WO2020259303A1

WO2020259303A1 - Method for rapid construction of rna 3'-end gene expression library

Info

Publication number: WO2020259303A1
Application number: PCT/CN2020/095600
Authority: WO
Inventors: 耿亮; 辛文
Original assignee: 北京全式金生物技术有限公司
Priority date: 2019-06-25
Filing date: 2020-06-11
Publication date: 2020-12-30
Also published as: CN110257479A

Abstract

Disclosed is a method for rapid construction of an RNA 3'-end gene expression library, comprising: using Oligo(dT) reverse transcription primer with a first adapter to perform reverse transcription on an mRNA sample to obtain a first-strand cDNA with the first adapter; using the first-strand cDNA as a template to synthesize a second-strand cDNA to obtain a double-stranded cDNA with the first adapter; using a transposase complex with a second adapter to process the double-stranded cDNA, such that the second adapter is inserted during fragmentation to obtain a double-stranded cDNA fragment with the first adapter and/or the second adapter. The sequences of the first adapter and the second adapter are not completely the same. The method provided by the present invention can effectively achieve the construction of a transcriptome library for the 3'-end of eukaryotic mRNA.

Description

Method for quickly constructing RNA 3'end gene expression library

Technical field

The invention relates to the technical field of molecular biology. More specifically, it relates to a method for quickly constructing an RNA 3'gene expression library.

Background technique

With the advent of the post-genome era, gene expression and transcriptomics research, as a powerful tool, occupies an increasingly important position in today's life science research. It can help people understand gene structure in depth, reveal gene expression under specific conditions, and the regulatory mechanism of organisms to respond to changes in the external environment. Different from the research at the DNA level, the construction and detection of mRNA expression library can more accurately and directly reflect the expression differences at the level of individual organisms, tissues and even single cells; as the upstream research field of proteomics, gene expression detection is based on the current foundation Research and precision medicine, drug development and other fields are playing an increasingly important role.

Early gene expression detection methods were mainly based on the biochemical or specific phenotypic changes observed in cells or organisms to determine whether a specific gene was expressed; later, with the continuous development of biochemical technology, specific expression products and Protein molecule detection methods have also been applied to qualitatively or semi-quantitatively detect gene expression, such as Western Blot technology. On the other hand, the rapid development of molecular biology has provided powerful tools for expression detection. The most representative and landmark technologies are RT-PCR and RT-qPCR technologies, which researchers can use to construct Expression library, more sensitive and accurate quantitative detection of specific gene expression level. But the common limitation of these technologies is that they can only obtain a limited amount of data at the same time, and they are unable to meet the increasing demand for high-throughput and large-sample testing.

The rise of gene chip (also known as microarray) technology has made high-throughput expression detection possible. This technology uses a large number of probe molecules to be immobilized on a specific support (chip) at a high density and hybridizes with the labeled sample molecules, and then obtains the number and sequence information of the sample molecules by detecting the intensity of the hybridization signal of each probe molecule . This technology can detect and analyze a large number of sequences of samples at one time, meeting the needs of high-throughput gene expression detection. However, due to technical constraints in sample preparation, probe synthesis and immobilization, molecular labeling, data reading and analysis, etc., this method also has many shortcomings in current applications, such as high cost, low detection sensitivity, and repetition. Poor sex and so on.

The vigorous development of second-generation sequencing technology, especially the advancement of RNA sequencing technology, has rapidly promoted the widespread application of transcriptomics research. At present, RNA sequencing technology can effectively study mRNA on a qualitative and quantitative level, help people understand the cellular response mechanism, and promote a series of life science research, as well as medical and pharmaceutical related research and the development of molecular diagnostic reagents.

Because gene expression testing often focuses more on the expression level of specific genes, or the absolute number and relative number of specific mRNA molecules, rather than its full-length exact sequence, the application of RNA library construction in the field of gene expression testing can be It can be achieved by only constructing a library of the 3'-end region of the mRNA to obtain a certain length of specific information that can determine the difference between it and other molecules. Based on the above principles, there are many mature technical solutions, such as MARS-seq.

However, one common feature of these schemes is that they are reverse transcribed through the 3'end poly(A) structure of the mRNA molecule, and then converted into double-stranded cDNA, which is then constructed by traditional DNA library. This method requires a series of tedious operations such as end repair and phosphorylation, addition of A, ligation of adapters, library amplification, and multi-step purification. These operations are acceptable for larger amounts of RNA samples, but for single-cell RNA The construction of a library is represented by extremely low template mRNA. Especially for some mRNAs with extremely low expression levels, the number of molecules is small or even at the level of single copy, which can easily lead to the loss of information.

It is worth noting that there are mature methods based on transposase complexes for DNA NGS library construction, such as Epicentre's second-generation DNA sequencing kit series products (TRANSPOSONEND COMPOSITIONS AND METHODS FOR MODIFYING NUCLEIC ACIDS. United States Patent Application Pub. No. US 20110287435 A1.), as well as improvements made by domestic scholars to the above library construction method (Chinese invention patent: 201710013203.8; invention title: a circular transposon complex and its application). Compared with the traditional DNA library construction scheme, this method has simpler steps, is easy to operate, and greatly shortens the operation time of library construction; however, this method has no precedent for mature application in the direction of RNA library construction.

As a relatively novel DNA library construction technology, the two characteristics of transposase complexes include: 1. Randomly introduce the first or second linker at both ends of the DNA fragment. For a single fragment, the sequences at both ends may be the same. It may be different; 2. The molecular end of the DNA template cannot be introduced into the linker by transposase. These two points are not a problem for DNA library construction using genome as a template, but for RNA library construction, directional double-ended linkers cannot be connected to the 3'region of mRNA molecules.

If this problem can be solved, simple, fast, and efficient transposase library construction technology can be combined with transcription construction library technology to develop powerful RNA 3'end gene expression library construction and sequencing technology, which is very useful for transcriptomics. The research in the field of RNA sequencing has great and far-reaching practical significance.

Summary of the invention

The first objective of the present invention is to provide a method for quickly constructing an RNA 3'end gene expression library, which can effectively realize the construction of a transcriptome library for the 3'end of eukaryotic mRNA.

The second object of the present invention is to provide a rapid gene expression sequencing method.

To achieve the above objective, the present invention adopts the following technical solutions:

A method for quickly constructing an RNA 3'gene expression library, the method includes the following steps:

Use Oligo (dT) reverse transcription primer with the first linker to reverse transcription of the mRNA sample to obtain the first strand cDNA with the first linker;

Synthesize the second-strand cDNA using the first-strand cDNA as a template to obtain the double-stranded cDNA with the first linker;

Use the transposase complex carrying the second linker to process the double-stranded cDNA, insert the second linker while fragmenting, to obtain a double-stranded cDNA fragment with the first linker and/or the second linker;

Wherein, the sequence of the first linker and the second linker are not the same.

In addition, a preferred solution is that the method further includes the following steps:

The double-stranded cDNA fragments are amplified by PCR primers designed according to the first linker sequence and the second linker sequence to obtain an RNA 3'end gene expression library.

In addition, a preferred solution is that the PCR primers designed according to the first linker sequence and the second linker sequence also include the Index sequence required for library construction and sequencing.

In addition, a preferred solution is that the first linker and the second linker carry Index sequences required for library construction and sequencing.

In addition, a preferred solution is that the transposase complex includes a transposase and inserted DNA; and the transposase is Tn5 transposase or MuA transposase.

In addition, a preferred solution is that in the transposase complex, the insert DNA carrying the second linker is two identical DNA molecules, or the insert DNA carrying the second linker is a piece with the same second linker at both ends. DNA molecule.

In addition, a preferred solution is that the Oligo (dT) reverse transcription primer with a first linker has an Oligo (dT) primer with a first linker sequence at the 5'end, and a T base-containing primer at the 3'end Nucleotides.

In addition, a preferred solution is that the Oligo (dT) reverse transcription primer with the first linker has an Oligo (dT) primer with the first linker sequence at the 5'end, and the 3'end with the immediately adjacent mRNA A nucleotide containing anchor bases annealed in the poly(A) region.

