CN117757909A

CN117757909A - Sequencing method containing Poly structural sequence

Info

Publication number: CN117757909A
Application number: CN202311726290.3A
Authority: CN
Inventors: 王永琦; 曹帅领
Original assignee: SANGON BIOTECH (SHANGHAI) CO Ltd
Current assignee: SANGON BIOTECH (SHANGHAI) CO Ltd
Priority date: 2023-12-14
Filing date: 2023-12-14
Publication date: 2024-03-26

Abstract

The invention provides a sequencing method containing a Poly structural sequence, belonging to the technical field of gene therapy sequencing. The sequencing method comprises the following steps: determining a specific primer according to the target sequence; performing PCR amplification on the target sequence based on the specific primer; after the PCR amplification result is determined by gel electrophoresis, the specific fragment is purified and intercepted by tapping; sequencing the specific fragment based on a sequencing program to obtain sequencing data; wherein the de-rotation time in the amplification cycle is 30 seconds. The sequencing method provided by the invention reduces the slippage phenomenon generated by sequencing by changing the sequencing amplification gradient amplification program under the condition that the target gene is not loaded into the plasmid, so that the accuracy of a first generation sequencing result is improved, compared with the existing method, the method is more convenient to operate, the experimental cost and the time are reduced, and the method has important significance for Sanger sequencing research, quality control and even clinical application of a short-segment tandem repeat sequence.

Description

Sequencing method containing Poly structural sequence

Technical Field

The invention belongs to the technical field of BRAF gene sequencing, and particularly relates to a sequencing method containing a Poly structural sequence.

Background

Sanger sequencing, also known as the first generation DNA sequencing technique, has the principle of incorporating fluorescent labelled ddNTPs into dNTPs, and the PCR product is likely to be ddNTPs at every position, starting from the first base after the primer, due to the random incorporation of ddNTPs. Since ddNTP lacks the 3' oh required for chain extension, chain extension is selectively terminated at G, A, T or C. Unlike conventional PCR products, this PCR product does not form an electrophoretic band, but a group of hundreds to thousands of fragments differing in length by one base. They have a common starting point, terminating at different nucleotides, with the same probability for each base to be terminated. And (3) carrying out capillary electrophoresis on fragments with different sizes, and finally obtaining the sequence of the target fragment through collecting and splicing fluorescent signals.

The replication and sliding mechanism is a generation mechanism of short-segment tandem repeat sequences which is relatively more studied at present. During DNA replication, replication of the sliding replication hysteresis strand will first form okazaki fragments, nicks and then ligate. Undergo DNA polymerase de-assembly and reassembly. During this time, the newly synthesized DNA strand and template strand will be separated with the DNA polymerase, and the template strand or the lag-behind strand will form a loop, which will result in a decrease or increase in the copy number of the tandem repeat of the short segment.

The replication and sliding mechanism is also embodied in biotechnology experiments. In particular, the phenomenon of slippage caused by the Poly structure during Sanger sequencing experiments is one of the common problems in the experiments. The interpretation of experimental results is very easy to influence.

The current technology is to load the target gene into plasmid, and then adjust the sequencing program to reduce the slippage. However, this method has the following disadvantages:

(1) Introducing additional steps and complexity: loading the gene of interest into the plasmid requires plasmid construction, transformation, etc., which adds to the complexity and time costs of the experiment. In addition, adjusting the sequencing program also requires modification of the experimental procedure, which may require re-optimization of experimental conditions and parameters.

(2) Deviations and errors may be introduced: in the process of loading the target gene into the plasmid, errors in plasmid construction, fragment loss or insertion errors, etc. may occur, resulting in deviation and error in sequencing results. Furthermore, adjusting the sequencing procedure may introduce new problems such as insufficient sequencing depth, difficulty in data analysis, and the like.

In general, in the current prior art, a method of loading a plasmid with an enriched target gene and reducing slippage by adjusting a sequencing program has drawbacks of introducing additional steps and complexity, and possibly introducing bias and error in practical application.

Disclosure of Invention

In order to solve the above problems, the present invention provides a sequencing method comprising a Poly structural sequence, comprising:

determining a specific primer according to the target sequence; wherein the target sequence contains a Poly structure;

performing PCR amplification on the target sequence based on the specific primer;

after the PCR amplification result is determined by gel electrophoresis, the specific fragment is purified and intercepted by tapping;

sequencing the specific fragment based on a sequencing program and obtaining sequencing data;

wherein, the unwinding time in the amplification cycle in the amplification procedure used in the PCR amplification process is 30 seconds.

Preferably, the Poly structure comprises any one or more of G/C rich, G/C Cluster, poly A, poly T and Poly C.

Preferably, the specific primer is located at a distance of 150dp to 200dp between the target site and the Poly structure.

Preferably, the amplification procedure comprises:

95 ℃,5 minutes and 1 cycle;

cycling at 95 ℃,30 seconds, 40 cycles;

cycling at 55deg.C for 30 seconds and 40;

cycling at 72 deg.c for 30 seconds, 40 cycles;

72 ℃,7 minutes, 1 cycle.

Preferably, the reaction system used for the PCR amplification comprises:

the specific primers, template DNA, PCR buffer and enzyme mix and deionized water.

Preferably, the total amount of components added in the reaction system is 20 μl, comprising the following volumes of components:

1 μl of each of the forward primer and the reverse primer in the specific primer;

1 μl of the template DNA;

10 μl of the PCR buffer and enzyme mixture;

deionized water 7 μl.

Preferably, the sequencing procedure comprises:

95 ℃,3 minutes, running for 1 cycle;

operating 30 cycles at 95 ℃ for 20 seconds;

running 30 cycles at 50℃for 20 seconds;

at 60 ℃, for 4 minutes, 30 cycles were run.

Preferably, in the step of sequencing the specific fragment based on a sequencing program and obtaining sequencing data, a sequencing system is used comprising:

3. Mu.L of sequencing kit, 1. Mu.L of sequencing primer at 10. Mu.M and 2. Mu.L of purified product.

Preferably, the sequencing the specific fragment based on a sequencing program and obtaining sequencing data comprises:

performing accounting purification on the intercepted specific fragment to obtain a purified product;

and carrying out capillary electrophoresis sequencing on the purified product to obtain the sequencing data.

Preferably, after the step of sequencing the specific fragment based on a sequencing program and obtaining sequencing data, the method further comprises:

and analyzing the sequencing data by using Sequencing Software software to obtain an analysis result.

The invention provides a sequencing method containing a Poly structural sequence, which comprises the following steps: determining a specific primer according to the target sequence; wherein the target sequence contains a Poly structure; performing PCR amplification on the target sequence based on the specific primer; after the PCR amplification result is determined by gel electrophoresis, the specific fragment is purified and intercepted by tapping; sequencing the specific fragment based on a sequencing program and obtaining sequencing data; wherein, the unwinding time in the amplification cycle in the amplification procedure used in the PCR amplification process is 30 seconds. The sequencing method provided by the invention reduces the slippage phenomenon generated by sequencing by changing the sequencing amplification gradient amplification program under the condition that the target gene is not loaded into the plasmid, so that the accuracy of a first-generation sequencing result is improved, compared with the existing method, the method is more convenient to operate, the experimental cost and the time are reduced, and the method has important significance for Sanger sequencing research, quality control and even clinical application of short-segment tandem repeat sequences.

Drawings

FIG. 1 is a diagram showing forward sequence alignment sequencing of BAT25 groups of experiments 1 and 2 in the examples of the present invention;

FIG. 2 is a diagram showing forward sequence alignment sequencing of BAT25 groups of experiments 1 and 2 according to the present invention;

FIG. 3 is a diagram showing forward sequence alignment sequencing of BAT26 group test 3 and test 4 in the examples of the present invention;

FIG. 4 is a reverse sequence comparison sequencing plot of BAT26 group experiment 3 and experiment 4 in the examples of the present invention.

The achievement of the objects, functional features and advantages of the present invention will be further described with reference to the accompanying drawings, in conjunction with the embodiments.

Detailed Description

The technical solutions of the present invention will be clearly and completely described in connection with the embodiments, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The invention provides a sequencing method containing a Poly structural sequence, which comprises the following steps:

step S1, determining a specific primer according to a target sequence; wherein the target sequence contains a Poly structure;

step S2, carrying out PCR amplification on the target sequence based on the specific primer; wherein, the unwinding time in the amplification cycle in the amplification procedure used in the PCR amplification process is 30 seconds.

Step S3, after the PCR amplification result is determined by gel electrophoresis, purifying by tapping and intercepting the specific fragment;

and step S4, sequencing the specific fragment based on a sequencing program and obtaining sequencing data.

The short tandem repeats (Short Tandem Repeats, STRs), also known as microsatellites (microsatellites), are a specific structure in the DNA sequence. They consist of short nucleotide sequence units (typically 1-6 bases) that are arranged together in tandem repeats. For example, a typical microsatellite sequence may be "ATATATATATAT".

As mentioned above, poly structure refers to the same nucleotide or nucleotide sequence that is repeated consecutively in a DNA sequence. For example, poly A/T refers to consecutively repeated adenine (A) or thymine (T) nucleotide sequences, while G/C Cluster refers to consecutively repeated guanine (G) or cytosine (C) nucleotide sequences.

In the replication and sliding mechanism, the Poly structure plays an important role. Due to the continuous reproducibility of the Poly structure, they form locally unstable regions on the DNA duplex, making DNA polymerase susceptible to slippage when DNA replication is performed. When a DNA polymerase encounters a Poly structure while replicating DNA, it may slip and misplace some bases, which results in an increase or decrease in the number of copies of the short tandem repeat in the DNA sequence, thereby affecting sequencing results. Thus, in Sanger sequencing experiments, the slipping phenomenon of Poly structures is a common problem, and some technical means are required to reduce the influence.

In the above-described sequencing method, in the amplification procedure employed in the PCR amplification process in step S2, the unwinding time is set to 30 seconds in order to reduce or avoid the slipping phenomenon caused by the Poly structure.

The unwinding time in the amplification cycle refers to a link in the PCR amplification process, that is, in the annealing step of each amplification cycle, the DNA double strand is heated to a high temperature to be unwound into two single strands. The unwinding time refers to the time required to unwind a double strand of DNA into two single strands under high temperature conditions.

Poly structure easily causes DNA polymerase to slip in the replication process, thereby affecting the sequencing result. The occurrence of slippage can be effectively reduced by setting a shorter unwinding time. The specific reasons are as follows:

(1) Shorter de-spinning times can reduce the high temperature action time in the amplification cycle, thereby reducing the melting and binding potential of the Poly structure. During the unwinding process, the high temperature causes the Poly structure to become single-stranded, while a shorter unwinding time means that the Poly structure is not easily fully developed. Thus, the Poly structure will be relatively less single stranded during the amplification cycle, reducing the occurrence of slip events.

(2) Shorter unwinding times may reduce the binding time of the DNA polymerase during the annealing phase. For target sequences where a Poly structure is present, DNA polymerase will specifically bind to the template DNA during the annealing stage. Shorter unwinding times allow the DNA polymerase to bind to the target sequence faster, reducing the risk of slippage due to the presence of Poly structures.

Therefore, by setting shorter unwinding time in the amplification cycle, the slipping phenomenon generated by the Poly structure can be effectively reduced, and the accuracy and reliability of the sequencing result are improved.

In a word, the sequencing method provided by the invention reduces the slippage phenomenon generated by sequencing by changing the sequencing amplification gradient amplification program under the condition that the target gene is not loaded into the plasmid, so that the accuracy of a first-generation sequencing result is improved, compared with the existing method, the method is more convenient to operate, the experimental cost and the experimental time are reduced, and the method has important significance for Sanger sequencing research of short-segment tandem repeat sequences, quality control and even clinical application.

Further, the Poly structure comprises any one or more of G/C rich, G/C Cluster, poly A, poly T and Poly C.

As mentioned above, poly structure refers to the presence of consecutively repeated nucleotide sequences in the target DNA sequence, which may be a single nucleotide (e.g., poly A and Poly T) or multiple identical nucleotides (e.g., G/C rich, G/C cluster, and Poly C). The specific explanation is as follows:

G/C rich: i.e., a repeated sequence of GC-rich bases, typically comprises three or more adjacent GC bases. During PCR amplification, the G/C rich sequence is prone to secondary structure, thereby interfering with polymerase binding and amplification.

G/C cluster: refers to a repeated sequence of multiple GC bases occurring consecutively in the target DNA sequence, which structure is prone to slippage, leading to errors in the amplification process.

Poly A: refers to a repeated sequence of consecutive adenine nucleotides (A) in the target DNA sequence, which may form secondary structures during PCR amplification, interfering with the binding and amplification of the polymerase.

Poly T: refers to repeated sequences of consecutive thymidines (T) in the target DNA sequence, which may also form secondary structures during PCR amplification, interfering with the binding and amplification of the polymerase.

Poly C: referring to the repeated sequence of consecutive cytosine nucleotides (C) in the target DNA sequence, slippage may occur during PCR amplification, resulting in errors during amplification.

These Poly structures tend to interfere during PCR amplification and sequencing, affecting accuracy and reliability. Thus, special attention to the existence of these structures is required in designing PCR primers and sequencing schemes, and corresponding strategies are adopted for optimization.

In addition, some other types of Poly structures besides the above-mentioned Poly A, poly T, G/C rich, G/C cluster and Poly C may also cause slippage during PCR amplification. These include, but are not limited to:

repeat sequence: the same nucleotide repeat sequence, e.g., atattat or CGCGCGCG, occurs consecutively in the target DNA sequence. These repeated sequences are prone to slippage during PCR amplification, resulting in a change in the length of the amplified product.

High GC content region: the GC base-rich region of the DNA sequence, particularly the region having a continuous GC base composition, also easily forms a secondary structure, thereby affecting the amplification process of the polymerase and causing a slip phenomenon.

Single nucleotide multimers: in addition to Poly A, poly T and Poly C, there are other single nucleotide polymers such as Poly G (consecutive guanine nucleotides) and Poly G/C (consecutive guanine/cytosine nucleotides) that may also cause slippage during PCR amplification.

These Poly structures may cause slippage during PCR amplification, so that the presence of these structures needs to be considered in PCR primer design and experimental optimization to avoid affecting experimental results. For different types of Poly structures, corresponding strategies can be adopted to reduce the occurrence of slipping phenomenon, and the accuracy and the reliability of PCR amplification and sequencing results are ensured.

Further, the specific primer has a distance between the target site and the Poly structure of 150dp-200dp.

In Sanger sequencing experiments, short tandem repeat structures (Poly structures) tend to cause slippage, affecting the accuracy and reliability of PCR amplification and sequencing results. In order to reduce the impact of this slipping phenomenon, special measures have to be taken, of which one very important measure is to take into account the presence of Poly structures in the sequencing primer design.

Specifically, the slippage phenomenon of the Poly structure usually occurs in the repeated sequence region in the amplification process, so that the distance between the position of the sequencing primer and the Poly structure is kept above 150-200 bp, the sequencing primer can avoid the region as much as possible, and the slippage phenomenon is reduced. Meanwhile, the distance is far enough, so that the PCR amplification reaction can fully amplify the target fragment without affecting the amplification efficiency. If the sequencing primer is designed too close to the Poly structure, it is susceptible to the Poly structure, causing a slipping phenomenon, resulting in erroneous and unreliable sequencing results.

Therefore, in Sanger sequencing experiments, in order to reduce the influence of the slippage phenomenon of the Poly structure on the experimental result, a specific primer needs to be designed at a position far away from the Poly structure in consideration of the existence of the Poly structure in the design of sequencing primers, so that the accuracy and the reliability of the PCR amplification and the sequencing result are ensured.

Further, the amplification procedure includes:

95 ℃,5 minutes and 1 cycle;

cycling at 95 ℃,30 seconds, 40 cycles;

cycling at 55deg.C for 30 seconds and 40;

cycling at 72 deg.c for 30 seconds, 40 cycles;

72 ℃,7 minutes, 1 cycle.

Further, the reaction system for PCR amplification comprises:

Further, in the reaction system, the total amount of the added components is 20. Mu.L, and the reaction system comprises the following components by volume:

1 μl of the template DNA;

10 μl of the PCR buffer and enzyme mixture;

deionized water 7 μl.

Further, the sequencing procedure comprises:

95 ℃,3 minutes, running for 1 cycle;

operating 30 cycles at 95 ℃ for 20 seconds;

running 30 cycles at 50℃for 20 seconds;

at 60 ℃, for 4 minutes, 30 cycles were run.

Further, in the step of sequencing the specific fragment based on a sequencing program and obtaining sequencing data, a sequencing system is adopted, which comprises:

Further, the sequencing the specific fragment based on a sequencing program and obtaining sequencing data comprises:

Further, after the step of sequencing the specific fragment based on a sequencing program and obtaining sequencing data, the method further comprises the steps of:

Sequencing Software, i.e. ProView ^TM Sequencing Software, a type of computer software for processing and analyzing DNA sequencing data. Such software is typically used to decode, sort, align and annotate raw DNA sequence data generated by sequencers so that researchers can obtain more information about DNA sequences.

The invention is further illustrated by the following specific examples, but it should be understood that these examples are for the purpose of illustration only and are not to be construed as limiting the invention in any way.

Examples:

1. materials and reagents:

materials: construction of plasmid nucleic acids, related synthetic primers

Reagent: 2X HieffTM PCR Master Mix (PCR buffer and enzyme mixture, salmonella on the sea),terminator v3.1cycle Sequencing Kit (Sequencing Kit, thermo Fisher), POP-7 ^TM (Thermo Fisher), hiDi format (Thermo Fisher), and magnetic bead method DNA gel recovery kit (biological).

2. The experimental method comprises the following steps:

(1) Determining the target fragment:

in this embodiment, BAT-25 locus and BAT-26 locus are selected; among them, BAT-25 and BAT-26 are two sites for microsatellite instability (microsatellite instability, MSI) detection.

Wherein BAT-25 is a ployT structure of up to 25bp in chromosome 4. The specific position is chr4:54732046-54732070. The sequence is as follows:

CAAGTTCACATTAGTTCATTCATTACCAGCCTTTGGTATGTCATTGC

CACTGTCTTTTCCTTTCCTGACCTTTATGGTTGTAATTGCTAAGAAAAA

TCCTCTCTTCCTCACAGGCTCATACATAGAAAGAGATGTGACTCCCGC

CATCATGGAGGATGACGAGTTGGCCCTAGACTTAGAAGACTTGCTGA

GCTTTTCTTACCAGGTGGCAAAGGGCATGGCTTTCCTCGCCTCCAAGA

ATGTAAGTGGGAGTGATTCTCTAAAGAGTTTTGTGTTTTGTTTTTTTGA[TTTTTTTTTTTTTTTTTTTTTTTTT]GAGAACAGAGCATTTTAGAGCCAT AGTTAAAATGCAGAATGTCATTTTGAAGTGTGGTAACCAAAAGCAGAGGAAATTTAGTTTCTTCATGTTCCAACTGCTGTCTCTTTGGAATTCCTGTTCTAATTTATAAGCTGTAAAGTACAAGCCTGTCTAAATGAGTTTTTCTATGAATATTCTTTTATATGCAGTGAAATTCTTTTAAAACTTTTGGCTTTTAGGATATAGGATATGTTCCTAGAGAACAGAATCATTTTATCAGTAAAAGCAGAG。

wherein BAT-26 is a ployA structure with a length of 27bp on chromosome 2. The specific position is chr2:47414421-47414447. The sequence is as follows:

ATCTTTAGAACTGGATCCAGTGGTATAGAAATCTTCGATTTTTAAAT

TCTTAATTTTAGGTTGCAGTTTCATCACTGTCTGCGGTAATCAAGTTTT

TAGAACTCTTATCAGATGATTCCAACTTTGGACAGTTTGAACTGACTA

CTTTTGACTTCAGCCAGTATATGAAATTGGATATTGCAGCAGTCAGAG

CCCTTAACCTTTTTCAGGT[AAAAAAAAAAAAAAAAAAAAAAAAAAA]GGGTTAAAAATGTTGAATGGTTAAAAAATGTTTTCATTGACATATACT GAAGAAGCTTATAAAGGAGCTAAAATATTTTGAAATATTATTATACTTGGATTAGATAACTAGCTTTAAATGGCTGTATTTTTCTCTCCCCTCCTCCACTCCACTTTTTAACTTTTTTTTTTTTAAGTCAGAGTCTCACTTGTTCCCTAGGCCAGAGTGCAGTGGCACAATCTCAGCCCACTCTAACCTCCACCTC CCAAGTAGTTGGGATTACAGTTGCCTGCCACC。

(2) Determining specific primers:

upstream primer (BAT-25F): TACCAGGTGGCAAAGGGCA;

downstream primer (BAT-25R): TCTGCATTTTAACTATGGCTC;

upstream primer (BAT-26F): CTACTTTTGACTTCAGCCAGTATATGA;

downstream primer (BAT-25R): AAGCTTCTTCAGTATATGTCAATGAAA.

The primer probe is synthesized into a commercial product.

(3) Preparing a PCR system: the amplification system was prepared as in the following table, and the template nucleic acid was entered into the system, and two experiments were performed on the same sample, one set of two, as a control.

(a) The BAT-25 experimental group is named as experiment 1 and experiment 2;

(b) The BAT-26 experimental group was named experiment 3 and experiment 4.

Wherein, experiment 1 and experiment 3 employ the method provided by the invention to amplify and sequence; experiment 2 and experiment 4 were used as a comparison and amplified and sequenced using conventional procedures. Specific reaction systems, amplification procedures, sequencing systems and sequencing procedures are shown in the following table.

The reaction system is as follows:

TABLE 1 reaction System Table

Component (A)	Volume (mu L)
		Forward primer(10pmol/ul)	1
Reverse primer(10pmol/ul)	1
		Template DNA	1
2×Hieff ^TM PCR Master Mix	10
		Sterilized deionized water	7
Total volume	20

(4) PCR amplification and procedure: adding the prepared system into a PCR tube, and then placing the PCR tube into a PCR gradient amplification instrument for amplification, wherein the amplification procedure is as follows:

TABLE 2 amplification program Table

(5) And (3) electrophoresis and tapping purification of PCR products: preparing 2% TAE agarose gel, putting the four PCR amplified products into the gel, and putting the gel into an electrophoresis tank. And (3) electrophoresis at 200V, 400mA and 30min to observe whether a target strip exists or not, cutting and recovering the target PCR strip, and sequencing the purified PCR product.

(6) Sequencing PCR products: sequencing the amplified and purified product.

Wherein, experiment 1 and experiment 3 used the adjusted sequencing system and reaction procedure to perform sequencing and amplification, the system and procedure were as follows:

TABLE 3 sequencing System Table (post-adjustment System) was used in this example

Reagent(s)	Volume (mu L)
		Bigdye 3.0	3
Sequencing primer (10. Mu.M)	1
		Purification of the product	2
Total	6

Table 4, a sequencing program table (low temperature extension program) was used in this example:

wherein, experiment 2 and experiment 4 were amplified using the general system and general procedure in the conventional method, the system and procedure were as follows:

TABLE 5 sequencing System (general System)

Reagent(s)	Volume (mu L)
		BigDyeMix (BigDye, sequencing buffer ratio mix)	3
Sequencing primer (10. Mu.M)	1
		Purification of the product	2
Deionized water	4
		Total	6

TABLE 6 sequencing procedure (general procedure)

Compared with the general method, the method after adjustment does not add Sequencing buffer reagent into the reaction system. The denaturation time in the cycle in the reaction procedure was reduced to 5s and the annealing temperature was reduced to 50 ℃.

The prepared system is centrifuged after being evenly mixed, and is put on a PCR instrument to be amplified by selecting a proper program.

(7) Sequencing product purification sequencing: the method is to purify nucleic acid by sodium acetate ethanol precipitation.

(8) Sequencing on a machine: HIDI was added to the purified and dried product and centrifuged with shaking. Placing the sample into a 3730 sequencer for capillary electrophoresis sequencing.

(9) And downloading corresponding data, and comparing and analyzing the data by the experimental group.

Experimental results:

experiment 1 and experiment 3 are experimental results of sequencing by adopting the sequencing method provided by the invention, and are used as experimental groups;

and experiment 2 and experiment 4 are the results of the comparison of the sequencing experiments performed by the conventional method, namely the control group.

Referring to fig. 1 to 4, it can be seen from the sequencing peak diagrams of the experimental results that the background peaks after the Ploy structure (the left side peak height and the approximate continuous peak in the diagram represent the Ploy structure, the right end after the Ploy structure, wherein the background peaks are thickened) of the sequencing peak diagrams of the experiment 1 and the experiment 3 are lower and cleaner, and the background peaks after the Ploy structure of the experiment 2 and the experiment 4 are higher and more disordered, which obviously affects the interpretation of the base sequence.

Thus, it can be concluded that: the sequencing results of the experiment 1 and the experiment 3 adopting the sequencing method provided by the invention are more stable, and the slippage phenomenon caused by the POLY structure is lower.

While the preferred embodiments and examples of the present invention have been described, it should be noted that modifications and improvements, including but not limited to, adjustments of proportions, procedures, amounts and reaction vessels, may be made by those skilled in the art without departing from the inventive concept herein.

Claims

1. A method of sequencing a sequence comprising a Poly structure, comprising:

2. The method of sequencing a sequence containing a Poly structure of claim 1, wherein the Poly structure comprises any one or more of G/C rich, G/C Cluster, poly A, poly T and Poly C.

3. The method of sequencing a sequence containing a Poly structure of claim 1, wherein the specific primer is located at a distance of 150dp to 200dp between the target site and the Poly structure.

4. The method of sequencing a Poly-containing structural sequence of claim 1, wherein the amplification procedure comprises:

95 ℃,5 minutes and 1 cycle;

cycling at 95 ℃,30 seconds, 40 cycles;

cycling at 55deg.C for 30 seconds and 40;

cycling at 72 deg.c for 30 seconds, 40 cycles;

72 ℃,7 minutes, 1 cycle.

5. The method for sequencing a sequence containing a Poly structure according to claim 1, wherein the reaction system for PCR amplification comprises:

6. The method for sequencing a sequence containing a Poly structure according to claim 5, wherein the total amount of added components in the reaction system is 20. Mu.L, comprising the following components by volume:

1 μl of the template DNA;

10 μl of the PCR buffer and enzyme mixture;

deionized water 7 μl.

7. The method of sequencing a Poly-containing structural sequence of claim 1, wherein the sequencing procedure comprises:

95 ℃,3 minutes, running for 1 cycle;

operating 30 cycles at 95 ℃ for 20 seconds;

running 30 cycles at 50℃for 20 seconds;

at 60 ℃, for 4 minutes, 30 cycles were run.

8. The method of sequencing the Poly-containing structural sequence of claim 1, wherein the step of sequencing the specific fragment based on a sequencing program and obtaining sequencing data uses a sequencing system comprising:

9. The method of sequencing the Poly-containing structural sequence of claim 1, wherein sequencing the specific fragment based on a sequencing program and obtaining sequencing data comprises:

10. The method of sequencing the Poly-containing structural sequence of claim 1, further comprising, after the step of sequencing the specific fragment based on a sequencing program and obtaining sequencing data: