CN117757710B

CN117757710B - Low endotoxin escherichia coli fermented at high density and application thereof

Info

Publication number: CN117757710B
Application number: CN202311798215.8A
Authority: CN
Inventors: 杨萍; 黄潇; 温佳红; 王询; 刘高成; 祁高富; 范豪
Original assignee: Hengjing Hechuang Biomedicine Zhejiang Co ltd
Current assignee: Hengjing Hechuang Biomedicine Zhejiang Co ltd
Priority date: 2023-03-16
Filing date: 2023-03-16
Publication date: 2024-06-04
Anticipated expiration: 2043-03-16
Also published as: CN117757710A; CN116376791A

Abstract

According to the low endotoxin escherichia coli with high-density fermentation and the application thereof, lpxP, lpxL, lpxM, pagP genes for regulating and controlling fatty acid chain synthesis on escherichia coli TAK genome, gutQ genes for participating in Kdo molecule synthesis and eptA genes for participating in phosphate group modification are knocked out, so that cells generate Lipid IV _A molecules without endotoxin activity. In order to improve the growth state of engineering strains under the condition of Kdo synthetic gene deletion, the invention carries out point mutation on msbA genes encoding lipopolysaccharide transporter. The CleanTAK series engineering strain endotoxin prepared by the invention is obviously reduced, and the engineering strain can be used for expressing recombinant protein medicines, vaccine antigens, antibodies, food proteins, enzymes, spider silk and other exogenous proteins in the follow-up process, or is used as a host for cloning and producing plasmids, or is used as a chassis for constructing engineering bacteria for synthesizing secondary metabolites, so that the purification steps of proteins, nucleic acids and secondary products are simplified, and the safety of the products is improved.

Description

Low endotoxin escherichia coli fermented at high density and application thereof

The application relates to a low endotoxin escherichia coli fermented at high density and applied by the patent application of 2023, 03 and 16 days, 202310253436.0 and the patent application of the application.

Technical Field

The invention relates to the technical field of bioengineering, in particular to low endotoxin escherichia coli fermented at high density and application thereof.

Background

Endotoxins, also known as lipopolysaccharides, are a component of the cell wall of gram-negative bacteria and are released into the surrounding environment as the bacteria divide, die or lyse as they grow. Endotoxins are composed of a chemically structured main of a short chain non-repeating core polysaccharide, a long chain O-specific antigenic polysaccharide and a hydrophobic lipid A. Lipid A is the active center of endotoxin and comprises two phosphate groups and six fatty acid chains, and the structure can most effectively stimulate the organism to generate immune inflammatory reaction, and meanwhile, the length, the number and the positions and 1 'and 4' of the fatty acid chains combined on a carbon skeleton are important influencing factors for influencing the lipid A to stimulate the TLR4/MD2 pathway and the caspase-11 pathway. Lipid A activates the TLR4/MD2/CD14 pathway in the body, stimulates the body to secrete various cytokines, and thus leads to immune response, and in severe cases, to septic shock and even death (Nat Rev Microbio 2010,8,8-14).

In E.coli, several enzymes are involved in the synthesis of lipopolysaccharide. Lipid IV _A is a non-glycosylated precursor during lipopolysaccharide synthesis, and Kdo2-Lipid IV _A is obtained by adding 2 molecules of Kdo molecule formed by isomerase KdsD or GutQ to its backbone (JBacteriol 2005, 187, 6936-42). Based on the above, a twelve-carbon-containing and fourteen-carbon-containing fatty acid chain is respectively introduced by lauroyl transferase LpxL (HtrB) and myristoyl transferase LpxM (MsbB) to form Kdo2-LipidA molecules. Kdo2-Lipid IV _A palm oleoyl-ACP acylase LpxP is induced to express at low temperature (12 ℃) with the addition of unsaturated hexadecanoyl chains at the expense of laurate (JBiol Chem 2002, 277, 14186-93). There are various modifications during lipopolysaccharide synthesis, such as palmitoyl transferase PagP can add a hexadecanoic fatty acid chain to LipidA (lipid a); ethanolamine phosphotransferase EptA can add an ethanolamine phosphate group to LipidA (Annu RevBiochem2007, 76, 295-329). ABC transporter MsbA is involved in the transport of core oligosaccharide-LipidA molecules during lipopolysaccharide synthesis, and the msbA 52 or 148 base mutation is confirmed to be an inhibitor of Kdo deletion mutants (MolMicrobiol 2008, 67, 633-48).

Coli TAK strains are high-density fermentable prokaryotic expression strains used for large-scale production of recombinant proteins. However, endotoxin residues limit the application of recombinant protein products in the pharmaceutical field to a certain extent, and the existing endotoxin removal technology in recombinant protein products generally has the defects of high cost, complex operation and incomplete removal. Therefore, the invention selects and utilizes the gene editing technology to modify the lipopolysaccharide synthesis or modification way, and reduces the endotoxin activity of the escherichia coli expression system from the source to the maximum extent.

Disclosure of Invention

The invention aims to provide low endotoxin escherichia coli with high-density fermentation and application thereof, so as to solve the problems in the background technology. Specifically, the escherichia coli strain does not contain genes related to fatty acid chain transferase synthesis and related genes involved in Kdo molecule synthesis and phosphate group modification by utilizing a gene knockout technology: lpxP, lpxL, lpxM, pagP, kdsD, gutQ, eptA; meanwhile, the coding gene of lipopolysaccharide transporter MsbA is subjected to point mutation to obtain the low endotoxin escherichia coli prokaryotic expression system CleanTAK series engineering strain. Further, the relevant engineering strains were named CleanTAK a, cleanTAK a, cleanTAK5 a, cleanTAK 6a, cleanTAK 7, cleanTAK 7m. Wherein CleanTAK 3 alpha is an engineering strain for knocking out the eptA, kdsD and pagP genes; cleanTAK4 alpha is an engineering strain for knocking out eptA, kdsD, pagP and lpxL genes; cleanTAK5 alpha is an engineering strain for knocking out eptA, kdsD, pagP, lpxL and lpxP genes; cleanTAK6 alpha is an engineering strain for knocking out eptA, kdsD, pagP, lpxL, lpxP and lpxM genes; cleanTAK 7 is an engineering strain for knocking out eptA, kdsD, pagP, lpxL, lpxP, lpxM and gutQ genes; cleanTAK 7m is an engineering strain for knocking out eptA, kdsD, pagP, lpxL, lpxP, lpxM and gutQ genes and msbA gene point mutation.

In order to achieve the above purpose, the present invention proposes the following technical scheme:

The invention aims to provide low endotoxin escherichia coli subjected to high-density fermentation and application thereof, wherein the low endotoxin escherichia coli is classified and named ESCHERICHIA COLI CLEANTAK alpha and is preserved in China Center for Type Culture Collection (CCTCC) M20221904, and the preservation time is 2022 and 12 months 09.

The invention also provides the use of ESCHERICHIA COLI CLEANTAK alpha for expression of protein/polypeptide substances, including but not limited to protein/polypeptide pharmaceuticals, protein/polypeptide agents, protein/polypeptide foods (e.g., sweet proteins, artificial meats, etc.), and protein/polypeptide biomaterials such as spider silks.

The invention also provides uses of ESCHERICHIA COLI CLEANTAK a for preparing enzyme products, including but not limited to protease products (e.g., carboxypeptidase, trypsin, enterokinase, etc.), tool enzymes for in vitro synthesis of mRNA (e.g., T7 RNA polymerase, methyltransferase, vaccinia virus capping enzyme, inorganic pyrophosphatase, DNase I, RNase inhibitors, omnipotent nucleases, etc.), feed enzymes (proteases, phytases, cellulases, hemicellulases, etc.), biochemical enzymes (methylases, racemases, acylases, etc.), and the like.

The invention also provides the application of ESCHERICHIA COLI CLEANTAK alpha in preparing plasmids, such as gene therapy, DNA vaccine, mRNA preparation and the like.

The invention also provides a ESCHERICHIA COLI CLEANTAK alpha synthetic biological chassis for preparing secondary metabolites such as polyhydroxyalkanoates, artemisinic acid, taxadiene, n-butanol and the like.

