

15. The method of any one of claims 10-14, wherein sequencing results are analyzed for cleavage efficiency prior to obtaining the DNA methylation level of the sample DNA;

if the digestion efficiency is more than or equal to 98%, continuing to analyze the sequencing result to obtain the DNA methylation level of the sample DNA;

stopping the detection method if the enzyme digestion efficiency is less than 98%;

the calculation of the digestion efficiency comprises the following steps:

obtaining from the sequencing result the sequencing depth epsilon of the MSRE sites in the digestion region of the DNA without methylation modification, and calculating the average sequencing depth of all the MSRE sites；

Obtaining the sequencing depth gamma of the negative control region of the DNA without methylation modification from the sequencing result, and calculating the average sequencing depth of the negative control region of the DNA without methylation modification；

Calculating the digestion efficiency。

16. The detection method according to claim 1, wherein the methylation sensitive restriction enzyme comprises HpaI, hpaII, hhaI or AciI;

the sample DNA comprises a gDNA sample or a cfDNA sample.

17. The method of detection according to any one of claims 3, 4, 10, 11, 12, 13 or 14, wherein the capture probe is a biotin-modified probe.

18. The method of claim 17, wherein the capture probe further comprises a mutation detection probe comprising a probe for detecting a base substitution, a base insertion, a base deletion, a chromosomal copy number variation analysis, a microsatellite instability, or a fusion gene.

19. The method according to claim 18, wherein the mutation detection probe does not contain an MSRE site that can be cleaved by the methylation sensitive restriction enzyme within 100bp of each of the targeting region.

20. Use of the method for detecting the methylation level of DNA according to any one of claims 1 to 19 for detecting the methylation level of a sample DNA.