CN117778287A

CN117778287A - Escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by using simple substance particles and construction method thereof

Info

Publication number: CN117778287A
Application number: CN202311851259.2A
Authority: CN
Inventors: 夏洪志; 李古月; 施晓玲; 徐铮; 孙怡; 牛堃; 李江波
Original assignee: Nantong Licheng Biological Engineering Co ltd
Current assignee: Nantong Licheng Biological Engineering Co ltd
Priority date: 2023-12-29
Filing date: 2023-12-29
Publication date: 2024-03-29

Abstract

The invention relates to the technical field of bioengineering, in particular to an escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by utilizing simple substance particles and a construction method thereof. The escherichia coli recombinant strain carries a recombinant plasmid ptrc99a-CBGWFYS; the recombinant plasmid ptrc99a-CBGWFYS comprises a ManCB gene cluster, a GmdWcag gene cluster, a FucT gene, a LacY gene and a setA gene; the initial strain of the escherichia coli recombinant strain is escherichia coli from which lacZ genes are knocked out. According to the invention, transcription is controlled by a Trc promoter through all of the ManCB gene cluster, the GmdWcag gene cluster, the FucT gene, the LacY gene and the setA gene, and under the condition, the recombinant escherichia coli strain carrying ptrc99a-CBGWFYS is fermented in a shake flask to synthesize 2' -FL, so that the yield of 7.85g/L can be obtained.

Description

Escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by using simple substance particles and construction method thereof

Technical Field

The invention relates to the technical field of bioengineering, in particular to an escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by utilizing simple substance particles and a construction method thereof.

Background

Human milk oligosaccharides (human milk oligosaccharides, abbreviated HMO) are a very important class of nutrients in breast milk, mostly consisting of 3 to 6 sugar groups, more than 200 having been found to date. Representative HMO components include 2 '-fucosyllactose, 2' -FL (CAS number 41263-94-9), 3-fucosyllactose (3-FL), 6 '-sialyllactose (6' -SL), lactose-N-neotetraose (LNnT), and the like. Since biosynthesis of 2'-FL requires more over-expressed key enzyme genes, the use of a multi-plasmid system is unavoidable, and reported 2' -fucosyllactose synthesis strains often use a two-plasmid, even three-plasmid, four-plasmid system. Such as Huang et al ^[1] In E.coli BL21 (DE 3), the DE novo synthesis of 2' -FL was achieved by coexisting expression of a plurality of plasmids such as pACYCDuet-1, pETDuet-1, pCDFDuet-1, pCOLADuet-1, etc., with a yield of 9.12g/L; chin et al ^[2] In E.coli BL21star (DE 3), 2' -FL was synthesized using coexisting expression of pETDuet-1 and pCOLADuet-1 with a yield of 15.4g/L. Ni et al ^[3] pRSFDuet-1 and pETDuet-1 plasmids were used to synthesize 2' -FL in the C41 (DE 3) strain by co-expression at 66.8g/L.

However, the coexistence of multiple plasmids may cause an increased host metabolic burden to affect strain growth, and multiple antibiotics are added during fermentation, increasing production cost and downstream componentsAnd (5) difficulty in separation and extraction. On the other hand, chromosomal integration means based on lambda-Red or CRISPR-Cas9 technology enable the construction of plasmid-free strains, e.gEt al ^[4] Five key enzyme genes for 2'-FL synthesis were integrated on the JM109 strain chromosome, and the yield of 2' -FL in the 10L fermenter was 20.3g/L, which did not carry any plasmid.

Since 2' -FL is a food additive for infant milk powder, the fewer and better the antibiotic use of the production process, the more likely it seems that the engineering bacteria in chromosome-integrated form are the optimal choice. However, the key enzyme gene copy number for chromosomal integration is generally much lower than plasmid expression, so for some rate-limiting enzymes with low enzyme activity, insufficient enzyme activity is expressed after chromosomal integration, resulting in lower final product yields than plasmid expression.

Reference is made to:

[1]Huang,D.,Yang,K.,Liu,J.,Xu,Y.,Wang,Y.,Wang,R.,Liu,B.,Feng,L.,2017.Metabolic engineering of Escherichia coli for the production of 2′-fucosyllactose and 3-fucosyllactose through modular pathway enhancement.Metab.Eng.41,23-38.

[2]Chin,Y.W.,Seo,N.,Kim,J.H.,Seo,J.H.,2016.Metabolic engineering of Escherichia coli to produce 2′-fucosyllactose via salvage pathway of guanosine 5′-diphosphate(GDP)-L-fucose:2-FL production from fucose and lactose in E.coli.Biotechnol.Bioeng.113,2443-2452.

[3]Ni,Z.,Li,Z.,Wu,J.,Ge,Y.,Liao,Y.,Yuan,L.,Chen,X.,Yao,J.,2020.Multi-path optimization for efficient production of 2′-fucosyllactose in an engineered Escherichia coli C41(DE3)derivative.Front.Bioeng.Biotechnol.8,611900.

[4]F.,Seitz,L.,Sprenger,G.A.,&Albermann,C.(2013).Construction of Escherichia coli strains with chromosomally integrated expression cassettes for the synthesis of 2′-fucosyllactose.Microbial Cell Factories,12,1-13.

disclosure of Invention

In order to solve the problems, the invention provides an escherichia coli recombinant strain for synthesizing 2 '-fucosyllactose by using simple substance particles and a construction method thereof, and the invention aims to integrate key enzyme genes required by biosynthesis of 2' -fucosyllactose (2 '-FL) onto the same plasmid by using a bioengineering technology, and control transcription and expression of the genes by using Ptrc promoter, thereby finally constructing the recombinant escherichia coli strain which only contains the plasmid but can efficiently synthesize the 2' -fucosyllactose. The single plasmid strain provided by the invention can ensure that the key enzyme gene has higher expression copy number and relatively smaller metabolic pressure on a host, thereby having certain advantages.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by utilizing simple substance particles, wherein the escherichia coli recombinant strain carries recombinant plasmid ptrc99a-CBGWFYS;

the recombinant plasmid ptrc99a-CBGWFYS comprises a ManCB gene cluster, a GmdWcag gene cluster, a FucT gene, a LacY gene and a setA gene;

the initial strain of the escherichia coli recombinant strain is an escherichia coli C41 (DE 3) strain with lacZ gene knocked out.

The invention also provides a construction method of the escherichia coli recombinant strain for synthesizing the 2' -fucosyllactose by using the simple substance particles, which comprises the following steps:

1) Connecting the ptrc99a vector with a ManCB gene cluster, a GmdWcag gene cluster, a FucT gene, a LacY gene and a SetA gene respectively to obtain ptrc99a-CB recombinant plasmid, ptrc99a-GW recombinant plasmid, ptrc99a-T recombinant plasmid, ptrc99a-Y recombinant plasmid and ptrc99a-S recombinant plasmid respectively;

2) Respectively taking the ptrc99a-CB recombinant plasmid, the ptrc99a-GW recombinant plasmid, the ptrc99a-T recombinant plasmid, the ptrc99a-Y recombinant plasmid and the ptrc99a-S recombinant plasmid obtained in the step 1) as templates, and amplifying by primer pairs to respectively obtain RBS-ManCB gene cluster fragments, RBS-GmdWcag gene cluster fragments, RBS-FucT gene fragments, RBS-LacY gene fragments and RBS-set A gene fragments;

3) Connecting the RBS-ManCB gene cluster fragment, the RBS-GmdWcag gene cluster fragment, the RBS-FucT gene fragment, the RBS-LacY gene fragment and the RBS-SetA gene fragment obtained in the step 2) into a ptrc99a vector to obtain a recombinant plasmid ptrc99a-CBGWFYS;

4) Converting the recombinant plasmid ptrc99a-CBGWFYS obtained in the step 3) into escherichia coli to obtain an escherichia coli recombinant strain; the E.coli knockdown the lacZ gene.

Preferably, the nucleotide sequence of the upstream primer of the primer pair used for amplifying the backbone DNA of the ptrc99a vector in the step 1) is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the ManCB gene cluster is shown as SEQ ID No.3, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 4;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the GmdWcag gene cluster is shown as SEQ ID No.5, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 6;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the FucT gene is shown as SEQ ID No.7, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 8;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the LacY gene is shown as SEQ ID No.9, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 10;

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the setA gene is shown as SEQ ID No.11, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 12.

Preferably, the nucleotide sequence of the upstream primer of the primer pair used for amplifying the RBS-ManCB gene cluster fragment in the step 2) is shown as SEQ ID No.13, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 14;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the RBS-GmdWcag gene cluster fragment is shown as SEQ ID No.15, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 16;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the RBS-FucT gene fragment is shown as SEQ ID No.17, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 18;

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the RBS-LacY gene fragment is shown as SEQ ID No.19, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 20;

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the RBS-SetA gene fragment is shown as SEQ ID No.21, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 22.

Preferably, the nucleotide sequence of the upstream primer of the primer pair used in the amplification of the linearized fragment of the ptrc99a vector in the step 3) is shown in SEQ ID No.23, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 24.

Preferably, the system connected in step 3) comprises: a linearized fragment of the ptrC99a vector of 100ng, an RBS-ManCB gene cluster fragment of 100ng, an RBS-GmdWcag gene cluster fragment of 100ng, an RBS-FucT gene fragment of 100ng, an RBS-LacY gene fragment of 100ng, an RBS-SetA gene fragment of 100ng,10 XTangbuffer 2. Mu. L, T4DNA ligase of 1. Mu.L and BsaI enzyme of 1. Mu.L were made up to 20. Mu.L.

Preferably, the conditions of the connection include: 37 ℃ for 1min; 1min at 16 ℃ for 30 cycles; and at 60℃for 5min.

Preferably, the E.coli in the step 4) is E.coli C41 (DE 3).

Preferably, the volume ratio of the recombinant plasmid ptrc99a-CBGWFYS in the step 4) to the escherichia coli is 1:100;

the recombinant plasmid ptrc99a-CBGWFYS is converted in a solution form, and the concentration is 10 ng/. Mu.L;

the escherichia coli is transformed in a bacterial liquid form, and the wet bacterial content is 20g/L.

Preferably, the conditions of the transformation include: mixing the recombinant plasmid ptrc99a-CBGWFYS and escherichia coli on ice, standing for 20min, and then heating for 90s in a water bath at 42 ℃, and then rapidly placing on ice for 3-5 min.

The beneficial effects of the invention are as follows:

according to the invention, transcription is controlled by the ManCB gene cluster, the GmdWcag gene cluster, the FucT gene, the LacY gene and the setA gene through the Trc promoter, and under the condition, the recombinant escherichia coli strain carrying ptrc99a is subjected to shake flask fermentation to synthesize 2' -FL, so that the yield of 7.85g/L can be obtained.

Detailed Description

The invention provides an escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by utilizing simple substance particles, wherein the escherichia coli recombinant strain carries recombinant plasmid ptrc99a-CBGWFYS; the recombinant plasmid ptrc99a-CBGWFYS comprises a ManCB gene cluster, a GmdWcag gene cluster, a FucT gene, a LacY gene and a setA gene; the initial strain of the escherichia coli recombinant strain is escherichia coli from which lacZ genes are knocked out.

The invention provides a construction method of an escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by utilizing simple substance grains, which comprises the following steps:

The invention connects the ptrc99a vector with the ManCB gene cluster, the GmdWcag gene cluster, the FucT gene, the LacY gene and the SetA gene respectively to obtain ptrc99a-CB recombinant plasmid, ptrc99a-GW recombinant plasmid, ptrc99a-T recombinant plasmid, ptrc99a-Y recombinant plasmid and ptrc99a-S recombinant plasmid respectively.

In the invention, the nucleotide sequence of an upstream primer of a primer pair used for amplifying skeleton DNA of a ptrc99a vector is shown as SEQ ID No.1, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.2, and is specifically as follows:

SEQ ID No.1：TCTAGAGTCGACCTGCAGGCA；

SEQ ID No.2：GGTCTGTTTCCTGTGTGAAATTGT；

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the ManCB gene cluster is shown as SEQ ID No.3, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.4, and the specific steps are as follows:

SEQ ID No.3：tttcacacaggaaacagaccATGGCTGCGCAGTCGAAA；

SEQ ID No.4：gcctgcaggtcgactctagaTTACTCGTTCAGCAACGTCAGC；

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the GmdWcag gene cluster is shown as SEQ ID No.5, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.6, and the specific steps are as follows:

SEQ ID No.5：tttcacacaggaaacagaccATGTCAAAAGTCGCTCTCATCACC；

SEQ ID No.6：gcctgcaggtcgactctagaTTACCCCCGAAAGCGGTC；

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the FucT gene is shown as SEQ ID No.7, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.8 and is specifically as follows:

SEQ ID No.7：tttcacacaggaaacagaccATGGCTTTTAAGGTGGTGCAA；

SEQ ID No.8：gcctgcaggtcgactctagaTTAAGCGTTATACTTTTGGGATTTCA；

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the LacY gene is shown as SEQ ID No.9, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.10, and is specifically shown as follows;

SEQ ID No.9：

tttcacacaggaaacagaccATGTACTATTTAAAAAACACAAACTTTTGG；

SEQ ID No.10：gcctgcaggtcgactctagaTTAAGCGACTTCATTCACCTGACG；

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the setA gene is shown as SEQ ID No.11, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.12, and the specific steps are as follows:

SEQ ID No.11：tttcacacaggaaacagaccATGATCTGGATAATGACGATGGC；

SEQ ID No.12：gcctgcaggtcgactctagaTCAAACGTCTTTAACCTTTGCG。

the invention respectively uses the obtained ptrc99a-CB recombinant plasmid, ptrc99a-GW recombinant plasmid, ptrc99a-T recombinant plasmid, ptrc99a-Y recombinant plasmid and ptrc99a-S recombinant plasmid as templates, and the RBS-ManCB gene cluster fragment, RBS-GmdWcag gene cluster fragment, RBS-FucT gene fragment, RBS-LacY gene fragment and RBS-set A gene fragment are obtained by primer pair amplification.

In the invention, the nucleotide sequence of an upstream primer of a primer pair used for amplifying RBS-ManCB gene cluster fragments is shown as SEQ ID No.13, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.14, and is specifically as follows:

SEQ ID No.13：ggctacggtctcaAAACTCTATCCAGTTGTGATG；

SEQ ID No.14：ggctacggtctccttgacatggtctgtttcctTTACTCGTTCAGCAACGTC；

the nucleotide sequence of an upstream primer of a primer pair used for amplifying RBS-GmdWcag gene cluster fragments is shown as SEQ ID No.15, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.16, and the specific steps are as follows:

SEQ ID No.15：ggctacggtctccTCAAAAGTCGCTCTCATCACC；

SEQ ID No.16：ggctacggtctcattcctTTACCCCCGAAAGCGGTC；

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the RBS-FucT gene fragment is shown as SEQ ID No.17, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.18, and the specific steps are as follows:

SEQ ID No.17：ggctacggtctcaGGAAACAGACCATGGCTTTTAAG；

SEQ ID No.18：ggctacggtctccccttTAAGCGTTATACTTTTGGGATTTC；

the nucleotide sequence of an upstream primer of a primer pair used for amplifying the RBS-LacY gene fragment is shown as SEQ ID No.19, and the nucleotide sequence of a downstream primer is shown as SEQ ID No.20, and the specific steps are as follows:

SEQ ID No.19：ggctacggtctccaaggAAACAGACCATGTAC；

SEQ ID No.20：ggctacggtctcttcctTTAAGCGACTTCATTCAC；

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the RBS-SetA gene fragment is shown as SEQ ID No.21, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.22, and the specific steps are as follows:

SEQ ID No.21：ggctacggtctctAGGAAACAGACCATGATC；

SEQ ID No.22：ggctacggtctctatcaAACGTCTTTAACCTTTG；

the nucleotide sequence of the upstream primer of the primer pair used for amplifying the linearized fragment of the ptrc99a vector is shown as SEQ ID No.23, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.24, and is specifically as follows:

SEQ ID No.23：ggctacggtctcttgatCTAGAGTCGACCTGCAG；

SEQ ID No.24：

ggctacggtctcagtttcgactgcgcagccatGGTCTGTTTCCTGTGTGAAATTG。

the invention connects the RBS-ManCB gene cluster fragment, RBS-GmdWcag gene cluster fragment, RBS-FucT gene fragment, RBS-LacY gene fragment and RBS-SetA gene fragment into a ptrC99a vector to obtain recombinant plasmid ptrC99a-CBGWFYS.

In the present invention, the linked system preferably comprises: a linearized fragment of the ptrC99a vector of 100ng, an RBS-ManCB gene cluster fragment of 100ng, an RBS-GmdWcag gene cluster fragment of 100ng, an RBS-FucT gene fragment of 100ng, an RBS-LacY gene fragment of 100ng, an RBS-SetA gene fragment of 100ng,10 XTangbuffer 2. Mu. L, T4DNA ligase of 1. Mu.L and BsaI enzyme of 1. Mu.L were made up to 20. Mu.L. In the present invention, the conditions of the connection preferably include: 37 ℃ for 1min; 1min at 16 ℃ for 30 cycles; and at 60℃for 5min.

The recombinant plasmid ptrc99a-CBGWFYS obtained is transformed into escherichia coli to obtain an escherichia coli recombinant strain; the E.coli knockdown the lacZ gene.

In the present invention, the E.coli is preferably E.coli C41 (DE 3). In the invention, the volume ratio of the recombinant plasmid ptrc99a-CBGWFYS to the escherichia coli is preferably 1:100; the recombinant plasmid ptrc99a-CBGWFYS is preferably transformed in the form of a solution with the concentration of 10 ng/. Mu.L; the escherichia coli is preferably transformed in a bacterial liquid form, and the wet bacterial content is 20g/L. In the present invention, the conditions for the transformation preferably include: mixing the recombinant plasmid ptrc99a-CBGWFYS and escherichia coli on ice, standing for 20min, and then heating for 90s in a water bath at 42 ℃, and then rapidly placing on ice for 3-5 min.

The present invention will be described in detail with reference to examples for further illustration of the invention, but they should not be construed as limiting the scope of the invention.

Example 1

Cloning of Critical enzyme genes

The key enzyme genes required for the synthesis of 2' -fucosyllactose include the ManCB gene cluster (Genbank accession number: NP-416553.1), the GmdWcag gene cluster (Genbank accession number: NP-416557.1), the FucT gene (Genbank accession number: LS 483488.1), the LacY gene (Genbank accession number: AKK 16698.1), the setA gene (Genbank accession number: AP 009048). The above genes were first amplified separately by PCR and ligated into ptrc99a vector as follows:

the ptrc99a vector backbone, the ManCB gene cluster, the GmdWcag gene cluster, the FucT gene, the LacY gene and the SetA gene are obtained by PCR reaction, respectively.

Taking ptrc99a vector backbone amplification as an example, the PCR reaction system is: a total of 100. Mu.L was found, of which 1. Mu.L of ptrc99a vector, 1.5. Mu.L of Ex-Taq enzyme (Takara Co., product number: RR 001A), 2. Mu.L of primer ptrc99 a_fwd2. Mu.L, 10 Xbuffer buffer, and 10. Mu.L of the remainder were filled with double distilled water. The PCR amplification procedure was: pre-denaturation at 95℃for 1min,30 cycles of denaturation at 95℃for 30 sec, annealing at 55℃for 30 sec, extension at 72℃for 4 min, and final extension at 72℃for 1 min. The above fragment was recovered using a DNA purification kit (Takara Corp., miniBEST Agarose Gel DNA Extraction Kit, cat# 9762).

Taking the amplification of the ManCB gene cluster as an example, the PCR reaction system is as follows: a total of 100. Mu.L, 1. Mu.L of the genomic DNA of E.coli W3110 strain, 1.5. Mu.L of Ex-Taq enzyme (Takara Co., ltd., cat. No.: RR 001A), 2. Mu.L of the primer ManCB_fwd2. Mu.L, 2. Mu.L of the primer ManCB_rev2. Mu.L, 10 Xbuffer 10. Mu.L, and the remainder were filled with double distilled water. The PCR amplification procedure was: pre-denaturation at 95℃for 1min,30 cycles of denaturation at 95℃for 30 sec, annealing at 55℃for 30 sec, extension at 72℃for 3 min, and final extension at 72℃for 1 min. The above fragment was recovered using a DNA purification kit (Takara Co., miniBEST Agarose Gel DNA Extraction Kit, cat# 9762) by a method described in the kit instructions, and stored at-20℃in a refrigerator after recovery.

Primers used in Table 1

The amplified ptrc99a vector backbone DNA and the ManCB gene cluster DNA were ligated by a ligation kit (Nanjinouzan Biotechnology Co., ltd.)II One Step Cloning Kit kit part number: c112-02), methods refer to kit instructions; coli DH 5. Alpha. Competent cells (Nanjinouzan Biotechnology Co., ltd., cat# C502-03) were transformed with the ligation product, and cultured overnight at 37℃on 50mg/L ampicillin LB agar plates. The growing clone is verified by PCR whether the full length accords with a theoretical value, and the primer sequence is as follows: verifyfwdSEQ ID No.25: TCAGGCAGCCATCGGAAGC, verifyRevSEQ ID No.26: TGGCAGTTTATGGCGGGC; the correct clone PCR product was approximately 3.0kbp in length. Positive clones were cultured in LB liquid medium at 37℃and extracted using plasmid extraction kit (Nannunovozan Biotechnology Co., ltd., cat# DC 201-01)The recombinant plasmid of the positive clone was named "ptrc99a-CB" recombinant plasmid. The GmdWcag gene cluster, fucT gene, lacY gene and SetA gene were ligated with the ptrc99a vector by the same method to obtain recombinant plasmids "ptrc99a-GW", "ptrc99a-T", "ptrc99a-Y" and "ptrc99a-S", respectively.

Example 2

Construction of Single plasmid for expression (V1)

The ptrc99a vector was used as a template, the ptrc99 a-fwd 2 and ptrc99 a-rev 2 primers were used to amplify the ptrc99a vector backbone DNA and to attach the corresponding Overhang adapter and BsaI cleavage site for Golden gate ligation, and the DNA was recovered using a DNA purification kit (Takara Corp., miniBEST Agarose Gel DNA Extraction Kit, cat# 9762) with reference to the kit instructions. The recombinant plasmid ptrc99a-CB is used as a template, the primers ManCB_fwd2 and ManCB_rev2 are used for amplifying the DNA fragment of the RBS sequence-ManCB, a DNA purification kit (Takara company, miniBEST Agarose Gel DNA Extraction Kit, product number: 9762) is used for recovering the fragment, the method refers to the kit instruction, and a refrigerator is used for preserving at-20 ℃ after recovery. The same procedure was used to amplify the "RBS sequence-GmdWcag" fragment, the "RBS sequence-FucT" fragment, the "RBS sequence-LacY" fragment, and the "RBS sequence-SetA" fragment.

Adding the obtained ptrc99a vector backbone fragment and the DNA fragment of each gene into a test tube; bsaI enzyme was purchased from New England Biolabs (cat# R3733L) and T4DNA ligase was also purchased from New England Biolabs (cat# M0202T) and was used for the cleavage and T4DNA ligase treatment. The reaction system is as follows: the ptrc99a linearization fragment 100ng, the ManCB gene cluster fragment 100ng, the RBS sequence-GmdWcag gene cluster fragment 100ng, the RBS sequence-FucT gene fragment 100ng, the RBS sequence-LacY gene fragment 100ng, the RBS sequence-SetA gene fragment 100ng,10 XTango buffer 2. Mu.L, T4DNA ligase 1. Mu.L, bsaI enzyme 1. Mu.L, and double distilled water was made up to 20. Mu.L. The reaction conditions are as follows: (37℃for 1 minute, 16℃for 1 minute). Times.30 cycles, the reaction was continued at 60℃for another 5 minutes. Coli DH 5. Alpha. Competent cells (Nanjinopran Biotechnology Co., ltd., cat# C502-03) were transformed with the reaction product, and the mixture was incubated overnight at 37℃on LB plates containing 50mg/L ampicillin. The growing clone is verified by PCR whether the full length accords with a theoretical value, and the primer sequence is as follows: verifyfwdSEQ ID No.27: TCAGGCAGCCATCGGAAGC, verifyRevSEQ ID No.28: TGGCAGTTTATGGCGGGC; the correct clone PCR product was about 8.5kbp in length, positive clones were cultured in LB liquid medium at 37℃and recombinant plasmids of the positive clones were extracted using plasmid extraction kit (Nanjinouzan Biotech Co., ltd., cat# DC 201-01) and designated as "ptrc99a-CBGWFYS" plasmids.

TABLE 2 primer list

Example 3

Gene knockout experiments of chassis microorganisms

The beta-galactosidase gene (lacZ) was knocked out using C41 (DE 3) as a chassis microorganism for the synthesis of 2' -FL. The specific method comprises the following steps: "N20 sequence", which can be paired with LacZ gene sequence, was inserted into ptargetF vector by inverse PCR, SEQ ID No.29: TCGCACAGCGTGTACCACAG the resulting recombinant plasmid was designated "ptargetF-N20". An Up homology arm DNA fragment of about 500bp after the start codon "ATG" of the LacZ gene and a Down homology arm DNA fragment of about 500bp before the stop codon "TAA" were obtained by PCR. Purifying the homologous arm DNA fragments respectively, and connecting the Up homologous arm DNA and the Down homologous arm DNA by using the homologous arm DNA fragments as templates through overlay PCR to obtain the Up-Down homologous DNA fragment. Using Nanjinouzan biotechnology Co.LtdII One Step CloningKit the kit (cat# C112-01) was used to join the "Up-Down" homologous DNA fragment to the ptargetF vector to give the recombinant plasmid "ptargetF-Up-Down" (methods refer to kit instructions). Coli DH5 alpha competent cells (Nanjinouzan Biotechnology Co., ltd., cat# C502-03) were transformed with the ligation product, and cultured overnight at 30℃after being plated on LB agar plates (containing 50mg/L spectinomycin).

The pCas plasmid (Addgene, cat# 62225) was transformed into competent cells of E.coli C41 (DE 3) (Beijing Wash Vietnam Biol.C.: 2HU 820) as follows:

(1) LB agar plates (formula 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride, 20g/L agar) containing 25mg/L kanamycin were prepared;

(2) A1.5 ml centrifuge tube was taken, 100. Mu. L C41 (DE 3) competent cell suspension was added and placed on ice; 1. Mu.L of pCas plasmid (10 ng/. Mu.L concentration) was added, gently mixed with a pipette, and left on ice for 20min;

(3) Heat shock is carried out for 90 seconds in a water bath at the temperature of 42 ℃, then ice is quickly placed for 3-5 minutes, and bacterial liquid is not required to be oscillated in the whole process;

(4) Adding 1mL of LB liquid medium (without antibiotics), uniformly mixing, standing and culturing at 37 ℃ for 1 hour to enable bacteria to recover to a normal growth state, and expressing an antibiotic resistance gene coded by a plasmid;

(5) Sucking 100 mu L of bacterial liquid onto an LB agar plate containing 25mg/L kanamycin, and uniformly coating;

(6) After the bacterial liquid is absorbed by the culture medium, culturing for 12-16 hours at 37 ℃ in an inversion way, after single colony appears, picking up C41 (DE 3) -pCas single colony, culturing to be turbid in LB liquid culture medium containing 25mg/L kanamycin at 37 ℃, sucking 500 mu L of bacterial liquid to a sterilized EP tube, adding 500 mu L of 40% (w/w) concentration glycerol, mixing uniformly, and preserving at-80 ℃ for later use.

Culturing the C41 (DE 3) -pCas strain at 30℃to OD ₆₀₀ At 0.2, L-arabinose was added to the flask at a final concentration of 10mM to induce expression of several genes of lambda Red on pCas vector, then to OD ₆₀₀ About 0.4 to about 0.5, the cells are recovered to prepare competence for electrotransformation. In the process of electrotransformation, 100ng of ptargetF-Up-Down plasmid is added into competent cells, the competent cells are gently mixed and then added into a precooled 1mm electrorotating cup, the cells are put into an electrorotating instrument under the condition of 1.8kV for electrorotating, 1mL of LB liquid medium is quickly added after the electrorotating is finished, the cells are cultured for 1h at 30 ℃ and 180rpm for resuscitation, and then the cells are coated on LB double-resistance agar plates of 25mg/L kanamycin and 50mg/L spectinomycin, and are cultured overnight at 30 ℃; the converted clone is identified by PCR, and the PCR product is positive clone with correct size.

Successful clones were identified and plasmid elimination in vivo was required for the next experiment. To eliminate the pCas and ptargetF-Up-Down plasmids, the positive clone of the previous step was inoculated with LB liquid medium (containing 25mg/L kanamycin and induced by the addition of IPTG at a final concentration of 0.5 mM), incubated overnight at 30℃and plated on LB agar plates containing 25mg/L kanamycin for elimination of the "ptargetF-Up-Down" plasmid. When a monoclonal grows on the plate, the selected bacteria are placed in LB liquid medium containing 50mg/L spectinomycin for 30 ℃ overnight, and the non-grown bacterial strain is the bacterial strain with the plasmid ptargetF-Up-Down eliminated. Then, the strain is picked up and placed in LB liquid medium at 37 ℃ overnight, so that pCas plasmid can be easily eliminated by utilizing the temperature-sensitive replicon of the strain. The positive clone strain from which all plasmids were eliminated was stored at-80℃to give a C41 (DE 3) DeltalacZ strain.

Example 4

Construction of Single plasmid expression Strain

Competent cells of the C41 (DE 3) DeltalacZ strain were prepared as follows:

(1) The C41 (DE 3) DeltalacZ strain was cultured overnight at 37℃in LB liquid medium.

(2) Sucking 10 μl of the bacterial liquid into 5mLLB liquid culture medium, and culturing at 37deg.C for 8-12 hr overnight for activation; 1mL of the bacterial liquid is taken and added into 100mLLB liquid culture medium (500 mL triangular shake flask is used), and the bacterial liquid is cultured for 2 to 3 hours to OD at 37 DEG C ₆₀₀ Reaching about 0.5.

(3) 100mL of the bacterial liquid was transferred to several pre-chilled 50mL centrifuge tubes and placed on ice for 30min to allow the bacterial liquid to cool to 0deg.C.

(4) The whole cells were recovered by centrifugation at 4000rpm for 10min at 4 ℃.

(5) Pouring out the culture solution, inverting the centrifuge tube for 1min on the water absorbing paper, and completely draining the trace culture solution remained finally.

(6) All bacterial solutions were pre-chilled with 10mL of 0.1mol/L CaCl ₂ The suspension was gently swirled and collected in a 50mL centrifuge tube, and allowed to stand on an ice bath for 30min.

(7) All cells were recovered by centrifugation at 4000rpm at 4℃for 10 min.

(8) Pouring out the culture solution, inverting the centrifuge tube on the water absorbing paper for 1min, and completely draining the trace culture solution remained finally.

(9) All bacterial sludge is precooled by 4ml of ice and CaCl of 0.1mol/L ₂ (15% glycerol) was resuspended.

(10) The C41 (DE 3) DeltalacZ competent cells were aliquoted into small portions, 100. Mu.L/tube, on ice and frozen at-80 ℃.

The correct single expression plasmid was further transformed into C41 (DE 3) DeltalacZ competent cells as follows:

(1) LB agar plates (formulation 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride, 20g/L agar) containing 50mg/L ampicillin were prepared;

(2) A1.5 ml centrifuge tube was taken, 100. Mu.LC 41 (DE 3) DeltalacZ competent cell suspension was added and placed on ice; adding 1 μl of recombinant plasmid (10 ng/. Mu.L concentration), gently mixing with a pipette, and standing on ice for 20min;

(4) Adding 1mL of LB liquid medium without antibiotics, uniformly mixing, standing and culturing at 37 ℃ for 1 hour to enable bacteria to recover to a normal growth state, and expressing an antibiotic resistance gene coded by a plasmid;

(5) Taking 100 mu L of bacterial liquid onto an LB agar plate containing 100mg/L of ampicillin, and uniformly coating;

(6) After the bacterial liquid is absorbed by the culture medium, culturing for 12-16 hours at 37 ℃ in an inversion way, after single colony appears, picking up C41 (DE 3) delta lacZV1 single colony, culturing to be turbid at 37 ℃ in LB liquid culture medium containing 50mg/L ampicillin, sucking 500 mu L of bacterial liquid to a sterilized EP tube, adding 500 mu L of 40% (w/w) concentration glycerol, mixing uniformly, and preserving at-80 ℃ for later use.

Example 5

Construction of double plasmid control expression Strain

Using the methods in examples 1 and 2, DNA fragments of "ManCB" and "RBS-GmdWcag" were obtained by PCR; the ptrc99a vector was amplified by the same method and loaded with the Overhang linker (four bases) and BsaI cleavage site sequence corresponding to the Golden gate ligation, and directly recovered using a DNA purification kit (Takara Corp., miniBEST Agarose Gel DNA Extraction Kit, cat# 9762), the method being referred to the instructions of the kit. The DNA fragments of the ptrc99a vector, "ManCB", and "RBS-GmdWcag" were ligated to obtain a "ptrc99a-CBGW" plasmid. Referring to the methods in examples 1 and 2, DNA fragments of "Ptrc promoter", "RBS-FucT", "RBS-LacY", "RBS-SetA" were obtained by PCR; the pCDFDuet vector backbone DNA (not containing the T7 promoter portion) was amplified by the same method and loaded with the over hang linker (four bases) and BsaI cleavage site sequences corresponding to the Golden gate ligation, and directly recovered using a DNA purification kit (Takara Corp., miniBEST Agarose Gel DNA Extraction Kit, cat# 9762) by reference to the instructions of the kit. The DNA fragments of the pCDFDuet vector backbone, "Ptrc promoter", "RBS-FucT", "RBS-LacY", "RBS-setA" were ligated to obtain the "pCDFDuet-Ptrc-FYS" plasmid. pCOLADuet-Ptrc-FYS, pACYCDuet-Ptrc-FYS, and pRSFDuet-Ptrc-FYS recombinant vectors can be obtained, respectively, using the same technical methods.

TABLE 3 primer List (exemplified by pCDFDuet-Ptrc-FYS construction)

pCDFDuet_fwd	SEQ ID No.30	ggctacggtctcagactCGAGTCTGGTAAAGAAACC
			pCDFDuet_rev	SEQ ID No.31	ggctacggtctctatttgccagaaccgCCTAATGCAGGAGTCGCATAAG
Ptrc_fwd	SEQ ID No.32	ggctacggtctctAAATATTCTGAAATGAGCTGTTGAC
			Ptrc_rev	SEQ ID No.33	ggctacggtctcttcctGGTCTGTTTCCTGTGTGAAATTG
RBS-FucT_fwd2	SEQ ID No.34	ggctacggtctctAGGAAACAGACCATGGCTTTTAAG
			RBS-FucT_rev2	SEQ ID No.35	ggctacggtctcctttcctTTAAGCGTTATACTTTTGGGATTTC
RBS-LacY_fwd2	SEQ ID No.36	ggctacggtctccGAAACAGACCATGTACTATTTAAAAAAC
			RBS-LacY_rev2	SEQ ID No.37	ggctacggtctcgctgtttcctTTAAGCGACTTCATTCAC
RBS-SetA_fwd2	SEQ ID No.38	ggctacggtctcgACAGACCATGATCTGGATAATG
			RBS-SetA_rev2	SEQ ID No.39	ggctacggtctcaagtcAAACGTCTTTAACCTTTG

With reference to the plasmid transformation method in example 4, the correct expression plasmid was further transformed into C41 (DE 3) ΔlacZ competent cells to obtain V2 strain (comprising Ptrc99a-CBGW and pCDFDuet-Ptrc-FYS plasmid), V3 strain (comprising Ptrc99a-CBGW and pCOLADuet-Ptrc-FYS plasmid), V4 strain (comprising Ptrc99a-CBGW and pACYCDuet-Ptrc-FYS plasmid), and V5 strain (comprising Ptrc99a-CBGW and pRSFDuet-Ptrc-FYS plasmid).

Example 6

Shake flask fermentation experiments of expression strains

Fermenting with baffle triangular flask, shaking 500mL, 100mL of liquid, inoculating C41 (DE 3) DeltalacZ (V1 strain) prepared in example 1 into triangular flask with 1% (V/V) of LB medium containing glucose or glycerol (formula 15g/L glucose or glycerol, 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride, ampicillin 50 mg/L), culturing at 37deg.C and 220rpm to OD ₆₀₀ =0.8, cooled to 25 ℃, added with 0.2mm iptg and 10g/L lactose, and continued to ferment at 25 ℃ at 220rpm for 60 hours; the same method was used to ferment the V2, V3, V4, V5 strains.

Centrifuging the shake flask fermentation broth at 12000rpm for 5min, heating supernatant at 95deg.C for 10min to inactivate soluble proteins, centrifuging at 12000rpm for 5min again, sucking into a syringe, and filtering with 0.22 μm filter head to remove impurities, and subjecting the filtrate to High Performance Liquid Chromatography (HPLC). The specific method for measuring the concentration of 2' -FL in the fermentation broth by HPLC is as follows: liquid phase device: agilent 1260 Infinity II; differential detector detects, model: G7162A-1260 RId; liquid phase column model: sepax HP-Amino,4.6 x 250mm, 5 micron particle size (or equivalent size Amino columns); flow rate: 0.8mL/min, mobile phase: 80% pure acetonitrile: 20% water (v/v), system temperature: the temperature is 35 ℃, and the sample injection amount is 10-20 microlitres. 2' -FL standard for concentration calculation was purchased from Shanghai Hui Cheng Biotechnology Co., ltd, purity 98% (cat# GY 1141); the same method was used to examine the 2' -FL production of the V2, V3, V4, V5 strains.

TABLE 4 results of production of 2' -FL in shake flasks

Strain	Type of plasmid carried	OD ₆₀₀	2' -FL yield
				V1	ptrc99a-CBGWFYS	13.13	7.85
V2	ptrc99a-CBGW，pCDFDuet-Ptrc-FYS	9.58	5.25
				V3	ptrc99a-CBGW，pCOLADuet-Ptrc-FYS	9.23	5.17
V4	ptrc99a-CBGW，pACYCDuet-Ptrc-FYS	10.28	3.76
				V5	ptrc99a-CBGW，pRSFDuet-Ptrc-FYS	2.05	0.28

From the above results, it was found that the transcription of the ManCB gene cluster, the GmdWcag gene cluster, the FucT gene, the LacY gene and the SetA gene was controlled by the Trc promoter, in this case, the recombinant E.coli strain carrying ptrc99a-CBGWFYS was shake-flask fermented to synthesize 2' -FL, and a yield of 7.85g/L and a strain OD could be obtained ₆₀₀ A value of 13.13; v1 Strain irrespective of OD ₆₀₀ The value and the yield of 2' -FL are better than those of the strains V2, V3, V4 and V5, and the performance superiority of the single plasmid expression strain is proved.

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. An escherichia coli recombinant strain for synthesizing 2' -fucosyllactose by utilizing simple substance particles is characterized in that the escherichia coli recombinant strain carries recombinant plasmid ptrc99a-CBGWFYS;

the initial strain of the escherichia coli recombinant strain is escherichia coli from which lacZ genes are knocked out.

2. The construction method of the escherichia coli recombinant strain for synthesizing the 2' -fucosyllactose by using the simple substance particles is characterized by comprising the following steps:

4) Converting the recombinant plasmid ptrc99a-CBGWFYS obtained in the step 3) into escherichia coli to obtain an escherichia coli recombinant strain; the escherichia coli is a C41 (DE 3) strain from which lacZ genes are knocked out.

3. The construction method according to claim 2, wherein the step 1) is characterized in that the nucleotide sequence of the upstream primer of the primer pair used for amplifying the backbone DNA of the ptrc99a vector is shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2;

4. The construction method according to claim 2, wherein the nucleotide sequence of the upstream primer of the primer pair used in the amplification of the RBS-ManCB gene cluster fragment in step 2) is shown in SEQ ID No.13, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 14;

5. The method according to claim 2, wherein the step 3) comprises amplifying the linearized fragment of the ptrc99a vector, the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID No.23, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 24.

6. The method of construction according to claim 2, wherein the system of step 3) connection comprises: a linearized fragment of the ptrC99a vector of 100ng, an RBS-ManCB gene cluster fragment of 100ng, an RBS-GmdWcag gene cluster fragment of 100ng, an RBS-FucT gene fragment of 100ng, an RBS-LacY gene fragment of 100ng, an RBS-SetA gene fragment of 100ng,10 XTango buffer 2. Mu. L, T4DNA ligase of 1. Mu.L and BsaI enzyme of 1. Mu.L were made up to 20. Mu.L.

7. The construction method according to claim 2 or 6, wherein the conditions of the connection include: 37 ℃ for 1min; 1min at 16 ℃ for 30 cycles; and at 60℃for 5min.

8. The method according to claim 2, wherein the E.coli in the step 4) is E.coli C41 (DE 3).

9. The method according to claim 2, wherein the volume ratio of the recombinant plasmid ptrc99a-CBGWFYS to escherichia coli in the step 4) is 1:100;

10. The method of construction according to claim 2, wherein the conditions of transformation comprise: mixing the recombinant plasmid ptrc99a-CBGWFYS and escherichia coli on ice, standing for 20min, and then heating for 90s in a water bath at 42 ℃, and then rapidly placing on ice for 3-5 min.