CN117757992A - LAMP detection primer group of salmon herpesvirus I and application thereof in preparation of kit - Google Patents
LAMP detection primer group of salmon herpesvirus I and application thereof in preparation of kit Download PDFInfo
- Publication number
- CN117757992A CN117757992A CN202311830480.XA CN202311830480A CN117757992A CN 117757992 A CN117757992 A CN 117757992A CN 202311830480 A CN202311830480 A CN 202311830480A CN 117757992 A CN117757992 A CN 117757992A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- salmon
- herpesvirus
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000972773 Aulopiformes Species 0.000 title claims abstract description 40
- 235000019515 salmon Nutrition 0.000 title claims abstract description 40
- 241001529453 unidentified herpesvirus Species 0.000 title claims abstract description 40
- 238000001514 detection method Methods 0.000 title claims abstract description 35
- 238000002360 preparation method Methods 0.000 title abstract description 5
- 238000006243 chemical reaction Methods 0.000 claims description 17
- 239000013642 negative control Substances 0.000 claims description 14
- 239000002773 nucleotide Substances 0.000 claims description 12
- 125000003729 nucleotide group Chemical group 0.000 claims description 12
- 239000013641 positive control Substances 0.000 claims description 11
- 108090000623 proteins and genes Proteins 0.000 claims description 11
- 108020004707 nucleic acids Proteins 0.000 claims description 9
- 150000007523 nucleic acids Chemical class 0.000 claims description 9
- 102000039446 nucleic acids Human genes 0.000 claims description 9
- 239000013612 plasmid Substances 0.000 claims description 9
- 229910021642 ultra pure water Inorganic materials 0.000 claims description 9
- 239000012498 ultrapure water Substances 0.000 claims description 9
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 8
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 8
- KWIUHFFTVRNATP-UHFFFAOYSA-N Betaine Natural products C[N+](C)(C)CC([O-])=O KWIUHFFTVRNATP-UHFFFAOYSA-N 0.000 claims description 7
- 108010043121 Green Fluorescent Proteins Proteins 0.000 claims description 7
- KWIUHFFTVRNATP-UHFFFAOYSA-O N,N,N-trimethylglycinium Chemical compound C[N+](C)(C)CC(O)=O KWIUHFFTVRNATP-UHFFFAOYSA-O 0.000 claims description 7
- 239000000980 acid dye Substances 0.000 claims description 7
- 229960003237 betaine Drugs 0.000 claims description 7
- 239000011535 reaction buffer Substances 0.000 claims description 7
- 238000007789 sealing Methods 0.000 claims description 4
- 239000007788 liquid Substances 0.000 claims description 3
- 239000002480 mineral oil Substances 0.000 claims description 2
- 235000010446 mineral oil Nutrition 0.000 claims description 2
- 239000012530 fluid Substances 0.000 claims 1
- 238000005516 engineering process Methods 0.000 abstract description 9
- 230000035945 sensitivity Effects 0.000 abstract description 5
- 238000003745 diagnosis Methods 0.000 abstract description 2
- 238000000034 method Methods 0.000 abstract description 2
- 244000005700 microbiome Species 0.000 abstract description 2
- 230000002265 prevention Effects 0.000 abstract 1
- 238000002474 experimental method Methods 0.000 description 5
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- 241000277275 Oncorhynchus mykiss Species 0.000 description 3
- 230000003321 amplification Effects 0.000 description 3
- 238000007397 LAMP assay Methods 0.000 description 2
- 241000700605 Viruses Species 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 1
- 241000282858 Hyracoidea Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 206010030113 Oedema Diseases 0.000 description 1
- 210000000577 adipose tissue Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 238000006073 displacement reaction Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000011901 isothermal amplification Methods 0.000 description 1
- 210000003734 kidney Anatomy 0.000 description 1
- 210000005228 liver tissue Anatomy 0.000 description 1
- 210000001161 mammalian embryo Anatomy 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 210000004923 pancreatic tissue Anatomy 0.000 description 1
- 210000005084 renal tissue Anatomy 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 210000001835 viscera Anatomy 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a salmon herpesvirus I-type LAMP detection primer group and application thereof in preparation of a kit, and belongs to the technical field of microorganism detection. The invention designs a salmon herpesvirus I type LAMP detection primer group based on the LAMP technology, which comprises an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB, and discloses a salmon herpesvirus I type LAMP kit. The advantages of the invention include: the on-site rapid detection can be realized by matching with common instrument and equipment, the detection time is less, the accuracy is high, the operation is simple, and the sensitivity can reach 10 3 cobies/. Mu.L; diagnosis and prevention of salmon herpesvirus type IThe method is suitable for use and popularization of the base layer.
