CN117757977A

CN117757977A - KASP molecular marker TMSK23 related to eggplant reverse thermosensitive core male sterility and application thereof

Info

Publication number: CN117757977A
Application number: CN202311749955.2A
Authority: CN
Inventors: 李冰; 武彦荣; 高秀瑞; 张敬敬; 田鹏; 潘秀清
Original assignee: INSTITUTE OF CASH CROPS HEBEI ACADEMY OF AGRICULTURE AND FORESTRY SCIENCES
Current assignee: INSTITUTE OF CASH CROPS HEBEI ACADEMY OF AGRICULTURE AND FORESTRY SCIENCES
Priority date: 2023-12-19
Filing date: 2023-12-19
Publication date: 2024-03-26

Abstract

The invention relates to the technical field of molecular genetics, in particular to a KASP molecular marker TMSK23 related to eggplant reverse thermo-sensitive male sterility and application thereof. The molecular marker locus is obtained by hybridization of a reverse thermosensitive male sterile line of eggplant, which is 05ms, as a female parent and a high-generation inbred line of eggplant, which is S132, as a male parent, to obtain F ₂ Isolating the population. According to published high-quality genome information of eggplants, using a whole genome resequencing technology, performing a sequencing on eggplants F ₂ In the generation, the homozygous dominant fertile plants and the homozygous recessive sterile plants are subjected to pool building and sequencing, SNP (single nucleotide polymorphism) difference sites of the fertility gene and the sterile gene pool are screened, and the obtained difference sites are verified through KASP genotyping and protein three-dimensional structure prediction. The invention solves the problems of large working amount and the like in the hybridization seed production in the prior art, and has the following advantagesThe method has the advantages of avoiding the problem of mass measurement in the process of transformation, improving the breeding efficiency and the like.

Description

KASP molecular marker TMSK23 related to eggplant reverse thermosensitive core male sterility and application thereof

Technical Field

The invention relates to the technical field of molecular genetics, in particular to a KASP molecular marker TMSK23 related to eggplant reverse thermo-sensitive male sterility and application thereof.

Background

Eggplant (Solanum melongena l.) belonging to the family Solanaceae belongs to annual crops, is one of important vegetable crops in the world, and china is the largest production country. The eggplant has remarkable heterosis and high utilization value, not only improves the yield and quality of fruits, but also enhances the disease resistance and stress resistance of plants. At present, most of the eggplant varieties promoted in China are hybrid generation, but the production of eggplant hybrid seeds is still mainly performed by artificial emasculation pollination hybridization. The first generation hybrid seed is produced by using the male sterile line of the eggplant, the links of manual emasculation and the like can be saved, the time and labor are saved, the cost and difficulty of seed production are greatly reduced, the seed purity is obviously improved, and the method is an important way for using the hybrid seeds. Therefore, male sterility research has been highly appreciated by many scholars both at home and abroad.

Heterosis is the general phenomenon in crops, i.e. the manifestation of the hybrid generation over the parent in terms of vigor, viability, stress resistance, yield and quality. The utilization of the male sterile line reduces the production cost of manual emasculation, simplifies the seed production difficulty, increases the seed production quantity and seed production speed, and accelerates the popularization of hybrid seeds. Male sterility is largely divided into two types, cytoplasmic male sterility (Cytoplasmic male sterility, CMS for short) and nuclear male sterility (Genetic male sterility, GMS for short). The development of CMS-based "three-line" hybrid rice systems (first generation) and "two-line" hybrid rice systems based on photosensitive and thermo-sensitive male sterile lines (photo-and thermo-sensitive genic male sterility, PGMS and TGMS for short) have made an important contribution to Chinese rice yield and grain safety. Compared with the three-line hybrid, the two-line hybrid is easier to operate and has higher utilization efficiency of germplasm resources. Two-line hybrid systems are an important innovation and are increasingly popular in large-scale hybrid seed production in China. High temperature sterility, low temperature fertility material is generally referred to as temperature sensitive sterility; whereas low temperature sterility and high temperature sterility are referred to as reverse thermosensitive sterility.