According to the second object of the present invention, the present invention provides a method for sequencing gene expression, which includes the following steps:

Use Oligo (dT) reverse transcription primer with the first adapter to reverse transcription of the RNA sample to obtain the first strand cDNA with the first adapter;

Use the transposase complex with a second linker to process the double-stranded cDNA, insert the second linker while fragmenting, to obtain a double-stranded cDNA fragment with the first linker and/or the second linker;

Use the double-stranded cDNA fragment with the first linker and/or the second linker for sequencing;

Wherein, the first linker and the second linker carry Index sequences required for library building and sequencing; the sequences of the first linker and the second linker are different.

According to the second objective of the present invention, the present invention also provides another gene expression sequencing method, the method comprising the following steps:

Amplify the double-stranded cDNA fragment with PCR primers designed according to the first linker sequence and the second linker sequence to obtain an RNA 3'end gene expression library;

Sequencing the RNA 3'gene expression library;

Wherein, the PCR primer designed according to the sequence of the first linker and the sequence of the second linker also includes an Index sequence required for library construction and sequencing; the sequence of the first linker and the second linker are different.

The beneficial effects of the present invention are as follows:

Traditional transcriptome library construction can easily lead to information loss due to cumbersome operations and excessive steps, and it is difficult to construct an expression library for low template mRNA (such as single-cell RNA). The method provided by the present invention intends to combine the relatively mature transposase complex-based library construction technology in the field of DNA NGS library construction with the requirement for expression detection of low template mRNA, so as to realize simple, fast and efficient RNA 3' End gene expression library construction.

The technical route of the present invention is clear. After reverse transcription of the RNA sample using Oligo (dT) primer with the first linker, the second-strand cDNA is synthesized, and the double-strand cDNA is processed by the transposase complex with the second linker Therefore, the first linker and the second linker were successfully added through the reverse transcription and transposition steps to generate a double-stranded cDNA with different linkers at both ends of the mRNA 3'-end region, which can be carried out directly or by adding a step of library amplification followed by downstream Sequencing. This method has high efficiency in library construction, and the method is simple and easy to implement. It saves time and effort. It is especially suitable for the construction of low-initiated RNA templates, especially single-cell RNA expression libraries. Research in the fields of omics and RNA sequencing has great and far-reaching significance.

Description of the drawings

The specific embodiments of the present invention will be described in further detail below in conjunction with the accompanying drawings.

Fig. 1 shows a schematic diagram of the principle of the present invention.

Figure 2 shows the electrophoresis detection results of the purified transposition products in Examples 1 and 2. Wherein, M refers to a DNA molecular marker of 100 bp, the amplified product of Example 1 is in Lane 1 and the amplified product of Example 2 is in Lane 2.

Fig. 3 shows the electrophoresis diagram of the library after sorting in Example 1 through the Agilent high-sensitivity DNA chip.

4 shows the electrophoresis diagram of the library after sorting in Example 2 through the Agilent high-sensitivity DNA chip.

Detailed ways

In order to explain the present invention more clearly, the present invention will be further described below in conjunction with preferred embodiments and drawings. Similar components in the drawings are denoted by the same reference numerals. Those skilled in the art should understand that the content described below is illustrative rather than restrictive, and should not limit the protection scope of the present invention.

The present invention provides a new method for quickly constructing an RNA 3'gene expression library. The method includes the following steps:

(1) Use Oligo (dT) reverse transcription primer with the first linker to perform reverse transcription on the mRNA sample to obtain the first strand cDNA with the first linker;

(2) Synthesize the second-strand cDNA using the first-strand cDNA as a template to obtain the double-stranded cDNA with the first linker;

(3) Treat the double-stranded cDNA with the transposase complex carrying the second linker, insert the second linker while fragmenting, to obtain a double-stranded cDNA fragment with the first linker and/or the second linker;

Wherein, the sequences of the first linker and the second linker are different to ensure that the double-stranded cDNA derived from the 3'end region of the mRNA template has different linker sequences at both ends.

In the terms "first linker" and "second linker" of the present invention, the linker sequence refers to the DNA sequence of the non-target nucleic acid component that provides addressing means to the nucleic acid fragment to which it is joined.

The mRNA sample of the present invention refers to an mRNA sample containing a polyA sequence at the 3'end of a eukaryotic organism. The mRNA sample can be obtained through conventional RNA extraction, purification and enrichment steps, which are all mature technologies in the prior art, and the present invention does not impose further restrictions on this.

The specific technical process of the present invention is as follows: firstly, reverse transcription of the RNA sample is carried out with Oligo (dT) primer with the first linker to obtain the first strand cDNA with the first linker, and then by digesting the mRNA template, synthesizing the second The double-stranded cDNA with the first linker can be obtained from the stranded cDNA; then the double-stranded cDNA is treated with the transposase complex with the second linker sequence, and the second linker is inserted while fragmenting; The double-stranded cDNA in the 3'end region of the mRNA template has different first and second linker sequences at both ends, and the remaining fragments have the same second linker sequence at both ends, so there is only the 3'end region of the mRNA template The downstream sequencing work can be performed, and the remaining areas will not be used. In summary, the present invention can effectively realize the construction and sequencing of the transcriptome library for the 3'end of mRNA. The transcriptome library obtained by the method provided by the present invention can be used in Roche, Illumina, ThermoFisher, Pacific Biosciences, BGI, Oxford Nanopore Technologies, Huayinkang, and Hanhai Gene high-throughput sequencing platforms.

The double-stranded cDNA fragment with the first linker and/or the second linker obtained in the present invention can be directly subjected to downstream sequencing work, or the library can be amplified by using PCR primers designed according to the first linker and the second linker sequence to realize Enrichment and amplification of the target area, and then downstream sequencing work.

In a preferred embodiment of the present invention, when the library needs to be amplified, the method further includes the following steps: Amplify the double-stranded cDNA fragment with PCR primers designed according to the first linker sequence and the second linker sequence, Obtain the RNA 3'end gene expression library. When the amount of the original RNA sample is very low, this step of amplification can effectively expand the amount of double-stranded cDNA fragments to achieve the enrichment of the target region and signal amplification. Further preferably, the PCR primers designed according to the first linker sequence and the second linker sequence in this step also include the Index sequence required for library building and sequencing. Those skilled in the art can understand that in the achievable embodiments of the present invention, the PCR primers designed according to the first linker sequence and the second linker sequence may also include any other desired sequences, such as high-throughput single cell When sequencing, the molecular tags and cell tags are introduced by multi-step PCR, and high throughput is achieved by multiplying the numbers of the two. Introduce any other desired sequences through the library amplification PCR step to achieve downstream sequencing work.

In a preferred embodiment of the present invention, when directly performing downstream sequencing work, the first adapter and the second adapter directly carry the Index sequence required for library construction and sequencing or any sequence required for other sequencing, so as to achieve Downstream sequencing work.

In a preferred embodiment of the present invention, the transposase complex in step (3) comprises a transposase and inserting DNA. The transposase can be Tn5, MuA or other transposable functions. Transposase. Further preferably, in the transposase complex, the insert carrying the second linker may be two identical DNA molecules; or the insert carrying the second linker may also be a piece of DNA with the same second linker sequence at both ends. The molecule is formed at this time as a circular transposon complex (see the patent application "A circular transposon complex and its application", application number 201710013203.8).

In a preferred embodiment of the present invention, the reverse transcription primer used when synthesizing the first-strand cDNA of the present invention is an Oligo(dT) primer with a first linker sequence at the 5'end; The nucleotides of anchor bases annealed in the poly(A) region. This primer can bind to all the mRNA components in the eukaryotic total RNA sample to initiate reverse transcription.

In another preferred embodiment of the present invention, the reverse transcription primer used when synthesizing the first-strand cDNA of the present invention is an Oligo (dT) primer with a first linker sequence at the 5'end; the 3'end contains T-base nucleotides.

Traditional gene expression library construction methods usually first require mRNA capture or ribosomal RNA removal, and then reverse transcription, followed by more cumbersome traditional library construction procedures (including fragmentation, end repair and A, linker connection, library Steps such as amplification, as well as multi-step product sorting and purification). This method is complicated in steps, time-consuming and laborious, and has a high probability of operation contamination. It requires a high initial amount of RNA samples. For a small amount of RNA template, especially single-cell RNA library construction, the effect is often not ideal.

The present invention uses the technical route of reverse transcription—synthesis of double-stranded cDNA—in vitro transposition. Through the two steps of reverse transcription and transposition, the 3'-end region of the mRNA template is successfully constructed into a library with different linker sequences at both ends. Directly or add a step of library amplification followed by downstream sequencing. This method has fewer steps, simple and flexible operation, and is particularly suitable for low-initiated RNA library building, such as single-cell RNA library building and sequencing.

Based on the method for constructing an RNA 3'gene expression library provided by the present invention, the present invention also provides two methods for sequencing gene expression.

Among them, the first sequencing method includes the following steps:

The second sequencing method includes the following steps:

Sequencing the RNA 3'gene expression library;

Example 1 Enter the paired-end sequencing adapter by PCR after transposition method

1. Enrichment of mRNA

For the enrichment of eukaryotic mRNA, the specific steps are conventional mRNA enrichment steps. For example, an mRNA purification kit (Beijing Quanshijin Biology, catalog number: EC801) can be used, and the steps are omitted here.

2. Synthesis of the first strand cDNA

For the synthesis of first-strand cDNA, for example, use the first-strand cDNA transcription synthesis kit (Beijing Quanshijin Biology, catalog number: AT301) for this operation:

1>Add each component according to the following system:

Oligo(T)-VN1 is an Oligo(dT) reverse transcription primer with a first linker, the sequence is: GACGTGTGCTCTTCCGATCTAAAAAAAAAAAAAAAAAAAAAAAAVN (shown in SEQ ID NO.1), where V represents the three bases of G/A/C Any one of the four bases, N represents any one of the four bases G/A/C/T.

2>Mix gently; incubate at 42°C for 30 minutes;

3> Heat at 85°C for 5 seconds to inactivate RT/RI transcriptase.

3. Digestion of mRNA

1>Add 1μl RNase mixture to the above system, digest the residual mRNA at 37°C for 15 minutes to obtain the first strand cDNA solution with the first linker;

4. Second strand synthesis

In the above system, the synthesis of the second strand is directly performed, for example, the first strand cDNA transcription synthesis kit of Quanshijin Company (Beijing Quanshijin Biology, catalog number: AT302) is used for this step.

1>Add each component according to the following system:

2> Mix gently; incubate at 16°C for 60 minutes to obtain a double-stranded cDNA solution with the first linker;

5. Insert the second joint of the transposition method

In the above system, the Tn5 transposition complex Tn5-S containing the same short linker (prepared by annealing Oligo A and Oligo B) is used to directly insert the double-stranded cDNA. The sequence of Oligo A is: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (As shown in SEQ ID NO. 2); Oligo B's sequence is: CTGTCTCTTATACACATCT (as shown in SEQ ID NO. 3). The steps to insert are:

1>Add each component according to the following system:

Note: The transposase Tn5 can react slowly at room temperature, so the reaction mixture should be added on ice, and the incubation reaction should be performed immediately after pipetting and mixing.

2>Blow and mix with pipette. If there is liquid on the tube wall, it can be centrifuged, and the next step of reaction will be carried out immediately.

3> Put the sample in a PCR machine and incubate at 55°C for 5 minutes (cover temperature 70°C).

4>Place on ice immediately, and immediately add 20μl 4×Tn5 Digestion Mix* to the reaction tube, pipette to mix evenly, incubate at 55°C for 5 minutes in the PCR machine (cover temperature 70°C), and place on ice immediately in.

6. Purification of transposition products

For product purification, the specific operation is omitted. For example, in this embodiment, MagicPure™ Size Selection DNA Beads (Beijing Quanshijin Biotech, catalog number: EC401) is used for purification. After purification, the purified product was subjected to electrophoresis detection. The detection result is shown in Figure 2. It can be seen that the purified transposition product is mainly distributed in the range of 300-500bp, and the fragmentation effect is good.

7. Amplification of the 3'end product

1>Add each component according to the following system:

Among them, the sequence of the upstream primer Primer-F is: CAAGCAGAAGACGGCATACGAGAT[index-i5]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT; where [index-i5] is inserted into the original sequence of the upstream primer Primer-F CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTG.TGCTTCCGIDATCAGACGNO. The position is shown in the sequence of the upstream primer Primer-F.

The sequence of the downstream primer Primer-R is: AATGATACGGCGACCACCGAGATCTACAC[index-i7]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG. Among them, [index-i7] is inserted in the middle of the original sequence AATGACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (shown in SEQ ID NO. 5) of the downstream primer Primer-R, and the specific insertion position is shown in the sequence of the primer-R of the lower primer.

2>Blow and mix with pipette, if there is liquid on the tube wall, it can be centrifuged.

3>Perform the following amplification procedures in the PCR machine

*This step cannot be omitted. The transposition reaction product is not a complete double-stranded DNA. Incubate at 72°C for 3 minutes to generate a mature PCR template.

8. Sorting of amplified products:

For product fragment sorting, for example, MagicPure™ Size Selection DNA Beads (Beijing Quanshijin Biotech, catalog number: EC401) is used in this embodiment. In order to prevent the residue of primers and large fragments, it is recommended to perform two fragment sorting. The specific operation of sorting is omitted. After sorting, the Agilent 2100 high-sensitivity DNA chip was used to detect the sorted products. The test results are shown in Figure 3. It can be seen that the amplified products are mainly distributed in the range of 300-500bp after sorting, and the size distribution and peak shape are normal.

Example 2 Direct sequencing after transposition method

1. Enrichment of mRNA

Same as step 1 in example 1

2. Synthesis of the first strand cDNA

The synthesis of the first strand cDNA is performed. For example, in this example, the first-strand cDNA transcription synthesis kit (Beijing Quanshijin Biology, catalog number: AT301) was used to perform this operation:

1>Add each component according to the following system:

Oligo(T)-VN2 is Oligo(dT) reverse transcription primer 2 with a first linker, and its sequence is: CAAGCAGAAGACGGCATACGAGAT[index-i5]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAAAAAAAAAAAAAAAAAAAAAAAVN.

Among them, [index-i5] plays a role in distinguishing the data of each sample. Each sample has a different index. When sequencing, the data of the sample will be distinguished by the difference of the index; [index-i5] is inserted in the with The original sequence of the Oligo (dT) reverse transcription primer of the first linker 2: CAAGCAGAAGACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAAAAAAAAAAAAAAAAAAAAAVN (shown in SEQ ID NO. 6) in the middle, the specific insertion position is as in the Oligo (dT) reverse transcription primer 2 with the first linker The sequence is shown.

Among them, the V at the end of the sequence represents any of the three bases of G/A/C, and N represents any of the four bases of G/A/C/T.

2>Mix gently; incubate at 42°C for 30 minutes;

3> Heat at 85°C for 5 seconds to inactivate RT/RI transcriptase.

3. Digestion of mRNA

Same as step 3 in example 1

4. Second strand synthesis

Same as step 4 in example 1

5. Insert the second joint of the transposition method

In the above system, the Tn5 transposable complex Tn5-L containing the same long linker (prepared by the annealing of Oligo C and Oligo B) is used to directly insert the double-stranded cDNA; the sequence of Oligo C is: CAAGCAGAAGACGGCATACGAGAT [index-i7] GTCTCGTGGGCTCGGAGATGTGTATA AGAGACAG; [index-i7] is inserted in the original Oligo C sequence CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (shown in SEQ ID NO. 7), and the specific insertion position is shown in the sequence of Oligo C.

The steps to insert are:

1>Add each component according to the following system:

4>Place on ice immediately, and immediately add 15μl 5×Tn5 Repair Mix to the reaction tube, pipette to mix evenly, incubate at 65°C for 5 minutes in the PCR machine (cover temperature 99°C), and place in ice immediately .

6. Purification of transposition products

Same as step 6 in Example 1. The purified product was detected by electrophoresis, as shown in Figure 2.

7. Sorting of transposition products:

Carry out product fragment sorting. For example, in this embodiment, MagicPure™ Size Selection DNA Beads (Beijing Quanshijin Biotech, catalog number: EC401) is used. In order to prevent the residue of primers and large fragments, it is recommended to perform two fragment sorting. The specific operation of sorting is omitted. After sorting, the Agilent 2100 high-sensitivity DNA chip was used to detect the sorted products. The test results are shown in Figure 4. It can be seen that the amplified products are mainly distributed in the range of 300-500bp after sorting, and the size distribution and peak shape are normal. .

Obviously, the above-mentioned embodiments of the present invention are merely examples to clearly illustrate the present invention, and are not meant to limit the implementation of the present invention. For those of ordinary skill in the art, they can also do on the basis of the above description. In addition to other different forms of changes or changes, it is not possible to list all the implementations here. Any obvious changes or changes derived from the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

A method for quickly constructing an RNA 3'gene expression library, characterized in that the method includes the following steps:

Use Oligo dT reverse transcription primer with the first linker to perform reverse transcription on the mRNA sample to obtain the first-strand cDNA with the first linker;

Synthesize the second-strand cDNA using the first-strand cDNA as a template to obtain the double-stranded cDNA with the first linker;

Use the transposase complex carrying the second linker to process the double-stranded cDNA, insert the second linker while fragmenting, to obtain a double-stranded cDNA fragment with the first linker and/or the second linker;

Wherein, the sequence of the first linker and the second linker are not the same.
The method according to claim 1, wherein the method further comprises the following steps:

The double-stranded cDNA fragments are amplified by PCR primers designed according to the first linker sequence and the second linker sequence to obtain an RNA 3'end gene expression library.
The method according to claim 2, wherein the PCR primers designed according to the first linker sequence and the second linker sequence further include an Index sequence required for library construction and sequencing.
The method according to claim 1, wherein the first linker and the second linker carry Index sequences required for library construction and sequencing.
The method of claim 1, wherein the transposase complex comprises a transposase and inserting DNA; and the transposase is Tn5 transposase or MuA transposase.
The method according to claim 1, wherein in the transposase complex, the insert DNA carrying the second linker is two identical DNA molecules, or the insert DNA carrying the second linker is a band at both ends DNA molecules with the same second linker.
The method according to claim 1, wherein the Oligo dT reverse transcription primer with a first linker has an Oligo dT primer with a first linker sequence at its 5'end, and a T base at its 3'end Base nucleotides.
The method according to claim 1, wherein the Oligo dT reverse transcription primer with a first linker has an Oligo dT primer with a first linker sequence at its 5'end, and an Oligo dT primer with a first linker sequence at its 3'end. Nucleotides containing anchor bases that anneal to the polyA region of the mRNA.
A method for sequencing gene expression, characterized in that the method comprises the following steps:

Use Oligo dT reverse transcription primer with the first linker to perform reverse transcription on the RNA sample to obtain the first strand cDNA with the first linker;

Synthesize the second-strand cDNA using the first-strand cDNA as a template to obtain the double-stranded cDNA with the first linker;

Use the transposase complex with a second linker to process the double-stranded cDNA, insert the second linker while fragmenting, to obtain a double-stranded cDNA fragment with the first linker and/or the second linker;

Use the double-stranded cDNA fragment with the first linker and/or the second linker for sequencing;

Wherein, the first linker and the second linker carry Index sequences required for library building and sequencing; the sequences of the first linker and the second linker are different.
A method for sequencing gene expression, characterized in that the method comprises the following steps:

Use Oligo dT reverse transcription primer with the first linker to perform reverse transcription on the RNA sample to obtain the first-strand cDNA with the first linker;

Synthesize the second-strand cDNA using the first-strand cDNA as a template to obtain the double-stranded cDNA with the first linker;

Use the transposase complex with a second linker to process the double-stranded cDNA, insert the second linker while fragmenting, to obtain a double-stranded cDNA fragment with the first linker and/or the second linker;

Amplify the double-stranded cDNA fragment with PCR primers designed according to the first linker sequence and the second linker sequence to obtain an RNA 3'end gene expression library;

Sequencing the RNA 3'gene expression library;

Wherein, the PCR primer designed according to the sequence of the first linker and the sequence of the second linker also includes an Index sequence required for library construction and sequencing; the sequence of the first linker and the second linker are different.