The second purpose of the invention is to provide a low endotoxin escherichia coli with high-density fermentation and application thereof, wherein the low endotoxin escherichia coli is classified and named ESCHERICHIA COLI CLEANTAK alpha and is preserved in China Center for Type Culture Collection (CCTCC) M20221905, and the preservation time is 2022, 12 months and 09 days.

The invention also provides the use of ESCHERICHIA COLI CLEANTAK alpha for expression of protein/polypeptide substances, including but not limited to protein/polypeptide pharmaceuticals, protein/polypeptide agents, protein/polypeptide foods (e.g., sweet proteins, artificial meats, etc.), and protein/polypeptide biomaterials such as spider silks, etc.

The invention also provides the application of ESCHERICHIA COLI CLEANTAK < 6 > alpha in preparing plasmids, such as gene therapy, DNA vaccine, mRNA preparation and the like.

The invention also provides ESCHERICHIA COLI CLEANTAK alpha for use in the chassis of synthetic biology for the preparation of secondary metabolites such as polyhydroxyalkanoates, artemisinic acid, taxadiene, n-butanol and the like.

The invention further aims to provide low endotoxin escherichia coli subjected to high-density fermentation and application thereof, wherein the low endotoxin escherichia coli is classified and named ESCHERICHIA COLI CLEANTAK M and is preserved in China Center for Type Culture Collection (CCTCC) M20221906, and the preservation time is 2022 and 12 months 09.

The invention also provides ESCHERICHIA COLI CLEANTAK m for use in expressing protein/polypeptide substances, including but not limited to protein/polypeptide pharmaceuticals, protein/polypeptide agents, protein/polypeptide foods (e.g., sweet proteins, artificial meats, etc.), and protein/polypeptide biomaterials such as spider silks.

The invention also provides ESCHERICHIA COLI CLEANTAK m for use in preparing enzyme products, including but not limited to protease products (e.g., carboxypeptidase, trypsin, enterokinase, etc.), tool enzymes for in vitro synthesis of mRNA (e.g., T7 RNA polymerase, methyltransferase, vaccinia virus capping enzyme, inorganic pyrophosphatase, DNase I, RNase inhibitor, omnipotent nuclease, etc.), feed enzymes (protease, phytase, cellulase, hemicellulase, etc.), biochemical enzymes (methylase, racemase, acylase, etc.), and the like.

The invention also provides the application of ESCHERICHIA COLI CLEANTAK m in preparing plasmids, such as gene therapy, DNA vaccine, mRNA preparation and the like.

The invention also provides ESCHERICHIA COLI CLEANTAK m for use in the chassis of synthetic biology for the preparation of secondary metabolites such as polyhydroxyalkanoates, artemisinic acid, taxadiene, n-butanol and the like.

Compared with the prior art, the invention has the main advantages that:

1. The escherichia coli TAK strain is an expression host bacterium capable of high-density fermentation, but in the application production, the expression of recombinant proteins is restricted due to the influence of endotoxin, so that the application of the escherichia coli TAK strain in the biomedical industry is influenced. The invention utilizes a gene editing method to modify lipid A synthesis, modification and related enzymes involved in lipopolysaccharide transport and other genes, reduces the content of lipopolysaccharide, obviously reduces the endotoxin content of the obtained engineering strain, and reduces the cost of removing endotoxin by recombinant protein, plasmid or secondary metabolite, thereby reducing the production cost of recombinant protein, plasmid or secondary metabolite products and improving the safety of recombinant protein, plasmid or secondary metabolite products.

2. The low endotoxin activity CleanTAK series engineering strain still maintains the high-density fermentation, rapid growth and high-efficiency expression of various proteins or synthetic plasmids of the parent TAK strain, but simultaneously obviously reduces the endotoxin content, and can be used for producing various high-quality proteins/polypeptides, nucleic acids or secondary metabolites at low cost. The growth rate of the strain is inhibited to a certain extent along with the increase of the gene editing quantity, and the strain is used for expressing proteins, and the capacity of expressing the proteins is not different from that of a parent strain.

It should be understood that all combinations of the foregoing concepts, as well as additional concepts described in more detail below, may be considered a part of the subject disclosure, provided that such concepts are not mutually inconsistent.

The foregoing and other aspects, embodiments, and features of the teachings of the present invention will be more fully understood from the following description. Other additional aspects of the invention, such as features and/or advantages of the exemplary embodiments, will be apparent from the description which follows, or may be learned by practice of the embodiments according to the teachings of the invention.

Drawings

Fig. 1: the PCR identification electrophoresis result of the engineering strain CleanTAK series of low endotoxin escherichia coli prokaryotic expression system engineering bacteria is constructed in the invention;

Fig. 2: the method is a result of detecting the whole cell endotoxin activity of CleanTAK series engineering strains;

Fig. 3: the result of the growth characteristics of CleanTAK series engineering strains in the invention during high-density fermentation;

Fig. 4: the result of high-resolution mass spectrum is carried out after CleanTAK series engineering strain lipid A is purified; fig. 5: the result of expressing the CleanTAK series engineering strain proinsulin glargine protein containing pEINGL expression plasmid in the invention.

Detailed Description

The present invention is described in detail below by way of examples, which are necessary to be pointed out herein for further illustration of the invention and are not to be construed as limiting the scope of the invention, since numerous insubstantial modifications and adaptations of the invention will occur to those skilled in the art in light of the foregoing disclosure.

The invention provides a low endotoxin escherichia coli with high-density fermentation and application thereof, in particular to a low endotoxin escherichia coli strain which does not contain genes related to fatty acid chain transferase synthesis and related genes involved in Kdo molecule synthesis and phosphate group modification: lpxP, lpxL, lpxM, pagP, kdsD, gutQ, eptA. Meanwhile, the coding gene of the lipopolysaccharide transporter MsbA is subjected to point mutation to obtain CleanTAK alpha, cleanTAK alpha, cleanTAK 5 alpha, cleanTAK 6 alpha and CleanTAK 7m engineering strains. Wherein CleanTAK 3 alpha is an engineering strain for knocking out the eptA, kdsD and pagP genes; cleanTAK4 alpha is an engineering strain for knocking out eptA, kdsD, pagP and lpxL genes; cleanTAK 5 alpha is an engineering strain for knocking out eptA, kdsD, pagP, lpxL and lpxP genes; cleanTAK 6 alpha is an engineering strain for knocking out eptA, kdsD, pagP, lpxL, lpxP and lpxM genes; cleanTAK 7m is an engineering strain for knocking out eptA, kdsD, pagP, lpxL, lpxP, lpxM and gutQ genes and msbA gene point mutation. The nucleotide sequence information of the related genes is shown in the following table:

Sequence name	Nucleotide sequence
		eptA	SEQ ID No.1
kdsD	SEQ ID No.2
		pagP	SEQ ID No.3
lpxL	SEQ ID No.4
		lpxP	SEQ ID No.5
lpxM	SEQ ID No.6
		gutQ	SEQ ID No.7
msbA	SEQ ID No.8

Further, the construction method of the low endotoxin escherichia coli with high-density fermentation comprises the following steps:

1) Heat shock converting the temperature sensitive pCas plasmid into colibacillus TAK cell, and kanamycin (50 mug/mL) resistance screening to obtain positive clone;

2) Constructing pTarget plasmid expression targeting sgRNA;

3) Amplifying the upstream and downstream homology arms of the target gene and fusing the same through SOE PCR;

4) Electrotransferring the plasmid obtained in the step 2) and the homologous arm fragment obtained in the step 3) into the strain obtained in the step 1), and carrying out double resistance screening on spectinomycin (50 mug/mL) and kanamycin to obtain positive clones;

5) Obtaining engineering strains knocking out target genes through PCR screening;

6) The pTarget plasmid and pCas plasmid were deleted.

Thus, gene knockout on the genome of the escherichia coli TAK strain, which participates in regulation of lipopolysaccharide synthesis and modification related enzyme synthesis, is carried out by CRISPR-Cas9 gene editing technology (AEM 2015,8, 2506-14), so that a low endotoxin escherichia coli prokaryotic expression system CleanTAK series engineering strain is obtained. The low endotoxin escherichia coli prokaryotic expression system CleanTAK series engineering strains lack lpxP, lpxL, lpxM, pagP genes for regulating and controlling synthesis of lipid A fatty acid chains, so that the lipid A structure of the engineering strains is changed into a structure containing 4 fatty acid chains; in addition, it does not contain the gutQ gene involved in the synthesis of Kdo molecules, the eptA gene modified by phosphate groups, so that the engineering strain can only synthesize the Lipid IVA molecule without endotoxin activity.

The coding gene of the lipopolysaccharide transporter MsbA is subjected to point mutation in the strain with the gene deletion, so that the engineering strain with the Kdo molecule deletion can grow normally, and meanwhile, the synthesized lipopolysaccharide molecule has the characteristics of low toxicity, easiness in removal and the like.

Example 1

The low endotoxin escherichia coli subjected to high-density fermentation is subjected to gene knockout on the escherichia coli TAK strain genome which participates in regulation of lipopolysaccharide synthesis and modification related enzyme synthesis by a CRISPR-Cas9 gene editing technology to obtain CleanTAK series of engineering strains, and the method specifically comprises the following steps of:

2) Constructing pTarget plasmid expression targeting sgRNA;

6) The pTarget plasmid and pCas plasmid were deleted.

Further, taking eptA gene knockout as an example, the specific operation steps of construction of CleanTAK series engineering strains are as follows:

1. Transformation of pCas plasmid

Chemically competent cells of E.coli TAK strain were prepared, and pCas plasmid was transformed by heat shock transformation, plated onto LB plates containing 50. Mu.g/mL kanamycin, cultured overnight in a 30℃incubator, and single colony streaks were picked from the plates onto another new Canada resistant plate. The Snap Gene software is used to design amplification primers synthesized by the genes of the biological engineering (Shanghai) Limited company, and the sequences of the primers are as follows:

S-pCas-F:5’TATCGGCACAAATAGCGTCGGGATGG 3’

S-pCas-R:5’GCGCTAAGGCCAAATAGATTAAGCG 3’

Extracting the genome DNA of the streaked single colony as a template for PCR amplification verification, wherein the PCR amplification reaction is carried out in a 20 mu L system, and the reaction system is as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix, purchased from Novain (Nanjing) Biotech Co., ltd., 10. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and ddH ₂ O6. Mu.L. The amplification conditions were: after 5min of pre-denaturation at 94℃the cycle was entered with cycle parameters of 94℃30sec,53℃30sec,72℃30sec. After 30 cycles, the extension was carried out at 72℃for 10min. The amplified PCR product was analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment size was 450bp, which was comparable to the expected size. The positive transformants screened were designated TAK (pCas) and stored in a-80℃freezer.

2. Construction of pTarget-sgRNA-eptA recombinant plasmid

Searching 5'-NGG sequence in the 5' UTR region of eptA Gene sequence, taking 20bp upstream of NGG sequence as target sequence of sgRNA, designing the following primers containing 20bp and having 20-25bp homologous fragment with pTarget plasmid by using Snap Gene software, and synthesizing by biological engineering (Shanghai) limited company Gene:

eptA-sg-IF：

5’CTCTTTGAATTTACTCGCCGTTTTAGAGCTAGAAATAGCAAGTT 3’

eptA-sg-IR：5’TCGATGACGCCAACTACCTCTGATA 3’

eptA-sg-VF：5’TCAGAGGTAGTTGGCGTCATCGAGC 3’

eptA-sg-VR：

5’CAGGCGAGTAAATTCAAAGAACTAGTATTATACCTAGGACTGAGC 3’

The pTarget plasmid DNA was used as a template to construct an Insert (Insert) and a Vector (Vector) fragment of the recombinant plasmid by PCR amplification, respectively. The PCR amplification reaction was carried out in a 20. Mu.L system as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix, purchased from Novain (Nanjing) Biotech Co., ltd., 10. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and ddH ₂ O6. Mu.L. The amplification conditions were: after 5min of pre-denaturation at 94℃the cycle was entered with parameters of 94℃30sec,53℃insert20sec, vector 2min, 72℃30sec. After 30 cycles, the extension was carried out at 72℃for 10min. Amplified PCR products are analyzed by 0.8% agarose gel electrophoresis, and the amplified fragments are 290bp and 1770bp in size and are equivalent to expected sizes.

After purification and recovery of PCR, the resulting Insert and Vector fragments were ligated using a one-step cloning test kit purchased from Shanghai, the next holy company, typically using a 10. Mu.L reaction system, 5. Mu.L one-step cloning of recombinase premix, insert 3. Mu.L, vector 2. Mu.L. The reaction solution was placed on ice for 5min in a water bath at 50℃for 25min, then heat-shocked and transformed into E.coli DH 5. Alpha. Competent cells, which were plated on LB plates containing 50. Mu.g/mL spectinomycin, and incubated overnight in an incubator at 37 ℃. The following day single colonies were streaked onto another fresh spectinomycin resistant plate. The SnapGene software is used for designing amplification primers which are synthesized by genes of biological engineering (Shanghai) limited company, and the sequences of the primers are as follows:

S-sgRNA-F：5’CGACCGAGCGCAGCGAGTCA 3’

S-sgRNA-R：5’CATCTCGAACCGACGTTGCT 3’

Extracting the genome DNA of the streaked single colony as a template for PCR amplification verification, wherein the PCR amplification reaction is carried out in a 20 mu L system, and the reaction system is as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix, purchased from Novain (Nanjing) Biotech Co., ltd., 10. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and ddH ₂ O6. Mu.L. The amplification conditions were: after 5min of pre-denaturation at 94℃the cycle was entered with cycle parameters of 94℃30sec,53℃30sec,72℃30sec. After 30 cycles, the extension was carried out at 72℃for 10min. The amplified PCR product was analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment size was 460bp, which was comparable to the expected size. The PCR product was sent to the biological engineering (Shanghai) Inc. for sequencing analysis, ensuring that the designed 20bp targeting sequence was constructed before the gRNA scaffold of the pTarget plasmid, successfully constructing the recombinant plasmid pTarget-sgRNA-eptA. And (5) preserving the screened positive transformants.

3. Amplification and fusion of eptA Gene upstream and downstream homology arms

Two pairs of fusion PCR primers are designed in a TAK genome sequence to amplify upper and lower homologous arms of eptA genes respectively, the amplified fragments are 400bp in size, the primers are synthesized by biological engineering (Shanghai) limited company, and the sequences of the primers are as follows:

eptA-up-F:5’AAAGAGTTCGGTCTGGTTTCTTCCG 3’

eptA-up-R:5’ATCAGAATTTCACGGTGTTTCCATCGAACAAAGTG 3’

eptA-down-F:5’AAACACCGTGAAATTCTGATTGTTGAAGACGATAC 3’

eptA-down-R:5’TTCAGCGTCAGATTGCCAACAATCA 3’

Extracting TAK strain genome DNA in logarithmic growth phase as template for PCR amplification verification, and the PCR amplification reaction is carried out in 20 mu L system as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix, purchased from Novain (Nanjing) Biotech Co., ltd., 10. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and ddH ₂ O6. Mu.L. The amplification conditions were: after 5min of pre-denaturation at 94℃the cycle was entered with cycle parameters of 94℃30sec,53℃30sec,72℃30sec. After 30 cycles, the extension was carried out at 72℃for 10min. The amplified PCR products were analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment size was 400bp, which was comparable to the expected size.

Fusion of upstream and downstream homology arms: 1 μl of each of the amplified upstream and downstream homology arms was added as a template for overlap extension PCR, and amplification was performed using primers eptA-up-F and eptA-down-R under the same amplification system as before, under conditions of 94℃for 5min of pre-denaturation, followed by cycling at 94℃for 30sec,53℃for 30sec, and 72℃for 1min. After 30 cycles, the extension was carried out at 72℃for 10min. The homology arm fusion fragment with the size of 800bp is obtained, and the PCR product is purified and recovered by using a PCR product purification kit purchased from Simer Feishul technology (China) Co.

4. Construction and identification of eptA Gene deletion engineering Strain

The constructed pTarget-sgRNA-eptA recombinant plasmid and the fused homology arm fragment are electrically transferred into an escherichia coli TAK (pCas) strain, coated on a plate with double resistance to spectinomycin and kanamycin, and placed in an incubator at 30 ℃ for overnight culture. Single colony is streaked on a new double-antibody plate for culture, and then genome is extracted as a template for PCR amplification verification, wherein the PCR amplification reaction is carried out in a20 mu L system, and the reaction system is as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix, purchased from Novain (Nanjing) Biotech Co., ltd., 10. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and ddH ₂ O6. Mu.L. The amplification conditions were: after 5min of pre-denaturation at 94℃the cycle was entered with cycle parameters of 94℃30sec,53℃30sec,72℃30sec. After 30 cycles, the extension was carried out at 72℃for 10min. The amplified PCR products were analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment size was 1000bp, which was comparable to the expected size. The primer sequences used were as follows:

U-eptA-F:5’CTGCGGGTTGCTTAGGTTCACTGGG 3’

U-eptA-R:5’TGTTGGTCGAGGGTTCATTGTCCCA 3’

The PCR product with the band size meeting the expectations is sent to a biological engineering (Shanghai) limited company for sequencing analysis, the sequencing result is compared with the TAK strain genome, the eptA gene is confirmed to be knocked out successfully, and the engineering strain is named CLEANTAK EPTA.

5. Plasmid elimination in CLEANTAK EPTA engineering strains

The CLEANTAK EPTA engineering strain containing pTarget and pCas double plasmids was transferred to 5mL of LB liquid medium containing Kan (50. Mu.g/mL) resistance, and then IPTG was added thereto at a final concentration of 1mmol/L to induce the expression of sgRNA on pCas plasmid, and cultured overnight at 30℃in a 180r/min shaker. Because sgRNA-pBR322 ori binds to Cas9 protein, the pTarget replication origin is cleaved and the pTarget plasmid cannot replicate normally, so the pTarget plasmid is lost. The overnight cultured strain was plated onto LB solid plates of 50. Mu.g/mL kanamycin, and single colonies were selected after culturing to be inoculated with Kan resistance alone and to verify successful elimination of the pTarget plasmid on plates containing both Spec and Kan resistance. Single colonies containing only pCas plasmid were selected and inoculated into 5mL LB medium and cultured overnight at 37℃in a 180r/min shaker. Since pCas plasmid is temperature sensitive plasmid, it can not replicate normally at 37 deg.c, so pCas plasmid is lost, and CLEANTAK EPTA engineering strain without plasmid is obtained. The strain without the pCas plasmid eliminated was stored at-80℃and designated CLEANTAK EPTA (pCas) and used to construct a double knockout engineering strain.

According to the method, the constructed target gene recombinant pTarget plasmid and the fused homologous arm fragments are electrically transferred into cells containing pCas plasmids of the previous gene deletion engineering strain. The CleanTAK 2 alpha, cleanTAK 3 alpha, cleanTAK4 alpha and CleanTAK alpha engineering strains are sequentially constructed, and the knocked-out genes of the strains are combined as follows:

CleanTAK 2a engineering strain: Δ eptA Δkdsd

CleanTAK 3a engineering strain: Δ eptA ΔkdsdΔ pagP

CleanTAK4 alpha engineering strain: Δ eptA ΔkdsdΔ pagP Δlpxl

CleanTAK 5a engineering strain: Δ eptA ΔkdsdΔ pagP ΔlpxlΔ lpxP

Still further, the PCR results of the engineering strain related identification of this example are shown in FIGS. 1A-E.

Example 2

Different from the above example 1, on the basis of CleanTAK a engineering strain, the constructed target gene recombinant pTarget plasmid and the fused homology arm fragment were electrically transferred into cells containing pCas plasmid of CleanTAK a engineering strain, and CleanTAK a engineering strain was constructed, and the knockout gene combination thereof was: Δ eptA ΔkdsdΔ pagP ΔlpxlΔ lpxP Δlpxm.

Still further, the engineering strain of this example has the identified PCR results shown in FIGS. 1A-F.

Example 3

Different from the above example 1, on the basis of CleanTAK 6 a engineering strain, the constructed target gene recombinant pTarget plasmid and the fused homology arm fragment were electrically transferred into cells containing pCas plasmid of CleanTAK a engineering strain, and CleanTAK 7 engineering strain was constructed, the knockout gene combination was: Δ eptA ΔkdsdΔ pagP ΔlpxlΔ lpxP ΔlpxmΔgutq.

Still further, the engineering strain construction of the present embodiment includes the following steps:

1. Construction of pTarget-sgRNA-msbA recombinant plasmid

The 5' -NGG sequence is closely found at the position to be mutated of the msbA gene, 31bp upstream of the NGG sequence is used as a targeting sequence of sgRNA, snapGene software is used for designing the following primers which contain 20bp and have 20-25bp homologous fragments with pTarget plasmid, and the primers are synthesized by genes of the engineering (Shanghai) limited company:

msbA-sg-IF：

5’GATCTGTTTTACCAAAGCCATCATCAAGAAGGTTTTAGAGCTAGAAATA GCAAGTT 3’

msbA-sg-IR：5’CGATCAACGGCACTGTTGCAAATAG 3’

msbA-sg-VF：5’CTATTTGCAACAGTGCCGTTGATCG 3’

msbA-sg-VR：

5’TTCTTGATGATGGCTTTGGTAAAACAGATCACTAGTATTATACCTAGGAC TGAGC 3’

The pTarget plasmid DNA was used as a template to construct an Insert (Insert) and a Vector (Vector) fragment of the recombinant plasmid by PCR amplification, respectively. Specific plasmid construction and verification experiment were performed as in the construction of pTarget-sgRNA-eptA recombinant plasmid.

2. Amplification and fusion of msbA gene point mutation site-containing fragments

Two pairs of fusion PCR primers are designed to amplify exogenous fragments required by msbA gene point mutation respectively, and the primers are synthesized by biological engineering (Shanghai) limited company, and the sequences of the primers are as follows:

msbA-S1-F:5’AAAAGTGGCACTCGCATCGG 3’

msbA-S1-R:

5’CGATCTGTTTTACCAAAGCCATCATCAAGAAGTGACTTAAG

GAGCGATAACATGAAGGT 3’

msbA-S2-F:

5’ACCTTCATGTTATCGCTCCTTAAGTCACTTCTTGATGATGG

CTTTGGTAAAACAGATCG 3’

msbA-S2-R:5’AAAACGCTTCGATACAACGC 3’

Wherein the msbA-S1-R and msbA-S2-F primers comprise a mutated base, i.e. the 35 th base is replaced by G/C to a/T.

Fusion of S1 and S2 fragments: 1 mu L of each of the amplified S1 and S2 fragments was added as a template for overlap extension PCR, and the primers msbA-S1-F and msbA-S2-R were used to amplify under the same amplification system as before, and the amplification conditions were 94℃for 5min and then the mixture was subjected to cycle at 94℃for 30sec,53℃for 30sec and 72℃for 1min. After 30 cycles, the extension was carried out at 72℃for 10min. The fusion fragment with the size of 800bp is obtained, the PCR product is sent to a biological engineering (Shanghai) limited company for sequencing analysis, the obtained fragment contains mutated bases, and the rest PCR product is purified and recovered by using a PCR product purification kit purchased from the Simer Feishul technology (China) limited company.

3. Construction and identification of msbA gene point mutation engineering strain

The constructed pTarget-sgRNA-msbA recombinant plasmid and the fused exogenous fragment are electrically transferred into an escherichia coli CleanTAK (pCas) strain, coated on a plate with double resistance to spectinomycin and kanamycin, and placed in a 30 ℃ incubator for overnight culture. Single colony is streaked on a new double-antibody plate for culture, and then genome is extracted as a template for PCR amplification verification, wherein the PCR amplification reaction is carried out in a 20 mu L system, and the reaction system is as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix, purchased from Novain (Nanjing) Biotech Co., ltd., 10. Mu.L, 1. Mu.L of the upstream primer, 1. Mu.L of the downstream primer, and ddH ₂ O6. Mu.L. The amplification conditions were: after 5min of pre-denaturation at 94℃the cycle was entered with cycle parameters of 94℃30sec,53℃30sec,72℃30sec. After 30 cycles, the extension was carried out at 72℃for 10min. The amplified PCR products were analyzed by 0.8% agarose gel electrophoresis, and the amplified fragment size was 1000bp, which was comparable to the expected size. The primer sequences used were as follows:

U-msbA-F:5’TAACGGGTAGAATATGCGGC 3’

U-msbA-R:5’CTGGCATTCCCATCATGTGA 3’

and (3) sending the PCR product with the strip size meeting the expectations to a biological engineering (Shanghai) limited company for sequencing analysis, comparing the sequencing result with the TAK strain genome, confirming that the msbA gene is successfully subjected to point mutation, and naming CleanTAK m of the engineering strain.

5. Plasmid elimination in CleanTAK m engineering strains

CleanTAK 7m engineering strain containing pTarget and pCas double plasmids was transferred to 5mL of LB liquid medium containing Kan (50. Mu.g/mL) resistance, and then IPTG was added thereto at a final concentration of 1mmol/L to induce sgRNA expression on pCas plasmid, and cultured overnight at 30℃in a 180r/min shaker. Because sgRNA-pBR322 ori binds to Cas9 protein, the pTarget replication origin is cleaved and the pTarget plasmid cannot replicate normally, so the pTarget plasmid is lost. The overnight cultured strain was plated onto LB solid plates of 50. Mu.g/mL kanamycin, and single colonies were picked after culturing and inoculated onto plates containing only Kan resistance and both Spec and Kan resistance, respectively, to verify successful elimination of the pTarget plasmid. Single colonies containing only pCas plasmid were selected and inoculated into 5mL LB medium and cultured overnight at 37℃in a 180r/min shaker. Since pCas plasmid is temperature sensitive plasmid, it can not replicate normally at 37 deg.c, so pCas plasmid is lost, and CleanTAK m engineering strain without plasmid is obtained.

Example 4

The example relates to the detection of whole cell endotoxin activity of E.coli CleanTAK series engineering strains. The method comprises the following steps:

The endotoxin activity detection method of the escherichia coli TAK strain and CleanTAK series engineering strains is as follows: each strain to be tested is inoculated in 5mL of LB liquid medium, cultured overnight at 37 ℃ with shaking, 300 mu L of the strain is inoculated in fresh 30mL of LB liquid medium, and cultured at 37 ℃ until OD ₆₀₀ is approximately equal to 0.7. Taking 4mL of each strain bacterial liquid, centrifuging at 5000rpm for 5min, discarding supernatant, re-suspending sediment with 4mL of drohent distilled water, centrifuging at 5000rpm for 5min again, and repeating for 3 times. After re-suspending and precipitating with 4mL of distilled water, 2mL of the bacterial suspension OD ₆₀₀ is measured by using a spectrophotometer, and each bacterial suspension is diluted and adjusted by taking the OD ₆₀₀ value as a reference of 0.52. 1mL of bacterial suspension of each strain is taken for ultrasonic crushing, the power is 90W, and the ultrasonic crushing is carried out for 10min. Centrifuging the solution after ultrasonic crushing for 30min at 8000 rpm. The supernatant was collected. The cell lysate supernatant of each strain was subjected to gradient dilution, and the whole cell endotoxin activity of each strain was detected using a bacterial endotoxin detection kit (endpoint chromogenic substrate method) purchased from Xinbei biochemical industry limited, fuzhou, the specific experimental method is shown in the specification and will not be described here. 200 mu L of endotoxin detection mixed solution is taken to be placed on an ELISA plate, absorbance is measured by using an ELISA instrument with the wavelength of 562nm, and the activity of endotoxin is calculated according to a standard curve.

The statistics of the whole cell endotoxin activity detection results of the engineering strains in examples 1 to 3 are shown in fig. 2, and along with the accumulation of the gene editing quantity, the endotoxin content of the obtained engineering strain also tends to be reduced, and the endotoxin content of the CleanTAK m strain is most obviously reduced by 96.39 percent compared with that of the wild TAK strain.

Example 5

The example relates to growth characteristics analysis of E.coli CleanTAK series engineering strains, and is specifically as follows:

Taking 100 mu L of frozen bacterial liquid of each strain of engineering strains CleanTAK4 alpha, cleanTAK 5 alpha, cleanTAK alpha, cleanTAK and CleanTAK m with obviously reduced endotoxin activity of a parent TAK strain, transferring the frozen bacterial liquid into 5mL of LB test tube culture medium, and culturing the frozen bacterial liquid in a shaking table at the temperature of 33 ℃ and at the speed of 220rpm for 15-16 hours. 1000. Mu.L of each of the above-mentioned bacterial solutions was transferred to 100mL of 1/2TB medium, and cultured at 33℃for 5-8 hours (the culture period was determined depending on the concentration of the shaking culture) in a shaker at 220 rpm. Setting the fermentation volume of a fermentation tank to 7L, and the formula of a culture medium: lactose 150g/L, yeast 15g/L, SM 6.5g/L. Transferring the bacterial liquid cultured by shaking into a fermentation tank, and setting fermentation parameters: the fermentation culture was carried out at a temperature of 33℃at a rotation speed of 650rpm, a aeration rate of 9.5L/min and a tank pressure of 0.02MPa, and at a fermentation pH of 6.7. OD ₆₀₀ and thallus content are measured every 3h in the fermentation process, a fermentation growth curve is drawn as shown in figure 3, the clearTAK4α, cleanTAK 5α and CleanTAK6α strains can grow at high density in a high-density fermentation tank, the CleanTAK strain in the example 3 is severely inhibited in growth due to lack of key genes synthesized by Kdo, and the growth state of the CleanTAK m strain obtained after msbA gene point mutation is improved.

Example 6

1. Purification of LipidA of E.coli CleanTAK series engineering strains

The parent TAK strain and engineering strains CleanTAK alpha, cleanTAK 6 alpha and CleanTAK m with remarkably reduced endotoxin activity and good growth characteristics are subjected to overnight activation culture, and then transferred into fresh 200mL LB culture medium at the ratio of 1:100 in the next day, and cultured at 37 ℃ and 180r/min until the OD ₆₀₀ is between 0.8 and 0.9. The cells were collected by centrifugation at 4℃for 10 minutes, washed once with phosphate buffer, and precipitated with 20mL of phosphoric acid, chloroform methanol was added thereto, and the final ratio chloroform/methanol/water=1:2:0.8 (v/v) to form a Bligh/Dyer single-phase system. The bacterial suspension was shaken for 1 hour at room temperature, then centrifuged at 2500 Xg for 20 minutes to remove the upper layer containing the phospholipids, the pellet was resuspended in 40mL of single phase Bligh/Dyer, transferred to a 50mL centrifuge tube, the supernatant was discarded by centrifugation, the pellet was air dried and resuspended in 25mL of 50mM sodium acetate solution, pH4.5 (shake and sonicated to solution), the pH was adjusted to 4.5 if necessary using acetic acid, and then released in a boiling water bath for 30 minutes LipidA. After shaking cooling, the solution was transferred to a centrifuge tube, chloroform methanol was added to a volume ratio chloroform/methanol/water=2:2:1.8 to form a Bligh/Dyermixture biphasic system, lipidA was extracted with full vigorous shaking, then 2500×g was centrifuged at 20 ℃ for 20 min to form two phases, the lower phase (chloroform organic phase) was carefully collected into a round bottom flask, an equal amount of chloroform was added to the centrifuge tube again to form two phases, after centrifugation the lower phase was carefully sucked into the same round bottom flask, chloroform was removed by rotary evaporation, the sample was dissolved in chloroform/methanol=2:1 (v/v), transferred to a small centrifuge tube and dried under a lid of-80 ℃.

2. ESI/MS analysis of LipidA of Clean TAK series engineering Strain

Mass spectrometric detection of all samples was performed on a WATERS G2-XS Qtof high resolution mass spectrometer. Purified lipid a was dissolved in chloroform: methanol=2:1 (v/v). And adopting an ESI ion source and a cation detection mode, wherein the detection range is smaller than m/z 2500, and nitrogen is used as collision gas. The final results are shown in fig. 4, and the results show that the lipid A structure of the escherichia coli TAK strain can be successfully modified after a series of gene knockouts such as eptA, kdsD and the like are performed, and the change of the lipid A structure reduces the endotoxin activity of the engineering strain, is consistent with the detection result of the embodiment 4, and lays a theoretical foundation for the application of the subsequent engineering strain with low endotoxin activity.

Example 7

The embodiment relates to CleanTAK series engineering strain protein expression capacity analysis, which comprises the following specific steps:

The pEINGL expression plasmid is transformed into engineering strains of escherichia coli TAK, clearTAK 5 alpha, cleanTAK 6 alpha and CleanTAK m, and activation is transferred into a lactose-containing 1/2TB culture medium to induce the expression of proinsulin glargine protein. Respectively concentrating a proper amount of bacterial liquid until the OD ₆₀₀ is 20, and uniformly mixing; taking 40 mu L of each sample, adding 10 mu Lbuffer, uniformly mixing, and boiling in boiling water for 5min; the mixture was centrifuged at 12000rpm for 5 minutes in a table centrifuge, and a 14% sodium dodecyl sulfate-polyacrylamide gel was prepared for electrophoresis observation, and the electrophoresis result of SDS-PAGE showed that: compared with the parent strain TAK, the CleanTAK alpha engineering strain, the CleanTAK 6 alpha engineering strain and the CleanTAK 7m engineering strain have no obvious difference in protein expression capacity.

Sequence listing

Sequence Listing

eptA

1

1644

DNA

Escherichia coli str.K-12substr.MG1655

1atgttgaagc gcctactaaa aagaccctct ttgaatttac tcgcctggct attgttggcc

61gctttttata tctctatctg cctgaatatt gcctttttta aacaggtgtt gcaggcgctg

121ccgctggatt cgctgcataa cgtactggtt ttcttgtcga tgccggtcgt cgctttcagc

181gtgattaata ttgtcctgac actaagctct ttcttatggc ttaatcgacc actggcctgc

241ctgtttattc tggttggcgc ggctgcacaa tatttcataa tgacttacgg catcgtcatc

301gaccgctcga tgattgccaa tattattgat accactccgg cagaaagtta tgcgctgatg

361acaccgcaaa tgttattaac gctgggattc agcggcgtgc ttgctgcgct gattgcctgc

421tggataaaaa tcaaacctgc cacctcgcgt ctgcgcagtg ttcttttccg tggagccaat

481attctggttt ctgtactact gattttgctg gtcgccgcac tgttttataa agactacgcc

541tcgttgttcc gcaataacaa agagctggtg aaatccttaa gcccctctaa cagcattgtt

601gccagctggt catggtactc ccatcagcga ctggcaaatc tgccgctggt gcgaattggt

661gaagacgcgc accgcaaccc gttaatgcag aacgaaaaac gtaaaaattt gaccatcctg

721attgtcggcg aaacctcgcg ggcggagaac ttctccctca acggctaccc gcgtgaaact

781aacccgcggc tggcgaaaga taacgtggtc tatttcccta ataccgcatc ttgcggcacg

841gcaacggcag tttcagtacc gtgcatgttc tcggatatgc cgcgtgagca ctacaaagaa

901 gagctggcac agcaccagga aggcgtgctg gatatcattc agcgagcggg catcaacgtg

961 ctgtggaatg acaacgatgg cggctgtaaa ggtgcctgcg accgcgtgcc tcaccagaac

1021 gtcaccgcgc tgaatctacc tgatcagtgc atcaacggcg aatgctatga cgaagtgctg

1081 ttccacgggc ttgaagagta catcaataac ctgcaaggtg atggcgtgat tgtcttacac

1141 accatcggca gccacggtcc gacctattac aaccgctatc cgcctcagtt caggaaattt

1201 accccaacct gcgacaccaa tgagatccag acctgtacca aagagcaact ggtgaacact

1261 tacgacaaca cgctggttta cgtcgactat attgttgata aagcgattaa tctgctgaaa

1321 gaacatcagg ataaatttac caccagcctg gtttatcttt ctgaccacgg tgaatcgtta

1381 ggtgaaaatg gcatctatct gcacggtctg ccttatgcca tcgccccgga tagccaaaaa

1441 caggtgccga tgctgctgtg gctgtcggag gattatcaaa aacggtatca ggttgaccag

1501 aactgcctgc aaaaacaggc gcaaacgcaa cactattcac aagacaattt attctccacg

1561 ctattgggat taactggcgt tgagacgaag tattaccagg ctgcggatga tattctgcaa

1621 acttgcagga gagtgagtga atga

KdsD

2

987

DNA

Escherichia coli str.K-12 substr.MG1655

1 atgtcgcacg tagagttaca accgggtttt gactttcagc aagcaggtaa agaagtcctg

61 gcgattgaac gtgaatgcct ggcggagctt gatcaataca tcaatcagaa tttcacgctt

121 gcctgtgaaa agatgttctg gtgtaaaggg aaagttgtcg tcatggggat gggaaaatcg

181 gggcatattg ggcgaaaaat ggcggcaacg tttgccagca ccggtacacc ttcatttttc

241 gtccatcctg gtgaagccgc gcatggtgat ttaggcatgg ttaccccaca ggatgtggtg

301 attgctatct ctaactctgg tgaatccagc gaaatcacgg ccttaattcc agtgcttaag

361 cgtcttcacg taccgttaat ctgcatcacc ggtcgcccgg agagcagcat ggcgcgcgcc

421 gcagatgtgc atctgtgtgt taaagtagcg aaagaagcct gtccgttagg gctggcaccg

481 accagcagca ccaccgccac gctggttatg ggcgatgccc tcgctgtcgc gctgttaaaa

541 gcacgcggct ttactgctga agattttgcg ctctcacacc caggcggcgc actgggtcgt

601 aaacttctgc tgcgcgtaaa cgatattatg catacgggcg atgagatccc gcatgttaag

661 aaaacggcca gtctgcgtga cgcgttgctg gaagttaccc gcaaaaatct tggtatgact

721 gtcatttgcg atgacaatat gatgattgaa ggcatcttta ccgacggtga tttacgccgt

781 gtcttcgata tgggcgtgga tgttcgtcag ttaagtattg ccgatgtgat gacgccgggg

841 ggaatacgtg tgcgccctgg cattctggcc gttgaggcac tgaacttaat gcagtcccgc

901 catatcacct ccgtgatggt tgccgatggc gaccatttac tcggtgtgtt acatatgcat

961 gatttactgc gtgcaggcgt agtgtaa

pagP

3

561

DNA

Escherichia coli str.K-12 substr.MG1655

1 atgaacgtga gtaaatatgt cgctatcttt tcctttgttt ttattcagtt aatcagcgtt

61 ggtaaagttt ttgctaacgc agatgagtgg atgacaacgt ttagagaaaa tattgcacaa

121 acctggcaac agcctgaaca ttatgattta tatattcctg ccatcacctg gcatgcacgt

181 ttcgcttacg acaaagaaaa aaccgatcgc tataacgagc gaccgtgggg tggcggtttt

241 ggcctgtcgc gttgggatga aaaaggaaac tggcatggcc tgtatgccat ggcatttaag

301 gactcgtgga acaaatggga accgattgcc ggatacggat gggaaagtac ctggcgaccg

361 ctggcggatg aaaattttca tttaggtctg ggattcaccg ctggcgtaac ggcacgcgat

421 aactggaatt acatccctct cccggttcta ctgccattgg cctccgtggg ttatggccca

481 gtgacttttc agatgaccta cattccgggt acctacaaca atggcaatgt gtactttgcc

541 tggatgcgct ttcagttttg a

lpxL

4

921

DNA

Escherichia coli str.K-12 substr.MG1655

1 atgacgaatc tacccaagtt ctccaccgca ctgcttcatc cgcgttattg gttaacctgg

61 ttgggtattg gcgtactttg gttagtcgtg caattgccct acccggttat ctaccgcctc

121 ggttgtggat taggaaaact ggcgttacgt tttatgaaac gacgcgcaaa aattgtgcat

181 cgcaacctgg aactgtgctt cccggaaatg agcgaacaag aacgccgtaa aatggtggtg

241 aagaatttcg aatccgttgg catgggcctg atggaaaccg gcatggcgtg gttctggccg

301 gaccgccgaa tcgcccgctg gacggaagtg atcggcatgg aacacattcg tgacgtgcag

361 gcgcaaaaac gcggcatcct gttagttggc atccattttc tgacactgga gctgggtgcg

421 cggcagtttg gtatgcagga accgggtatt ggcgtttatc gcccgaacga taatccactg

481 attgactggc tacaaacctg gggccgtttg cgctcaaata aatcgatgct cgaccgcaaa

541 gatttaaaag gcatgattaa agccctgaaa aaaggcgaag tggtctggta cgcaccggat

601 catgattacg gcccgcgctc aagcgttttc gtcccgttgt ttgccgttga gcaggctgcg

661 accacgaccg gaacctggat gctggcacgg atgtccggcg catgtctggt gcccttcgtt

721 ccacgccgta agccagatgg caaagggtat caattgatta tgctgccgcc agagtgttct

781 ccgccactgg atgatgccga aactaccgcc gcgtggatga acaaagtggt cgaaaaatgc

841 atcatgatgg caccagagca gtatatgtgg ttacaccgtc gctttaaaac acgcccggaa

901 ggcgttcctt cacgctatta a

lpxP

5

921

DNA

Escherichia coli str.K-12 substr.MG1655

1 atgtttccac aatgcaaatt ttcccgcgag tttctacatc ctcgctactg gctcacatgg

61 tttgggcttg gtgtactctg gctttgggta cagcttcctt atcctgttct ctgctttctc

121 ggcacgcgta ttggcgcaat ggcgcgacca ttcctgaaac gtcgtgaatc tatcgcccgt

181 aaaaacctgg aactttgttt cccgcagcat tctgcggaag aacgcgagaa gatgattgcc

241 gaaaactttc gttcactcgg catggcgctg gtagaaaccg gcatggcatg gttctggccc

301 gacagtcgcg tacgtaaatg gtttgatgtt gaagggttgg ataaccttaa acgcgcacaa

361 atgcaaaatc gcggcgtaat ggttgtcggc gtccatttta tgtcgctgga actgggcggc

421 cgcgtgatgg gactgtgcca accaatgatg gctacctatc gtccacataa taatcagctg

481 atggaatggg tgcagacccg tgggcgcatg cgctctaaca aagcgatgat cggcagaaat

541 aatctgcgcg gcattgtcgg tgcactgaag aaaggtgaag cggtatggtt tgctcccgat

601 caggattatg gtcgtaaagg cagctccttc gcgccgttct ttgcggtgga aaatgtcgcc

661 acaaccaatg gcacctatgt tctctcccgt ctctctggcg cagccatgtt gaccgtaacg

721 atggtaagaa aagcggatta cagcggatat cgtttgttca tcaccccaga gatggaaggc

781 tacccgacag atgaaaatca agccgctgcc tatatgaaca agattatcga gaaagagatc

841 atgcgcgcac cggagcagta cctctggatc caccgtcgct ttaaaacgcg cccggtggga

901 gaatcgtcgt tgtacattta a

lpxM

6

972

DNA

Escherichia coli str.K-12 substr.MG1655

1 atggaaacga aaaaaaataa tagcgaatac attcctgagt ttgataaatc ctttcgccac

61 ccgcgctact ggggagcatg gctgggcgta gcagcgatgg cgggtatcgc tttaacgccg

121 ccaaagttcc gtgatcccat tctggcacgg ctgggacgtt ttgccggacg actgggaaaa

181 agctcacgcc gtcgtgcgtt aatcaatctg tcgctctgct ttccagaacg tagtgaagct

241 gaacgcgaag cgattgttga tgagatgttt gccaccgcgc cgcaagcgat ggcaatgatg

301 gctgagttgg caatacgcgg gccggagaaa attcagccgc gcgttgactg gcaagggctg

361 gagatcatcg aagagatgcg gcgtaataac gagaaagtta tctttctggt gccgcacggt

421 tgggccgtcg atattcctgc catgctgatg gcctcgcaag ggcagaaaat ggcagcgatg

481 ttccataatc agggcaaccc ggtttttgat tatgtctgga acacggtgcg tcgtcgcttt

541 ggcggtcgtc tgcatgcgag aaatgacggt attaaaccat tcatccagtc ggtacgtcag

601 gggtactggg gatattattt acccgatcag gatcatggcc cagagcacag cgaatttgtg

661 gatttctttg ccacctataa agcgacgttg cccgcgattg gtcgtttgat gaaagtgtgc

721 cgtgcgcgcg ttgtaccgct gtttccgatt tatgatggca agacgcatcg tctgacgatt

781 caggtgcgcc caccgatgga tgatctgtta gaggcggatg atcatacgat tgcgcggcgg

841 atgaatgaag aagtcgagat ttttgttggt ccgcgaccag aacaatacac ctggatacta

901 aaattgctga aaactcgcaa accgggcgaa atccagccgt ataagcgcaa agatctttat

961 cccatcaaat aa

gutQ

7

966

DNA

Escherichia coli str.K-12 substr.MG1655

1 atgagtgaag cactactgaa cgcgggacgt cagacgttaa tgctggagtt gcaggaagca

61 agccgtttac cggaacgtct gggcgatgat tttgttcgcg ccgccaatat catcctgcac

121 tgtgaaggca aagtggtggt ttcgggaatt ggcaaatcgg gccacattgg taagaaaatc

181 gccgcaacgc ttgccagtac cggcactccg gctttttttg tccatccggc agaagcgctg

241 cacggcgatc tggggatgat cgaaagccgc gatgtgatgc tgtttatctc ttactccggt

301 ggcgcgaagg aactggatct gattattccg cgtctggaag ataaatctat cgcgctgctg

361 gcgatgaccg gcaaaccgac gtcaccgctg ggcctggcgg caaaagcggt gctggatatc

421 tccgtagaac gcgaagcctg cccgatgcac cttgcgccga cctccagcac cgtcaatacc

481 ctgatgatgg gtgacgcgct ggcgatggcg gtcatgcagg cgcgcggatt taatgaagaa

541 gattttgccc gctcccaccc agccggggca ctgggcgctc gcttgctgaa taaagtgcat

601 catctgatgc gccgtgacga tgccatccca caggtggcgt taaccgccag cgtgatggat

661 gcgatgctgg aactcagccg caccggtctg gggctggtgg cggtatgtga cgctcaacaa

721 caggtacaag gcgtctttac cgacggcgat ttacgtcgct ggctggttgg cggcggcgca

781 ctcaccacgc cagtcaatga agcgatgacg gtcggcggca ccacgttgca atcgcaaagt

841 cgcgccatcg acgccaaaga gatcctgatg aagcgcaaaa tcactgccgc accggtggtg

901 gatgaaaacg gcaaactcac cggcgcaata aacctgcagg atttctatca ggccgggatt

961 atttaa

MsbA

8

1749

DNA

Escherichia coli str.K-12 substr.MG1655

1 atgcataacg acaaagatct ctctacgtgg cagacattcc gccgactgtg gccaaccatt

61 gcgcctttca aagcgggtct gatcgtggcg ggcgtagcgt taatcctcaa cgcagccagc

121 gataccttca tgttatcgct ccttaagcca cttcttgatg atggctttgg taaaacagat

181 cgctccgtgc tggtgtggat gccgctggtg gtgatcgggc tgatgatttt acgtggtatc

241 accagctatg tctccagcta ctgtatctcc tgggtatcag gaaaggtggt aatgaccatg

301 cgtcgccgcc tgtttggtca catgatggga atgccagttt cattctttga caaacagtca

361 acgggtacgc tgttgtcacg tattacctac gattccgaac aggttgcttc ttcttcttcc

421 ggcgcactga ttactgttgt gcgtgaaggt gcgtcgatca tcggcctgtt catcatgatg

481 ttctattaca gttggcaact gtcgatcatt ttgattgtgc tggcaccgat tgtttcgatt

541 gcgattcgcg ttgtatcgaa gcgttttcgc aacatcagta aaaacatgca gaacaccatg

601 gggcaggtga ccaccagcgc agaacaaatg ctgaagggcc acaaagaagt attgattttc

661 ggtggtcagg aagtggaaac gaaacgcttt gataaagtca gcaaccgaat gcgtcttcag

721 gggatgaaaa tggtttcagc ctcttccatc tctgatccga tcattcagct gatcgcctct

781 ttggcgctgg cgtttgttct gtatgcggcg agcttcccaa gtgtcatgga tagcctgact

841 gccggtacga ttaccgttgt tttctcttca atgattgcac tgatgcgtcc gctgaaatcg

901 ctgaccaacg ttaacgccca gttccagcgc ggtatggcgg cttgtcagac gctgtttacc

961 attctggaca gtgagcagga gaaagatgaa ggtaagcgcg tgatcgagcg tgcgactggc

1021 gacgtggaat tccgcaatgt cacctttact tatccgggac gtgacgtacc tgcattgcgt

1081 aacatcaacc tgaaaattcc ggcagggaag acggttgctc tggttggacg ctctggttcg

1141 ggtaaatcaa ccatcgccag cctgatcacg cgtttttacg atattgatga aggcgaaatc

1201 ctgatggatg gtcacgatct gcgcgagtat accctggcgt cgttacgtaa ccaggttgct

1261 ctggtgtcgc agaatgtcca tctgtttaac gatacggttg ctaacaacat tgcttacgca

1321 cggactgaac agtacagccg tgagcaaatt gaagaagcgg cgcgtatggc ctacgccatg

1381 gacttcatca ataagatgga taacggtctc gatacagtga ttggtgaaaa cggcgtgctg

1441 ctctctggcg gtcagcgtca gcgtattgct atcgctcgag ccttgttgcg tgatagcccg

1501 attctgattc tggacgaagc tacctcggct ctggataccg aatccgaacg tgcgattcag

1561 gcggcactgg atgagttgca gaaaaaccgt acctctctgg tgattgccca ccgcttgtct

1621 accattgaaa aggcagacga aatcgtggtc gtcgaggatg gtgtcattgt ggaacgcggt

1681 acgcataacg atttgcttga gcaccgcggc gtttacgcgc aacttcacaa aatgcagttt

1741 ggccaatga

Claims

1. The low endotoxin escherichia coli subjected to high-density fermentation is characterized by being classified and named ESCHERICHIA COLI CLEANTAK M and preserved in China Center for Type Culture Collection (CCTCC) M20221906, wherein the preservation time is 2022 and 12 months 09;

On the basis of CleanTAK 6 alpha engineering strains, the constructed target gene recombinant pTarget plasmids and fused homology arm fragments are electrically transferred into cells containing pCas plasmids of CleanTAK 6 alpha engineering strains, cleanTAK engineering strains are constructed, and the knockout gene combination is as follows: Δ eptA ΔkdsdΔ pagP ΔlpxlΔ lpxP ΔlpxmΔgutq;

CleanTAK 6 alpha is an engineering strain for knocking out eptA, kdsD, pagP, lpxL, lpxP and lpxM genes;

the construction of CleanTAK m engineering strain comprises the following steps:

1) Construction of pTarget-sgRNA-msbA recombinant plasmid:

The 5' -NGG sequence is closely searched at the position to be mutated of the msbA gene, 31bp upstream of the NGG sequence is used as a targeting sequence of sgRNA, and the following primers which contain 20bp and have 20-25bp homologous fragments with pTarget plasmid are designed:

msbA-sg-IF：

5’GATCTGTTTTACCAAAGCCATCATCAAGAAGGTTTTAGAGCTAGAAATA GCAAGTT 3’

msbA-sg-IR：5’CGATCAACGGCACTGTTGCAAATAG 3’

msbA-sg-VF：5’CTATTTGCAACAGTGCCGTTGATCG 3’

msbA-sg-VR：

5’TTCTTGATGATGGCTTTGGTAAAACAGATCACTAGTATTATACCTAGGAC TGAGC 3’

Respectively carrying out PCR amplification by taking pTarget plasmid DNA as a template to construct an insert fragment and a carrier fragment of the recombinant plasmid;

2) Amplification and fusion of msbA gene point mutation site-containing fragments

Designing two pairs of fusion PCR primers to amplify exogenous fragments required by msbA gene point mutation respectively, wherein the sequences of the primers are as follows:

msbA-S1-F:5’AAAAGTGGCACTCGCATCGG 3’

msbA-S1-R:

5’CGATCTGTTTTACCAAAGCCATCATCAAGAAGTGACTTAAG

GAGCGATAACATGAAGGT 3’

msbA-S2-F:

5’ACCTTCATGTTATCGCTCCTTAAGTCACTTCTTGATGATGG

CTTTGGTAAAACAGATCG 3’

msbA-S2-R:5’AAAACGCTTCGATACAACGC 3’

wherein the msbA-S1-R and msbA-S2-F primers comprise a mutated base, i.e., the 35 th base is replaced by G/C to a/T;

Fusion of S1 and S2 fragments: adding 1 mu L of each of the amplified S1 and S2 fragments as a template of overlap extension PCR, and amplifying the fragments by using primers msbA-S1-F and msbA-S2-R under an amplification system to obtain fusion fragments;

3) Construction and identification of msbA gene point mutation engineering strain

Electrotransferring the constructed pTarget-sgRNA-msbA recombinant plasmid and the fused exogenous fragment into an escherichia coli CleanTAK (pCas) strain, coating the strain onto a plate with double resistance to spectinomycin and kanamycin, and placing the plate in a 30 ℃ incubator for overnight culture; single colony is streaked on a new double-antibody plate for culture, and then genome is extracted as a template for PCR amplification verification, wherein the PCR amplification reaction is carried out in a 20 mu L system, and the reaction system is as follows: template DNA 2. Mu.L, 2 XHi-Fi DNase premix 10. Mu.L, upstream primer 1. Mu.L, downstream primer 1. Mu.L, ddH ₂ O6. Mu.L; the primer sequences used were as follows:

U-msbA-F:5’TAACGGGTAGAATATGCGGC 3’

U-msbA-R:5’CTGGCATTCCCATCATGTGA 3’

Sequencing and analyzing the PCR product with the strip size meeting the expectation, comparing the sequencing result with the TAK strain genome, confirming successful point mutation of the msbA gene, and naming the engineering strain as CleanTAK m;

4) Elimination of plasmids in CleanTAK m engineering strains

CleanTAK 7m engineering strain containing pTarget and pCas double plasmids is transferred into 5mL LB liquid medium containing Kan (50 mug/mL) resistance, then IPTG with a final concentration of 1mmol/L is added to induce the expression of sgRNA on pCas plasmid, and the mixture is cultured overnight in a shaking table at 30 ℃ and 180r/min, thus obtaining CleanTAK m engineering strain without plasmid.

2. Use of the low endotoxin e.coli as claimed in claim 1 for expression of protein/polypeptide substances.

3. Use of the low endotoxin e.coli as claimed in claim 1 for the preparation of an enzyme product.

4. Use of the low endotoxin e.coli as claimed in claim 1 for the preparation of plasmids.

5. Use of the low endotoxin e.coli of claim 1 for the preparation of secondary metabolites for the chassis of synthetic biology.