The CMS seed production needs three lines of matching, and although the CMS seed production is applied to eggplant varieties, the CMS seed production still has great difficulty in the utilization of the CMS seed production, and the key point is that an excellent restorer line is difficult to find in the eggplant; the GMS line has simple heredity and wide restorer line, but the maintenance of sterility of the GMS line only depends on pollen of heterozygous materials, half of single plants in offspring groups are still fertile heterozygous single plants, and the fertile single plants must be pulled out in the process of hybrid seed production, so that the seed production efficiency is seriously affected. In 2005, the applicant finds out the male sterile mutant strain of eggplant in the long eggplant inbred line S63, and the male sterile line of temperature-sensitive is bred by multi-generation directional selection for 05ms, and the male sterile line is different from the material through researches, is sterile at low temperature and is fertile at high temperature, is controlled by a pair of recessive nuclear genes, belongs to the type of reverse temperature-sensitive nuclear sterility (rTGMS), and the material obtained lays a germplasm foundation for the research of the hybridization breeding of eggplant two lines. The sterile line is a more excellent cross breeding material, and fertility can be recovered by changing temperature conditions, and the sterile line is a maintainer line, so that the seed production process is simpler. The stable sterile line is bred by adopting the traditional nuclear male sterile material for 7-10 years, and the molecular marker assisted selective breeding can effectively shorten the breeding period and improve the breeding efficiency. To date, few markers of male sterility molecules of eggplants are reported, wherein 1 marker of cytoplasmic sterility type restorer gene DNA is not reported.

The patent document with publication number CN116287359A discloses a molecular marker and a primer for detecting cytoplasmic male sterility restoring gene of eggplant Saet source, which are obtained by using hybrid F of cytoplasmic male sterility restoring line 3-26 of eggplant Saet source and maintainer line EP26 ₁ Based on the population, the restoring gene is positioned on the chromosome of Ch06, and a SNP molecular marker SmRf186 closely linked with the restoring gene is designed through sequence analysis. And the molecular marker technology is utilized to rapidly detect the Saet-source cytoplasmic male sterility restoring gene of the eggplant in the seedling stage, so that the breeding efficiency is improved. The SNP marker SmRf186 is positioned in the genome of eggplantThe base at position 1860648 of chromosome 6 is C or G. The base at the SNP marker is G which is an eggplant Saet-source cytoplasmic male sterile restorer line, and the base at the SNP marker is C which is an eggplant Saet-source cytoplasmic male sterile maintainer line. The molecular marker in the patent document is aimed at the restoring gene of cytoplasmic male sterility of eggplant, and the molecular marker related to the temperature-sensitive nuclear male sterility of eggplant is mentioned in the patent, and the detection types are completely different.

The invention aims to:

the invention aims to provide a KASP molecular marker TMSK23 related to eggplant temperature sensitive male sterility and application thereof, wherein molecular marker sites are obtained by hybridizing an eggplant rTGMS line 05ms serving as a female parent with an eggplant high-generation inbred line S132 serving as a male parent to obtain F ₂ Isolating the population. According to published high-quality genome information of eggplants, using a whole genome resequencing technology, performing a sequencing on eggplants F ₂ In the generation, the homozygous dominant fertile plants and the homozygous recessive sterile plants are subjected to pool building and sequencing, SNP (single nucleotide polymorphism) difference sites of the fertility gene and the sterile gene pool are screened, and the obtained difference sites are verified through KASP genotyping and protein three-dimensional structure prediction.

The invention has the following overall technical concept:

the KASP molecular marker TMSK23 related to the reverse thermosensitive male sterility of the eggplant has a SNP locus corresponding to the 85846822 th nucleotide locus C mutation to G on the eggplant chromosome 6, which results in the difference of fertility phenotypes of the eggplant, and the 85846822 th nucleotide on the eggplant chromosome 6 has a base sequence shown in SEQ ID No.4, wherein:

when the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is GG genotype, the eggplant is sterile;

when the genotype of the 85846822 nucleotide locus on the eggplant chromosome 6 is the CC genotype, the eggplant is homozygous and fertile;

when the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is GC genotype, the eggplant is heterozygous and fertile.

Application of KASP molecular marker TMSK23 related to eggplant reverse thermo-sensitive male sterility comprises the following steps:

(1) The application of the gene in detecting the reverse thermosensitive genic male sterile gene of the eggplant or the genotype of the gene;

(2) The application in screening or detecting the eggplant with the reverse thermosensitive core male sterile phenotype;

(3) Application in identifying eggplant reverse thermosensitive core male sterility character;

(4) Application in preparing reverse thermosensitive male sterile transgenic eggplant;

(5) The application in the seed production of reverse thermosensitive male sterile eggplant.

The specific technical concept of the invention is as follows:

the identification or detection comprises the steps of detecting the genotype of the eggplant by using a substance for detecting the polymorphism or genotype of the 85846822 nucleotide site on the chromosome 6 of the eggplant, and identifying or assisting in identifying the fertility phenotype of the eggplant according to the genotype of the eggplant to be detected:

the 85846822 nucleotide locus is a SNP locus of a molecular marker related to eggplant reverse thermo-sensitive male sterility, as shown in the 815 nucleotide of SEQ ID No.4, and the nucleotide variety is G or C;

the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is GG genotype, and the eggplant to be detected is sterile;

the genotype of the 85846822 nucleotide locus on the eggplant chromosome 6 is CC genotype, and the eggplant to be detected is homozygous and fertile;

the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is GC genotype, and the eggplant to be detected is heterozygous and fertile.

The substances for detecting the polymorphism or genotype of 85846822 locus on eggplant chromosome 6 are A1), A2) or A3) as follows:

a1 The polymorphic or genotypic material comprises a KASP primer that amplifies a nucleotide locus 85846822 on chromosome 6 of the eggplant;

a2 The polymorphism or genotype substance is a KASP primer reagent containing A1) the KASP primer;

a3 A kit containing A1) the KASP primer or A2) the KASP primer reagent.

The KASP primer is a primer group consisting of single-stranded DNA with a base sequence shown as SEQ ID No.1, single-stranded DNA with a base sequence shown as SEQ ID No.2 and single-stranded DNA with a base sequence shown as SEQ ID No. 3.

The application of the molecular marker related to the eggplant reverse thermo-sensitive male sterility comprises the following steps:

A. extraction of eggplant sterile line 05ms and fertility line S132 hybrid offspring F ₂ Generation-obtained seedling DNA;

B. by F in step A ₂ The DNA of the young seedling is taken as a template, PCR amplification is carried out by taking KASP primers in A1), A2), A3) or SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, the amplification is carried out by a fluorescent quantitative PCR instrument, and the detection and the typing are carried out by a KASP genotyping module matched with the instrument;

C. according to the parting result of the step B, when the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is GG, the eggplant to be detected is sterile;

when the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is CC, the eggplant to be detected is homozygous and fertile;

when the genotype of the 85846822 nucleotide locus on the chromosome 6 of the eggplant is GC, the eggplant to be detected is heterozygous and fertile.

The eggplant temperature-sensitive nuclear male sterile line 05ms and the fertility line S132 are provided by eggplant research laboratories of the applicant, and the sterility of the sterile line is controlled by a pair of recessive nuclear single genes and is genetically stable. The KASP primer was synthesized by Shanghai Biotechnology Co., ltd.

The primer combination for amplifying the SNP locus KASP comprises:

TMSK23-Primer1: GAAGGTGACCAAGTTCATGCTTGCAGTGTTTGACATGGAATATTC as shown in SEQ ID No. 1;

TMSK23-Primer2: GAAGGTCGGAGTCAACGGATTTGCAGTGTTTGACATGGAATATTG as shown in SEQ ID No. 2.

TMSK23-PrimerCommon AATGTGCTTGTAATGCAGTTCGAA as shown in SEQ ID No. 3.

The eggplant F is extracted in the step A ₂ Seedling replacementDNA extraction was performed using DNA extraction kit from Chengdu Fuji Biotechnology Co.

The PCR reaction in the step B adopts a reaction system of 10 mu L: PARMS PCR Mix (2X) 5. Mu.L, DNA extract 5. Mu.L (oven dried), forward primer 0.4. Mu.L, two reverse primers 0.15. Mu.L each, ddH2O 4.3. Mu.L; PCR amplification procedure: 94 ℃ for 15min;94℃for 20s at 65℃for 1min (10 cycles, 0.8℃drop per cycle); 94 ℃ for 20s and 57 ℃ for 1min, and 32 cycles are total; preserving heat at 25 ℃, collecting fluorescent signals, and reading data.

PCR Mix enzyme in step B: 2X PARMS SNP Gentyping PCR Mix developed by Wuhan City peptide Biotechnology Co., ltd was used as Mix enzyme for PCR reaction and KASP detection.

Adding the 5 mu L PARMS Mix solution into each 96-well PCR hole to be reacted, sealing the plate with a film, vortex vibrating, and placing the plate into a fluorescence quantitative PCR instrument for the following procedures: 94 ℃ for 15min;94℃for 20s at 65℃for 1min (10 cycles, 0.8℃drop per cycle); 94 ℃ for 20s and 57 ℃ for 1min, and 32 cycles are total; preserving heat at 25 ℃, collecting fluorescent signals, and reading data.

The fluorescent signal acquisition and SNP data analysis conditions in the step B are as follows:

the PARMS fluorescent signal can be detected at the same time as PCR amplification. The quantitative PCR instrument of the ABI series and the BioRad series is provided with a Genotyping data analysis module, and SNP allele data typing can be carried out according to the instrument instruction after PARMS reading is completed. The KASP reaction uses a Applied Biosystems 7500 Real-Time PCR System instrument, and performs fluorescence signal scanning using an endpoint method, uses ROX fluorescence as an internal reference fluorescence, and calculates Δrn values [ Δrn= (rn+) - (Rn-) ] of each sample using 7500 Software v2.0.6 software for data analysis. All the above reactions were performed on a 96-well PCR module (Applied Biosystems).

The invention has the substantial characteristics and the remarkable technical progress that:

1. in order to further improve breeding efficiency, the invention provides a KASP molecular marker closely linked with the temperature-sensitive male sterility of the eggplant, and the molecular marker and the fertility of the temperature-sensitive male sterility of the eggplant show coseparation, so that the genotypes of the fertility and the sterility plants can be accurately identified.

2. According to the KASP molecular marker of the temperature sensitive genic male sterility of the eggplant, the invention provides a pair of KASP marker primers which can be used for rapidly identifying the fertility phenotype of the eggplant and lay a good foundation for the transfer of the temperature sensitive genic male sterility gene of the eggplant.

3. Compared with the traditional method for distinguishing plant fertility according to morphological characteristics, fertility characteristics and economic characters, the molecular marker can distinguish plant fertility and genotypes thereof in advance in a seedling stage. Can identify F in the process of transferring ₂ The genotype (MSms ) of the generation fertile plant is hybridized and transferred with the sterile plant (MSms), so that the problem of mass side matching in the transfer process is effectively avoided, and the transfer efficiency is improved.

4. Compared with the first generation molecular marker (RELP, RADP, AFLP) and the second generation molecular marker (SSR, ISSR), the competitive allele-specific polymerase chain reaction (kompetitive allele specific PCR, KASP) is a novel genotyping technology based on Single Nucleotide Polymorphisms (SNPs), and can realize genotyping high-throughput screening of a large number of SNPs every day. The method has the characteristics of large flux, high speed, high accuracy, strong flexibility, short detection period, low cost and the like.

5. The molecular marker TMSK23 can effectively genotype male sterile lines and restorer lines and is used for molecular marker assisted selection. The development of the marker provides important technical support for guiding male sterile characters in a directional way, widening genetic basis of eggplant germplasm, creating a reverse thermosensitive male sterile inbred line with excellent characters, improving hybrid seed production efficiency and cultivating new male sterile eggplant varieties.

Drawings

The drawings of the invention are as follows:

FIG. 1 is a schematic diagram of the molecular marker TMSK23 at F ₂ The genotyping results in the generations are schematically shown.

The scatter diagram is divided into 3 parts as can be seen from fig. 1, circles represent genotypes C, and represent homozygous fertile plants; the triangle represents genotype G, which represents homozygous sterile plant; the square represents genotype GC, indicating heterozygous fertile plants.

FIG. 2 is a schematic diagram showing the comparison of the patterns of a wild-type fertility line and a reverse thermosensitive genic male sterile line in a pattern of 05 ms.

The anther of the fertility line is full and normal in two periods; the anther of the sterile line turns brown and shrank in the low temperature period, but the anther is full and normal in the high temperature period.

Detailed Description

The present invention is further described below with reference to examples, but the present invention is not limited thereto, and the claims of the present invention should be construed as being limited thereto, and any equivalent means according to the specification may be substituted without departing from the scope of the present invention.

Example 1

a3 A kit containing A1) the KASP primer or A2) the KASP primer reagent.

The application of the KASP molecular marker TMSK23 related to the eggplant reverse thermo-sensitive male sterility comprises the following steps:

The eggplant temperature-sensitive nuclear male sterile line 05ms and the fertility line S132 are provided by eggplant research laboratories of the applicant, and the sterility of the sterile line is controlled by a pair of recessive nuclear single genes and is genetically stable. Kasp primers were synthesized by Shanghai Biotechnology Co., ltd.

The primer combination for amplifying the SNP locus KASP comprises:

TMSK23-PrimerCommon AATGTGCTTGTAATGCAGTTCGAA as shown in SEQ ID No. 3.

The eggplant F is extracted in the step A ₂ The DNA extraction kit of Chengdu Fuji Biotechnology Co was used for the DNA extraction of young seedlings.

1. Identification of field traits

Hybridizing eggplant temperature-sensitive nuclear male sterile line 05ms with fertility line S132F ₁ F obtained after the selfing of the generation ₂ The 356 th generation strain is planted in a greenhouse in the day of 22 3 months, and fertility identification is carried out in the flowering period (low-temperature sterile period) at the bottom of 4 months. Through investigation F ₂ In the population, a fertile strain 264 strain and a sterile strain 92 strain are adopted. Will F ₂ Single plant seed reserving of fertile plants (MSms ) in the generation group, planting respectively, wherein each single plant planting group is 40 plants according to F ₃ Fertility segregation in the generation line population, from which eggplant F is deduced ₂ Genotype of the fertile plants in the generation. F (F) ₂ 75 plants (MSMS) with pure dominant generation and 188 plants (MSms) with heterozygous generation are bred, and specific results are shown in Table 1.

2. Plant DNA extraction

Eggplant sterile line 05ms and fertility line S132 parent and hybridization F ₁ Selfing offspring F of the generation (genotype MSms) ₂ The leaf DNA was extracted from 356 individuals (genotypes MSMS, MSms and MSMS) using the DNA extraction kit from Chengdu Fuji Biotechnology Co.

3. Construction of DNA Gene pool and sequencing

From eggplant F ₂ 30 extremely homozygous fertile strains and 30 extremely sterile strains are selected from the generation group, and after DNA is extracted, the sterile DNA pool (MSMS) and the sterile DNA pool (MSMS) are respectively and equally mixed and constructed. Parental individual and two extreme pool DNA were sequenced by BSA-seq technique.

4. Sequencing data analysis

(1) Data quality control

The resulting clear Data was sequenced to 116.07gbp, with q30 reaching 94.28. The average alignment efficiency of the sample to the reference genome was 99.66%, the average coverage depth was 24.25X, and the genome coverage was 90.78% (at least one base coverage).

(2) Mutation detection

SNP detection: 720,248 SNPs are obtained among parents, wherein 6,783 SNPs are obtained among non-synonymous mutations; 127,054 SNPs were obtained in total between pools, and 900 SNPs causing non-synonymous mutations were obtained in total. InDel detection: 96,493 Small InDels are obtained among parents; 27,905 Small InDels are obtained among the mixing tanks.

(3) Correlation analysis

SNP results: the SNP-index association algorithm obtains 7 candidate regions related to the characters, and the total length is 27.89Mb; ED association algorithm, which obtains 1 candidate region related to the character, the total length is 7.03Mb, and the intersection of the two methods obtains 1 candidate region related to the character, and the total length is 7.03Mb. InDel results: the InDel-index association algorithm obtains 15 candidate areas related to the characters, and the total length is 15.96Mb; ED association algorithm, which obtains 8 candidate regions related to the characters, the total length is 17.65Mb, and the intersection of the two methods obtains 1 candidate region related to the characters, and the total length is 6.00Mb.

Results of SNP and InDel intersection: intersection of SNP and InDel related regions is taken to obtain 1 candidate region related to the character, the candidate region is located in 83669840-89668480 locus region of chromosome 6, the total length is 6.00Mb, 709 genes are contained in the related region, 31 non-synonymous mutant genes and 3 frameshift mutant genes are contained in the related region.

5. Development of molecular markers for KASP verification

Developing a molecular marker of polymorphism between parents in the region of 83669840 to 89668480 locus of chromosome 6 of genome, and developing a molecular marker of polymorphism between parents and F as described above ₂ KASP detection, genotyping and phenotype identification combination analysis are carried out in the generation population, and the highest accuracy of mutation site 85846822 base variation (875 th base on CDS sequence of gene Smechr0602754.1 is changed from C to G, resulting in early termination of translated amino acid sequence) and fertility investigation is screened.

6. Identification of plant fertility genotype by KASP genotyping method

Designing KASP primers according to candidate gene SNP locus 85846822 on eggplant chromosome 6, wherein the primer combination comprises:

TMSK23-Primer1: GAAGGTGACCAAGTTCATGCTTGCAGTGTTTGACATGGAATATTC, as shown in SEQ ID No. 1;

TMSK23-PrimerCommon: AATGTGCTTGTAATGCAGTTCGAA as shown in SEQ ID No. 3.

PCR amplification reaction

The PCR reaction used a 10. Mu.L reaction system: PARMS PCR Mix (2X) 5. Mu.L, DNA extract 5. Mu.L (oven dried), forward primer 0.4. Mu.L, two reverse primers 0.15. Mu.L each, ddH2O 4.3. Mu.L;

PCR amplification procedure: 94 ℃ for 15min;94℃for 20s at 65℃for 1min (10 cycles, 0.8℃drop per cycle); 94 ℃ for 20s and 57 ℃ for 1min, and 32 cycles are total; preserving heat at 25 ℃, collecting fluorescent signals, and reading data.

Amplification was performed using a fluorescent quantitative PCR instrument, and SNP allele data typing was performed using the instrument's own genogyping data analysis module. The SNP locus 85846822 polymorphism is a sterile plant homozygous for the plant line G, a fertile plant homozygous for the plant line C, and a fertile plant heterozygous for the plant line GC.

Detection of the genotyping result of the sterile eggplant by the KASP typing method: eggplantF ₂ 188 heterozygous fertile plants, 75 homozygous fertile plants and 92 sterile plants exist in 356 single plants, the plants except for the number 254 have no SNP typing result, the other plants are consistent with the field character expression, the reliability of the candidate SNP locus is verified, and the specific results are shown in Table 1 and figure 1.

TABLE 1 KASP genotyping and field data results of eggplant temperature-sensitive sterile SNP locus 85846822

/>

Annotation: m represents sterility; f represents fertility; y represents homozygous fertility; z represents heterozygous fertility.

Example 2

Seed purity identification using molecular marker TMSK23

1. Identification of field traits

The eggplant thermo-sensitive male sterile line 05ms and the fertility line S63 are planted in open field without isolation, seeds are collected after natural pollination, the sterile line is self-planted in 2023 in 3 months and 20 days in the next year and planted in a greenhouse, and fertility identification is carried out in the flowering phase (low-temperature sterile phase) at the end of 4 months. Of the 50 plants examined, 7 were sterile and the other 43 were fertile.

2. Seedling and DNA extraction

The eggplant seedlings are cultured as follows: soaking eggplant seeds to accelerate germination, sowing the eggplant seeds into a seedling tray after exposure, and extracting leaf DNA by using a DNA extraction kit of Chengdu Fuji biotechnology Co Ltd after 2-3 true leaves grow on the plants.

2. Identification of plant genotype by KASP typing method

The KASP primer TMSK23 provided by the invention is subjected to PCR amplification reaction, amplified by the PCR method mentioned in the example 1, data are read, and typing is carried out after detection.

The plant with SNP locus 85846822 polymorphism G is homozygous sterile plant, the plant with GC is heterozygous fertile plant, the identification results are consistent with the field character expression, the reliability of the marker is verified, and the result is shown in Table 2, and can be used for purity identification of seeds.

TABLE 2 results of TMSK23 genotyping and field data for temperature-sensitive sterility markers of eggplants

Numbering device	SNP locus	Field traits	Numbering device	SNP locus	Field traits
						1	GC	F	26	GC	F
2	GC	F	27	GC	F
						3	GC	F	28	GC	F
4	GC	F	29	GC	F
						5	GC	F	30	GC	F
6	GC	F	31	GC	F
						7	GC	F	32	GC	F
8	GC	F	33	GC	F
						9	GC	F	34	GC	F
10	GC	F	35	GC	F
						11	GC	F	36	GC	F
12	GC	F	37	GC	F
						13	G	M	38	G	M
14	GC	F	39	GC	F
						15	G	M	40	GC	F
16	GC	F	41	GC	F
						17	GC	F	42	GC	F
18	GC	F	43	G	M
						19	GC	F	44	GC	F
20	GC	F	45	GC	F
						21	GC	F	46	G	M
22	GC	F	47	GC	F
						23	GC	F	48	GC	F
24	G	M	49	G	M
						25	GC	F	50	GC	F

Annotation: m represents sterility; f represents fertility.

Example 3

Use of molecular marker TMSK23 to improve transformation efficiency

1. Identification of field traits

The eggplant temperature-sensitive male sterile line is hybridized with 4 excellent round eggplant fertility inbred lines for 05ms, the sterile genes are transferred into the excellent round eggplant inbred lines through continuous hybridization polymerization and backcross transformation, 4 new round eggplant temperature-sensitive male sterile germplasm (22-4, 22-7, 22-12 and 22-14) is created, the sterile rate is more than 98%, the sterile rate is 100%, and a material foundation is laid for hybrid seed production by using the round eggplant temperature-sensitive male sterile line. In order to carry out fertility identification on the 4 newly created sterile materials, the sterile line inbred seeds are planted in a greenhouse for 20 days in 3 months in 2023, and fertility identification is carried out in the flowering phase (low-temperature sterile phase) at the end of 4 months. The investigation shows that all 16 plants of 22-4 are sterile plants; 22-7, wherein all 29 plants are sterile plants; all 13 plants of 22-12 are sterile plants; all of the 16 plants 22-14 were sterile.

2. DNA extraction

The first new leaf at the top of the plant was taken at day 28 of 4 months and fresh leaf DNA was extracted using the DNA extraction kit from Chengdu Fuji Biotechnology Co.

2. Identification of plant genotype by KASP typing method

The plant with the SNP locus 85846822 polymorphism of G is a homozygous sterile plant, and the plant with the SNP locus 85846822 polymorphism of GC is a heterozygous fertile plant. The identification results are shown in Table 3, and the sterile genotypes (G) of the plants 22-4, 22-7 and 22-12 are completely consistent with the identification results of the phenotype in the field; of the 16 plants 22-14, 15 exhibited a sterile genotype (G) while 1 genotype was heterozygous fertility Genotype (GC). In sum, the coincidence rate of the molecular marker result of 74 plants and the field phenotype identification result is 98.65%, and the marker is further verified to have very high reliability. The application of the marker can identify the fertility of the transfer offspring before field planting in the seedling stage, and only the sterile plants can be field planted afterwards, so that manpower, material resources and planting area are saved, transfer efficiency is greatly improved, and the fine variety breeding process is accelerated.

TABLE 3 results of TMSK23 genotyping and field data for temperature-sensitive sterility markers of eggplants

Annotation: m represents sterility; f represents fertility.

Claims

1. The KASP molecular marker TMSK23 related to the reverse thermosensitive male sterility of the eggplant is characterized in that the SNP locus thereof is mutated into G corresponding to a 85846822 th nucleotide locus C on a No. 6 chromosome of the eggplant, so that the fertility phenotype of the eggplant is different, the 85846822 th nucleotide of the No. 6 chromosome of the eggplant has a base sequence shown as SEQ ID No.4, and the SNP locus is the nucleotide locus C:

2. Use of the KASP molecular marker TMSK23 associated with eggplant reverse thermo-sensitive male sterility according to claim 1, characterized in that it comprises:

3. Use according to claim 2, wherein said identifying or detecting comprises detecting the genotype of the eggplant with a substance that detects the polymorphism or genotype of nucleotide position 85846822 on chromosome 6 of the eggplant, identifying or aiding in the identification of the fertility phenotype of the eggplant based on the genotype of the eggplant to be tested:

4. Use according to claim 3, characterized in that the substance for detecting the polymorphism or genotype of the 85846822 th locus on chromosome 6 of eggplant is A1), A2) or A3) as follows:

a3 A kit containing A1) the KASP primer or A2) the KASP primer reagent.

5. The use according to claim 4, wherein the KASP primer is a primer set comprising single-stranded DNA having a base sequence shown in SEQ ID No.1, single-stranded DNA having a base sequence shown in SEQ ID No.2, and single-stranded DNA having a base sequence shown in SEQ ID No. 3.

6. Use according to claim 4 or 5, characterized by comprising the steps of:

B. by F in step A ₂ Performing PCR amplification by taking seedling DNA as a template and using the KASP primer in claim 3 or 4, performing amplification by using a fluorescent quantitative PCR instrument, and performing detection typing by using a KASP genotyping module matched with the instrument;