Description
Technical Field
The invention relates to the technical field of microorganism detection, in particular to a technology for detecting salmon herpesvirus I.
Background
Salmon herpesvirus type I (SalHV-1) was first isolated in the Washington rainbow trout hatchery in the 70 s of the 20 th century and was again isolated in the rainbow trout region of California in 1985. SalHV-1 is a major hazard to young rainbow trout, and is also a typical representative of the genus salmon herpesvirus; salHV-1 infection usually causes edema in internal organs, congestion in liver and adipose tissue, histopathological observations see that kidney and pancreatic tissue syncytia are produced, and kidney is the main target organ for infection by this virus. At present, the detection method of salmon herpesvirus type I has been studied little.
The loop-mediated isothermal amplification (LAMP-mediated isothermal amplification) technology is a novel isothermal nucleic acid amplification method, is improved in the technology of the traditional PCR technology, designs 4 or 6 different specific primers aiming at 6 or 8 sites of a target gene, and realizes the rapid amplification of DNA under the constant temperature condition under the action of a strand displacement active DN A polymerase (Bst DNA polymerase). The method has been widely used in the fields of clinical disease diagnosis, qualitative and quantitative detection of epidemic bacteria or viruses, sex identification of animal embryo, gene chip development and the like.
If the LAMP technology can be used for developing the salmon herpesvirus I type detection technology with good specificity and high sensitivity, the LAMP technology has great market prospect.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a salmon herpesvirus I-type LAMP detection primer group and application thereof in preparation of a kit.
A first object of the present invention is to provide a set of primers for detecting salmon herpesvirus type I.
A second object of the present invention is to provide a detection kit for detecting salmon herpesvirus type I.
In order to achieve the above object, the present invention is realized by the following means:
the LAMP detection primer group for salmon herpesvirus I comprises an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB;
the nucleotide sequence of the outer primer F3 is shown as SEQ ID NO.1,
the nucleotide sequence of the outer primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the inner primer FIP is shown as SEQ ID NO.3,
the nucleotide sequence of the inner primer BIP is shown as SEQ ID NO. 4;
the nucleotide sequence of the loop primer LF is shown as SEQ ID NO.5,
the nucleotide sequence of the loop primer LB is shown as SEQ ID NO. 6.
The invention also provides application of the primer group in preparation of a detection kit.
Further, the kit further comprises: the primer set of claim 1, a thermo pol reaction buffer, mgSO 4 Betaine, dNTPs, bst DNA polymerase, SYTO-9 green fluorescent nucleic acid dye, positive control, negative control and sealing liquid.
Further, the positive control is plasmid DNA containing salmon herpesvirus I type detection target gene, the target gene sequence is shown as SEQ ID NO.31, the negative control is sterilized ultrapure water, and the sealing liquid is mineral oil.
The invention also provides a reaction system containing the primer group, which comprises the following components: the final concentrations of the primers F3, B3, FIP, BIP, LF and LB are respectively 0.15-0.35 mu M, 1.8-2.2 mu M, 1.2-1.5 mu M and 1.2-1.5 mu M, mgSO 4 The final concentration is 6-8 mmol/L, the betaine is 0.9-1.3 mol/L, dNTPs and the final concentration is 1-1.5 mmol/L, bst DNA polymerase is 6-8U, SYTO-9 green fluorescent nucleic acid dye is 0.3-0.7 mu L, thermopol reaction buffer is 2.5 mu L, the sample to be detected is 2-3 mu L, and sterilized ultrapure water is added to 25 mu L.
More preferably, the reaction system comprises the following components: the final concentrations of primers F3, B3, FIP, BIP, LF and LB were 0.25. Mu.M, 0.2, respectively5. Mu.M, 2. Mu.M, 1.25. Mu.M and 1.25. Mu.M MgSO 4 The final concentration is 7mmol/L, the final concentration of betaine is 1mol/L, dNTPs, the final concentration is 1.2mmol/L, bst DNA polymerase 6U, SYTO-9 green fluorescent nucleic acid dye is 0.5 mu L, thermoPol reaction buffer is 2.5 mu L, the sample to be detected is 2 mu L, and sterilized ultrapure water is added to 25 mu L.
Compared with the prior art, the invention has the following beneficial effects:
(1) The detection cost is low: the detection method consumes shorter time than the common PCR, and the detection cost is lower than that of the common PCR detection technology;
(2) The sensitivity is high: for positive plasmid containing salmon herpesvirus I type detection target gene, minimum detection limit can be up to 10 3 copies/μL；
(3) The operation is convenient: expensive and precise equipment is not needed, the requirement on instruments is low, the reaction and detection can be carried out by only one constant temperature instrument, and the conditions are simpler.
Drawings
FIG. 1 is a diagram showing the experimental results of primer set 1 for salmon herpesvirus I;
FIG. 2 is a graph showing the experimental results of primer set 2 for salmon herpesvirus I;
FIG. 3 is a graph showing the experimental results of primer set 3 for salmon herpesvirus I;
FIG. 4 is a graph showing the experimental results of primer set 4 for salmon herpesvirus I;
FIG. 5 is a graph showing the experimental results of primer set 5 for salmon herpesvirus I;
curve 1 in fig. 1-5 is a positive control and curve 2 is a negative control;
FIG. 6 shows the results of a negative control repeatability test of salmon herpesvirus type I, in which FIG. 1 is 10 6 cobies/. Mu.L positive control, 2 negative control;
FIG. 7 is a graph showing the results of a reaction system sensitivity test of primer set 1 of the present invention containing salmon herpesvirus type I, wherein 1 is 10 8 COPIES/. Mu.L, 2 is 10 7 COPIES/. Mu.L, 3 is 10 6 COPIES/. Mu.L, 4 is 10 5 COPIES/. Mu.L, 5 is 10 4 COPIES/. Mu.L, 6 is 10 3 COPIES/. Mu.L, 7 is 10 2 COPIES/. Mu.L, 8 is 10 1 COPIES/. Mu.L, 9 is 10 0 copies/. Mu.L, 10 as negative control;
FIG. 8 is a graph showing the results of a nucleic acid detection experiment of KHV, cyHV-II, cyHV-I, eeCV, GIV, angHV by the primer set 1 containing salmon herpesvirus I of the present invention, wherein 1 is a positive control of salmon herpesvirus I, 2 is KHV,3 is CyHV-II,4 is CyHV-I, 5 is EeCV,6 is GIV,7 is AngHV, and 8 is a negative control.
Detailed Description
The invention will be further described in detail with reference to the drawings and specific examples, which are given solely for the purpose of illustration and are not intended to limit the scope of the invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are those commercially available.
Example 1 Effect of different primer sets on detection of salmon herpesvirus type I LAMP results
1. Designing primers
The specific segment gene of salmon herpesvirus I type DNA is used as target gene, its sequence is shown in SEQ ID NO.31, 5 groups of LAMP candidate primer groups are designed and synthesized by the division of biological engineering (Shanghai).
Primer set 1 for salmon herpesvirus type i:
outer primer F3: ATCTCTGCATGGGGGGTAT (SEQ ID NO. 1);
outer primer B3: TCGGAACATGCACATGTCA (SEQ ID NO. 2);
inner primer FIP:
CTGTAGTCCGGCTGCCGAAAC-GAGCAGAGACTACTTTGGCG(SEQ ID NO.3)；
inner primer BIP:
GCCCCCATCAACTCCACATCAA-ACCAAAACGTGAGCGAGAA(SEQ ID NO.4)；
loop primer LF: CATTCTCTCGGGTGGTTCCT (SEQ ID NO. 5);
loop primer LB: CCACTGTGCCATATGTCTGAC (SEQ ID NO. 6).
Primer set 2 for salmon herpesvirus type i:
outer primer F3: ACTGCTGAGAACGTGTCAC (SEQ ID NO. 7);
outer primer B3: CTTGGGGATCACACAGAGTG (SEQ ID NO. 8);
inner primer FIP:
CACCATAGCTGTGATGGGGCA-AAAGACAGGGCTCTTTCACC(SEQ ID NO.9)；
inner primer BIP: AGCTGCTGCCCTCATTGGAG-TCCGGTTGGTGTACTGGC (SEQ ID NO. 10);
loop primer LF: TCCCGATGGACACTTTGAGA (SEQ ID NO: 11);
loop primer LB: GACCAGCTGGTGTTTGAAAACC (SEQ ID NO: 12).
Primer set 3 for salmon herpesvirus type i:
outer primer F3: TACCCCCGGGAACAATCG (SEQ ID NO. 13);
outer primer B3: CCCGCGAATGTGAAGCATT (SEQ ID NO. 14);
inner primer FIP:
GGCAATTGGAGAGCCACTGGAT-GAGGAGTCTCTCCAGGAACC(SEQ ID NO.15)；
inner primer BIP:
ACAAGGGGGAGGAAATTCGTGC-AGGGCATCTTCCAGGTGAG(SEQ ID NO.16)；
loop primer LF: TGGGGGGACATTCTCTCGG (SEQ ID NO. 17);
loop primer LB: CCACTGTGCCATATGTCTGAC (SEQ ID NO. 18).
Primer set 4 for salmon herpesvirus type i:
outer primer F3: ACATGTTGGACGGTGTCAAT (SEQ ID NO. 19);
outer primer B3: CCCGCGAATGTGAAGCATT (SEQ ID NO. 20);
inner primer FIP:
ACTGGATCAATTCCTGGGGGGA-TACCCCCGGGAACAATCG(SEQ ID NO.21)；
inner primer BIP:
ACAAGGGGGAGGAAATTCGTGC-AGGGCATCTTCCAGGTGAG(SEQ ID NO.22)；
loop primer LF: CATTCTCTCGGGTGGTTCCT (SEQ ID NO. 23);
loop primer LB: CCACTGTGCCATATGTCTGAC (SEQ ID NO. 24).
Primer set 5 for salmon herpesvirus type i:
outer primer F3: CCGCGGGAAATGTACAATGA (SEQ ID NO. 25);
outer primer B3: AGTTGTCATCGTTGCTACGT (SEQ ID NO. 26);
inner primer FIP:
TTGGTGTACTGGCCCAGGTTTTGAAAAAGCTGCTGCCCTCA(SEQ ID NO.27)；
inner primer BIP: GTGGCGGGCGATCTTGCAATGATGAGATCCTGTCCACTGC (SEQ ID NO. 28);
loop primer LF: CACCAGCTGGTCCTCCAA (SEQ ID NO. 29);
loop primer LB: CAACCCGCACATTATTCTACGA (SEQ ID NO. 30).
Salmon herpesvirus type I target gene sequence (SEQ ID NO. 31):
AGAGAAATGAGTTTTGTCCACCTTTCAGACTACCGCACTTTCTTTGTGGCGTGCGGCCTTCTACCTTGGTCCCACATGATCAAACATGCCAAAGTTCCCACGTTCAAAAAAGAGTTCCTGGGGAACAGGGAAAAATATGGAATGGTCCTCAACGGTGCGGCCACAAAACTACCGTATGTCAAAATGGTCCACACGCACACGGCTCTCTATGAAATCACACAGAGAACAAAGAAAGACCTCAAATTCCCACCGGACTACATCAAGCAAGATCCGTCGATGGCATTCTTCCGAAAGTACCCCCTGGATCTCTGCATGGGGGGTATGAGCAGAGACTACTTTGGCGAGTTTCTCATCTGCAAAGACAAGTCGTTTCGGCAGCCGGACTACAGCCGGTGGAATAGGCAAAAGAACAGCCCCCATCAACTCCACATCAAAGCCTTCATCGACTCAAACTACCTCAACCCCAATGCAAAATTTCTCGCTCACGTTTTGGTTGACATGTGCATGTTCCGAAACAGCTTTCTGGAAATGAAAAACCCGGGTGATTACATCAAAAACCTAGTTGCCAAGGCTGAGAAGGACATCATCTCGGCCATGGATCGCCATGGGAGAATTGCTGACATTGGCACCGCCATCTTCCGATCATTCTTCAACAACACACCTCCTGAATTGGAACTGCTGAGAACGTGTCACAAATACACCCCCCAGAAAGACAGGGCTCTTTCACCTCTCAAAGTGTCCATCGGGATGCCCCATCACAGCTATGGTGACCCGCGGGAAATGTACAATGAGGCCATTGATAAGATGAAAAAGCTGCTGCCCTCATTGGAGGACCAGCTGGTGTTTGAAAACCTGGGCCAGTACACCAACCGGACACTCTGTGTGATCCCCAAGAGCGTGGCGGGCGATCTTGCAATCAACCCGCACATTATTCTACGAGGAGACAACAGCAGTGGACAGGATCTCATCCAATTTGGTCAACTTCTCTACGTAGCAACGATGACAACTCACATGTTGGACGGTGTCAATTTTCAGACTTACCCCCGGGAACAATCGGAGGAGTCTCTCCAGGAACCACCCGAGAGAATGTCCCCCCAGGAATTGATCCAGTGGCTCTCCAATTGCCGCCATTATATCAACAAGGGGGAGGAAATTCGTGCCCACTGTGCCATATGTCTGACCTTTTGGGAAACTCACCTGGAAGATGCCCTGGAGTTTACAGAGAAATGCTTCACATTCGCGGGTGGTGTGTTTACTCGAAAAAACCCCCCCATATGTAATATCTAAATTGGCCCAAAGTGCTCATTCGAAATAGTATAAGGGGTGGAAAATCTCAACGGTAACAGCACACATTTTTGAAACACATTCAAGTCTCTATCAATATTAATAGGAAAATGGGCT
2. loop-mediated isothermal amplification detection reaction
The reaction system is constructed by using the 5 groups of primer groups respectively for detection reaction. The positive control was plasmid DNA containing the target gene, and the negative control was sterilized ultrapure water.
The reaction system is as follows: the final concentrations of primers F3, B3, FIP, BIP, LF and LB were 0.25. Mu.M, 2. Mu.M, 1.25. Mu.M and 1.25. Mu.M, mgSO, respectively 4 The final concentration is 7mmol/L, the final concentration of betaine is 1mol/L, dNTPs, the final concentration is 1.2mmol/L, bst DNA polymerase 6U, SYTO-9 green fluorescent nucleic acid dye is 0.5 mu L, thermoPol reaction buffer is 2.5 mu L, the sample to be detected is 2 mu L, and sterilized ultrapure water is added to 25 mu L.
The reaction conditions are as follows: the reaction was carried out at 63℃for 45min.
3. Primer screening results
As shown in figures 1-5, the primer group 3, the primer group 4 and the primer group 5 of the salmon herpesvirus I have negative tail-tilting phenomenon, the yin and yang results of the primer group 2 are normal, but the peak time is too late, the yin and yang results of the primer group 1 are normal and the peak time is early, so that the performance of the primer group 1 is superior to that of other primer groups, and the primer group 1 of the salmon herpesvirus I should be selected as the primer group for detecting the salmon herpesvirus I in the subsequent experiment.
Example 2 repeatability experiments
Negative controls were set 20 times in parallel and positive controls were set 3 times in parallel. The reaction system of example 1 was used for the detection.
As shown in fig. 6, curve 1 is a positive control, curve 2 is a negative control, and the result shows that: the negative control was repeated 20 times without amplification, which proves that the repeatability of the invention is good.
Example 3 sensitivity experiment
Positive control plasmid DNA was subjected to 10-fold gradient dilution at 10 8 copies/μL、10 7 copie s/μL、10 6 copies/μL、10 5 copies/μL、10 4 copies/μL、10 3 copies/μL、10 2 copies/μL、10 1 copies/μL、10 0 Nine gradient concentrations of plasmid DNA and negative control (sterilized ultrapure water) were used as templates for detection using the reaction system of example 1.
As shown in fig. 7, the results indicate that: after 10-fold gradient dilution of positive plasmid DNA, the concentration of the positive plasmid DNA can be detected to be 10 3 Cories/. Mu.L of positive plasmid DNA.
Example 4 specificity experiments
Referring to the reaction system in example 1, the detection of KHV, cyHV-II, cyHV-I, eeCV, GIV, angHV nucleic acids was performed, respectively, as shown in FIG. 8, and the results showed that amplification curves were generated only for the salmon herpesvirus type I detection, and that the other samples were not amplified, indicating that the kit detection specificity was good.
It should be noted that the above embodiments are merely for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and that other various changes and modifications can be made by one skilled in the art based on the above description and the idea, and it is not necessary or exhaustive to all embodiments. Any modification, equivalent replacement, improvement, etc. which come within the spirit and principles of the invention are desired to be protected by the following claims.
Claims (6)
1. The LAMP detection primer group for salmon herpesvirus I is characterized by comprising an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB;
the nucleotide sequence of the outer primer F3 is shown as SEQ ID NO.1,
the nucleotide sequence of the outer primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the inner primer FIP is shown as SEQ ID NO.3,
the nucleotide sequence of the inner primer BIP is shown as SEQ ID NO. 4;
the nucleotide sequence of the loop primer LF is shown as SEQ ID NO.5,
the nucleotide sequence of the loop primer LB is shown as SEQ ID NO. 6.
2. Use of the primer set according to claim 1 for preparing a detection kit.
3. The use according to claim 2, wherein the kit further comprises: the primer set of claim 1, a thermo pol reaction buffer, mgSO 4 Betaine, dNTPs, bst DNA polymerase, SYTO-9 green fluorescent nucleic acid dye, positive control, negative control and sealing liquid.
4. The use according to claim 3, wherein the positive control is plasmid DNA containing a salmon herpesvirus type i detection target gene, the target gene sequence of which is shown in SEQ ID No.31, the negative control is sterilized ultrapure water, and the sealing fluid is mineral oil.
5. A reaction system containing the primer set according to claim 1, wherein the reaction system comprises the following components: the final concentrations of the primers F3, B3, FIP, BIP, LF and LB are respectively 0.15-0.35 mu M, 1.8-2.2 mu M, 1.2-1.5 mu M and 1.2-1.5 mu M, mgSO 4 The final concentration is 6-8 mmol/L, the final concentration of betaine is 0.9-1.3 mol/L, dNTPs and is 1-1.5 mmol/L, bst DNA polymerase is 6-8U, SYTO-9 green fluorescent nucleic acid dye is 0.3-0.7 mu L, thermoPol reaction buffer is 2.5 mu L, sample to be detected is 2-3 mu L, and sterilized ultrapure water is added to 25 mu L.
6. The reaction system of claim 5, wherein the reaction system comprises the following components: the final concentrations of primers F3, B3, FIP, BIP, LF and LB were 0.25. Mu.M, 2. Mu.M, 1.25. Mu.M and 1.25. Mu.M, mgSO, respectively 4 The final concentration is 7mmol/L, the final concentration of betaine is 1mol/L, dNTPs, the final concentration is 1.2mmol/L, bst DNA polymerase 6U, SYTO-9 green fluorescent nucleic acid dye is 0.5 mu L, thermoPol reaction buffer is 2.5 mu L, the sample to be detected is 2 mu L, and sterilized ultrapure water is added to 25 mu L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311830480.XA CN117757992A (en) | 2023-12-28 | 2023-12-28 | LAMP detection primer group of salmon herpesvirus I and application thereof in preparation of kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311830480.XA CN117757992A (en) | 2023-12-28 | 2023-12-28 | LAMP detection primer group of salmon herpesvirus I and application thereof in preparation of kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117757992A true CN117757992A (en) | 2024-03-26 |
Family
ID=90320041
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311830480.XA Pending CN117757992A (en) | 2023-12-28 | 2023-12-28 | LAMP detection primer group of salmon herpesvirus I and application thereof in preparation of kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117757992A (en) |
-
2023
- 2023-12-28 CN CN202311830480.XA patent/CN117757992A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551853B (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN103397107B (en) | Bovine viral diarrhea virus (BVDV) fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection kit | |
| CN103484571B (en) | LAMP (loop-mediated isothermal amplification) detection primer group, detection kit and detection method for infectious hypodermal and hematopoietic necrosis virus | |
| CN110791592A (en) | Primer and kit for rapidly detecting African swine fever virus | |
| CN111471797B (en) | RT-RPA primer pair, probe, kit and detection method for detecting cat coronavirus | |
| CN101942511A (en) | Method for detecting mycobacterium tuberculosis by in-situ fluorescent loop-mediated isothermal nucleic acid amplification technology and kit | |
| CN115044710A (en) | Primer group, kit and application for detecting pangolin beta coronavirus | |
| CN107236826A (en) | A kind of LAMP primer group, kit and detection method for detecting lily asymptomatic virus | |
| CN117757992A (en) | LAMP detection primer group of salmon herpesvirus I and application thereof in preparation of kit | |
| CN113249503B (en) | LAMP primer group and method for detecting haemolytic mannheimia | |
| CN114672596A (en) | Amplification primer pair for detecting African swine fever virus, detection kit and application | |
| CN112852975A (en) | Primer probe set, kit and detection method for detecting schistosoma japonicum nucleic acid based on fluorescence RMA method | |
| CN113774162A (en) | Novel coronavirus isothermal amplification primer, detection method and application | |
| CN112063759A (en) | RT-LAMP primer, kit and detection method for simultaneously detecting multiple viruses of banana | |
| CN113234862A (en) | African swine fever virus LAMP detection primer group and kit | |
| CN108148917B (en) | LAMP-LFD primer and probe for detecting highly pathogenic vibrio parahaemolyticus and application thereof | |
| CN104450965A (en) | LAMP primer and kit for detecting goose parvovirus and applications of LAPMP primer and kit | |
| CN111593138A (en) | Duck hepatitis B virus recombinant polymerase isothermal amplification detection method | |
| CN111270010B (en) | Loop-mediated isothermal amplification detection primer group for detecting SARS-CoV-2 and application thereof | |
| CN113322353B (en) | RPA kit for detecting sweet potato pinnate mottle virus and sweet potato chlorotic stunt virus | |
| CN112575122B (en) | Dual PCR primer set for rapidly detecting duck type 2 adenovirus and duck circovirus, and detection method and application thereof | |
| JP2019129798A (en) | Quick and efficient isothermal amplification reaction using heating sample | |
| CN117106980A (en) | Primer group, kit and method for detecting Infectious Spleen and Kidney Necrosis Virus (ISKNV) | |
| CN116411131A (en) | Primer combination for LAMP detection of H1N1 influenza A virus | |
| CN106906308B (en) | LAMP-LFD rapid kit and detection method for bombyx mori BmBDV |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |