CN117586892A

CN117586892A - Genetically engineered bacterium for producing neotame B0 and preparation method and application thereof

Info

Publication number: CN117586892A
Application number: CN202210943983.7A
Authority: CN
Inventors: 吴燕; 邢丽彤; 王舒; 田振华
Original assignee: Yikelai Biotechnology Group Co ltd
Current assignee: Yikelai Biotechnology Group Co ltd
Priority date: 2022-08-05
Filing date: 2022-08-05
Publication date: 2024-02-23

Abstract

The invention discloses a genetic engineering bacterium for producing neotame B0, and a preparation method and application thereof. Wherein the genetically engineered bacterium overexpresses a gene encoding a non-ribosomal peptide synthetase; the NCBI accession number of the non-ribosomal peptide synthetase is XP_008078276.1. The genetically engineered bacterium provided by the invention overcomes the defects of lower synthesis yield and high production cost of the neotame B0 in the prior art. The production of the neotame B0 by using the genetically engineered bacterium has the advantages of high yield and low overall cost.

Description

Genetically engineered bacterium for producing neotame B0 and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a genetic engineering bacterium of neotame B0, and a preparation method and application thereof.

Background

Neotame B0 (pneumocandin B0) is a precursor of the echinocandin antifungal drug caspofungin (caspofungin). Echinocandins can inhibit the synthesis of fungal cell walls by non-competitively inhibiting beta-1, 3-D-glucan synthase activity in the fungal cell walls.

The pneumocandin B0 is a peptide ring composed of 6 amino acids of threonine, trans-4-hydroxyproline, 3, 4-dihydroxyhomotyrosine, 3-hydroxyglutamine, trans-3-hydroxyproline and 4, 5-dihydroxyornithine, and an ester peptide composed of 10, 12-dimethyl myristic acid is connected to the N-terminal of the amino acid residue of the 4, 5-dihydroxyornithine on the peptide ring.

Currently, filamentous fungus Glarea lozoyensis is an important industrial producer for the production of neotame B0.

In 2013, the Liu Xingzhong and An Zhijiang subject groups have found a cluster of genes synthesizing neotame Mo Kangding B0 on the basis of complete genome sequencing of g.lozoyensis ATCC20868 (neomo-kang A0 high-producing strain), and determined that the biosynthetic pathway of neomo-kang B0 is a polyketide synthase type I (polyketide synthase, PKS) -non-ribosomal peptide synthase (nonribosomal peptide synthetase, NRPS) hybrid pathway. The neotame B0 biosynthetic gene cluster is about 116kb in length and comprises polyketide synthase (GLPKS 4), non-ribosomal peptide synthase (GLNRPS 4), a high tyrosine synthase family (GLAREA 37-40), multiple oxidases P450, a zinc finger transcription factor (GLAREA 10050) and an ABC transporter (GLAREA 10036).

The biosynthesis of neotame B0 is mediated, assembled and modified via the PKS-NRPS system on the basis of 8 precursor molecules, ultimately synthesizing neotame Mo Kangding B0. The initial synthesis unit of neotame B0 is derived from acetyl CoA and completes a total of 7 polyketide chain extension cycles on the basis of the first acyl CoA, under PKS (GLPKS 4) catalysis, according to the type I PKS synthesis mechanism. The PKS comprises a methyltransferase that transfers methyl groups from methionine to polyketide intermediates during extension to form the two methyl side chains of 10, 12-dimethyl myristic acid. Because GLPKS4 lacks a Thioesterase (TE) domain, 10, 12-dimethyl myristoyl, which is located on the Acyl Carrier Protein (ACP) of the PKS, is reacted under GLHYD containing TE type II to form 10, 12-dimethyl myristic acid, which is released from the PKS as the free carboxylic acid. Free 10, 12-dimethyl myristic acid is converted to coa thioester form by acyl AMP ligase (GLligase, GLAREA 10043) and localizes to the thiolation (T) domain in the first module of GLNRPS4, which receives ornithine adenylated by the adenylation (a) domain, initiating hexapeptide extension. Threonine, 4-hydroxyproline, 3-hydroxyhomotyrosine, 3-hydroxyglutamine and 3-hydroxyproline are sequentially connected by a ribosome polypeptide synthesis mechanism to form peptide chains, and condensation (C) domains of NRPS cyclize the formed hexapeptide chains. And then 4-position of high tyrosine is hydroxylated by GLP450-1 and 4-position and 5-position of ornithine are hydroxylated by GLP450-2 to finally obtain the new knot Mo Kangding B0.

The production of the neotame B0 involves removal of impurity neotame C0, and the document CRISPR/Cas9-Based Genome Editing in the Filamentous Fungus Glarea lozoyensis and Its Application in Manipulating gloF discloses a method for modifying a strain G.lozoyensis SIPI1208 by using a CRISPR/Cas9 gene editing technology, wherein a GloF gene is knocked out and replaced by an Ap-HtyE gene, so that a new strain is obtained, and the new strain can be used for producing the neotame B0 to well avoid the generation of impurity neotame C0. However, no studies have been made on other key genes in the neotame B0 producing strain, such as GloA, gloD, gloL. Wherein GloA, gloD and GloL in the G.lozoyensis SIPI1208 gene cluster correspond to GLNRPS4 (non-ribosomal peptide synthase, nonribosomal peptide synthetase), GLligase (acyl-CoA synthase) and GLPKS4 (polyketide synthase ), respectively, in G.lozoyensis ATCC 20868.

Thus, the study of other key genes in the strain producing neotame B0 is also particularly important for the yield enhancement of neotame B0.

Disclosure of Invention

The invention aims to overcome the defects of low synthesis yield and high production cost of the neotame B0 in the prior art, and provides a genetic engineering bacterium, a preparation method thereof and application thereof in preparing the neotame B0. The production of the neotame B0 by using the genetically engineered bacterium has the advantages of high yield and low overall cost.

In order to solve the technical problems, the invention provides a genetically engineered bacterium, the original strain of which is filamentous fungi Glarea lozoyensis, and the genetically engineered bacterium overexpresses a gene for encoding non-ribosomal peptide synthetase; the NCBI accession number of the non-ribosomal peptide synthetase is XP_008078276.1.

In certain embodiments, the NCBI accession number of the gene encoding the non-ribosomal peptide synthetase is xm_008080085.1; and/or, the filamentous fungus Glarea lozoyensis is g.lozoyensis ATCC 20868.

Preferably, the overexpression is by using a strong promoter to overexpress a gene encoding a non-ribosomal peptide synthase in the genome of the filamentous fungus Glarea lozoyensis;

the strong promoter is selected from gpd promoter or Tef1 promoter; the nucleotide sequence of the gpd promoter is shown as SEQ ID NO. 4; the nucleotide sequence of the Tef1 promoter is shown as SEQ ID NO. 6.

In certain embodiments, the strong promoter is integrated on the genome of g.lozoyensis ATCC20868 and overexpresses the gene encoding the non-ribosomal peptide synthetase.

Preferably, the integration is by replacing the pro-promoter of the gene encoding the non-ribosomal peptide synthetase in the genome with the strong promoter.

In a second aspect, the present invention provides a method for preparing a genetically engineered bacterium according to the first aspect of the present invention, the method comprising the steps of: transforming a plasmid or linear fragment containing a strong promoter into a filamentous fungus Glarea lozoyensis cell, and replacing the original promoter of a gene encoding a non-ribosomal peptide synthase in the genome with the strong promoter to obtain a genetically engineered bacterium over-expressing the gene encoding the non-ribosomal peptide synthase; the strong promoter is selected from gpd promoter or Tef1 promoter; the nucleotide sequence of the gpd promoter is shown as SEQ ID NO. 4; the nucleotide sequence of the Tef1 promoter is shown as SEQ ID NO. 6.

Preferably, the replacement is performed using CRISPR/Cas9 gene editing techniques.

In certain embodiments, the filamentous fungus Glarea lozoyensis has its cell wall digested by an enzymatic solution that lyses the cell wall prior to the transformation.

Preferably, the enzyme solution comprises one or more of filamentous fungal cell wall lytic enzyme (Yatalase), lywallase (lyicase), cellulase (cellulose).

More preferably, the enzyme solution includes: 2% filamentous fungal cell wall lytic enzyme, 3% lywallase, 1% cellulase, the% being g/100mL.

The third aspect of the present invention provides a method for preparing neotame B0, comprising: fermenting under the condition suitable for culturing the genetically engineered bacterium according to the first aspect of the invention. Preferably, the preparation method is to transfer the seed culture medium to a fermentation culture medium for fermentation after culturing the seed culture medium.

More preferably, the seed medium comprises cottonseed meal, mannitol, KH ₂ PO ₄ Glucose, mgSO ₄ ·7H ₂ O, chloramphenicol, wherein the fermentation medium comprises soybean oil, glucose, mannitol, cotton seed cake powder, soybean protein concentrate, compound nitrogen source, proline, potassium dihydrogen phosphate, chloramphenicol, and/or,

the temperature of the cultivation and fermentation is 21-28 ℃, e.g. 24 ℃, and/or,

the cultivation is carried out in shaking at a rotational speed of 200-250rpm, for example 220rpm, and/or,

the duration of the incubation is from 5 to 10 days, for example from 5 to 7 days, and/or,

the duration of the fermentation is 15-25 days, for example 20 days.

Even more preferably, the seed culture medium comprises cotton seed cake flour 25g/L, mannitol 50g/L, KH ₂ PO ₄ 4g/L, glucose 10g/L, mgSO ₄ ·7H ₂ 0.1g/L of O and 0.1g/L of chloramphenicol, wherein the fermentation medium comprises 8g/L of soybean oil, 9g/L of glucose, 110g/L of mannitol, 9g/L of cottonseed meal, 9g/L of soybean protein concentrate, 3.5g/L of compound nitrogen source, 10g/L of proline, 8.5g/L of monopotassium phosphate and 0.1g/L of chloramphenicol.

In a fourth aspect, the invention provides an expression cassette comprising a promoter, a gene encoding a non-ribosomal peptide synthetase, and a terminator;

the promoter is selected from gpd promoter or Tef1 promoter; such as the gpd promoter;

the nucleotide sequence of the gpd promoter is shown as SEQ ID NO. 4;

the nucleotide sequence of the Tef1 promoter is shown as SEQ ID NO. 6;

the NCBI accession number of the gene encoding the non-ribosomal peptide synthetase is XM_008080085.1.

Wherein the terminator is a prototerminator of a gene encoding the non-ribosomal peptide synthetase in the genome of g.lozoyensis ATCC 20868.

In a fifth aspect the present invention provides a recombinant plasmid comprising an expression cassette according to the fourth aspect of the present invention; preferably, the backbone plasmid of the recombinant plasmid is pUC57 plasmid.

In a sixth aspect, the invention provides a recombinant plasmid combination comprising a Cas9 expression plasmid, an sgRNA plasmid, and a recombinant plasmid according to the fifth aspect of the invention; the linear fragments of Cas9 expression plasmid and sgRNA plasmid are used in the genome of a producer of neotame B0 to homologous recombine the expression cassette according to the fourth aspect of the invention;

preferably, the backbone plasmid of the Cas9 expression plasmid is a pFC333 plasmid and/or the backbone plasmid of the sgRNA plasmid is a pUC57 plasmid; and/or the expression cassette is in the recombinant plasmid according to the fifth aspect of the invention and linearization of the recombinant plasmid prior to homologous recombination takes place.

In a seventh aspect, the invention provides the use of a genetically engineered bacterium according to the first aspect of the invention or an expression cassette according to the fourth aspect of the invention or a recombinant plasmid according to the fifth aspect of the invention or a recombinant plasmid combination according to the sixth aspect of the invention for the preparation of pneumocandin B0.

On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention.

The reagents and materials used in the present invention are commercially available.

The invention has the positive progress effects that:

the improvement of the expression quantity of GloA by the regulation and control of the promoter is beneficial to the improvement of the B0 yield. Compared with the wild strain, the fermentation yield of the neotame B0 of the genetically engineered bacterium provided by the invention is improved by 16-37.4%, and in a preferred embodiment, the fermentation yield is improved by 37.4%.

Drawings

FIG. 1 shows the map of the plasmid pUC 57-gpd-GloA.

FIG. 2 is a map of the plasmid pUC 57-gpd-GloD.

FIG. 3 is a map of the plasmid pUC 57-gpd-GloL.

FIG. 4 is a map of plasmid pUC57-5 sRNA-GloA.

FIG. 5 is a map of plasmid pUC57-5 sRNA-GloD.

FIG. 6 is a map of plasmid pUC57-5 sRNA-GloL.

FIG. 7 is a map of plasmid pUC57-Tef 1-GloA.

FIG. 8 is a map of plasmid pUC57-Tef 1-GloD.

FIG. 9 is a map of plasmid pUC57-Tef 1-GloL.

FIG. 10 is a map of plasmid pAncas 9-02.

FIG. 11 shows a GLSg1.0 map of the plasmid.

FIG. 12 is a neomycin resistance gene Neo plasmid map.

FIG. 13 is a map of the NeoR Frame of the plasmid.

FIG. 14 is a map of plasmid GLSg2.0.

FIG. 15 is a map of plasmid pSg-GloA-01.

FIG. 16 shows a map of plasmid pSg-GloD-01.

FIG. 17 shows a map of plasmid pSg-GloL-01.

FIG. 18 is a graph of the detection of a standard of Neumokadam B0 with a peak time of 28.363min.

FIG. 19 is a HPLC detection chart of neotame B0 in fermentation broth when the gpd promoter regulates GloA expression in example 2.

Detailed Description

The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention.

The technical means adopted by the present invention and the effects thereof will be further described in detail below with reference to the accompanying drawings and preferred embodiments of the present invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.

TABLE 1

HPLC detection method of the neotame B0:

chromatographic column: YMC J' sphere ODS-M80 (4 μm, 250X 4.6 mm); mobile phase a:0.1% phosphoric acid aqueous solution; mobile phase B: acetonitrile; flow rate: 1.5ml/min; gradient elution procedure: 60% A+40% B (0.00 min), 60% A+40% B (20.00 min), 50% A+50% B (35.00 min), 1% A+99% B (45.00 min), 60% A+40% B (46.00 min), 60% A+40% B (56.00 min); column temperature: 30 ℃; sample injection amount: 10. Mu.L; detection wavelength: 210nm.

EXAMPLE 1 enhancement of expression of Critical Gene GloA, gloD, gloL

1.1 promoter optimized vector construction

In order to strengthen the expression of the key gene GloA, gloD, gloL, the invention selects gpd, 5sRNA and Tef 13 promoters to respectively carry out expression regulation and control on GloA, gloD, gloL, and constructs a pINSERT series sequence: pUC57-gpd-GloA/pUC57-gpd-GloD/pUC57-gpd-GloL, pUC57-5sRNA-GloA/pUC57-5sRNA-GloD/pUC57-5sRNA-GloL, pUC57-Tef1-GloA/pUC57-Tef1-GloD/pUC57-Tef1-GloL 9 plasmids.

Wherein, NCBI accession number of non-ribosomal peptide synthetase (nonribosomal peptide synthetase) is XP_008078276.1, NCBI accession number of GloA encoding gene is XM_008080085.1;

the acyl AMP ligase (acetyl-CoA sync) has NCBI accession number S3DB78.1, the GloD gene encoding NCBI accession number xm_008080093.1;

the polyketide synthase (polyketide synthase) enzyme has an NCBI accession number of S3D9F1.1 and the GloL gene encoding has an NCBI accession number of XM_008080084.1.

The gpd promoter sequence is shown below:

tgtcacttcgcgtctttgtctgttacacgatacagcaaactttaagaatgaacctttctggcggctcctaaatcaatgaaagacggactcggacccaatgaggccaacaacggaagttggtacgtttcagggccccaaagtatccttcgctccatgatatgaatgtctagatttagcgactctctaaccaagaatatctacggtctgacctagtgcagaacaatgtattcgtgaaaggaaagattgaaacattctgcggcagcaataaggcagctagttctactaacgttaaactgaaagcgaagggatttgaaagttgatgaacagttgtaagtgacacagtaaatccttaagagcctaagatatgatattgtggtttgaaagaagttatttttctatgtaagcacgtaaaacagcgaaagatcaaagactattgtggcattagatctttgttagaaagaagtacattttgtttggcgaagagatgtgagcataaaagggtgaatgaaagatgtatgaatggttgtccggcagaatcagatgtggatttctgctggtgaacccgtaagagaaagcctcacgtgtctcccgatcataaatccataacagttccaaaaaattcatgagcgcgagcgcgagcggcaataaatcagcttttttcaagattgtcacgagttatgaagccatgcaggtttccgagttttcaacacattctgttgtataatcatcgatgcatagcacgtgatttctggctcgaaagcaaacaagattgggaggctttgggcagctctttatctggcgagaaatctgaatgagaatgcttctcgtgcgaaagaataacgctgttggcaattagagggcgaattcagccacctgcaatgacaataggagcttagcttcaagtcagataaaaggcgtggggcgttatcgagaataagaaaagcccgaagatttggccggctgccgttaaatatttgtcaagcaaaaggcagggaatgagtgttactcatatggattgagggaataacactttgcaagaaggatgccatgcaatgagaaaagtctgaactacacgtggcggcgcaacgcaacgctccgcagttaggaggaggtttagctgacagcgcagtctggagacaccgagaggaaatgttcctgttgacgatggagcttccattttgaatcttcaaggggggttggtgttctggagtttgatattggtatggtcaggaccacgagaaacagattacctaggtaaagaataatagcttcgccgttcgaacgatagctcggttaaagaattacttccattctatccgaattatcgtggagtatctagttcctcatagcaccgtatctccccggcggctcggagcgagtcgcctgctcttaaagtgtgacgtgatggtgactctgctcactctgctcactctgctcactcctccagcctcatcgactgcaggtggtggtgagactgtattattgagagatttaaatctccgtcagcttttcctgatcatctggagcgaaaggaataaataaaaacttcgtaaagcgtaacgggaacacgattgcgcaggggcgcgaccggatgcacgataagatgagtgaggaagccaattgaggactcatccactccacgtcgagaaaaatcatcatctagtctgtggtgtttccagctggttggttgccagacagccttgtcgcagtgattgcttgcttggtttcggtggtcgtggtcgtggcttgcccctcttttccgtagcgtagcgcatcttcccatctcaacaacaccccaccacgagcacaaactctctcattttcgtctcgattcttcttccttcgacatcgtacgaaacaaccaacctaagaaaaacaatcaacgaaacatgtatgtatatccttccccatctgttcactctgccagtcgcccatcctctacatcgagaattcttgtcgctccttcgtcatcgcggggctaatcttcaccagaaaacaat(SEQ ID NO:4)

the 5sRNA promoter sequence is shown below:

gcttcatttgatcgatgttccaacacaaatgacactcgcctacgtattacaaccaactctctagcaactaactgccaaacactctatcgaacttagtcgagcagtccgtctgaagttgattcattaagagtaacagactgccttgaatctctcaactcagcatttaccaagaaagcgttctaaaatccgtaccacacgccgtcatttctgacataacttgaatcggcctcccatcacgtgacgcaccccgactcccttaacaaccgcacaagtcctcacacaccacaaccccctcaaccacacaaccacccttcttccaccaaaacacaatttccctacaaactcatatagctgtgtttgtgtttctctcatcacacccccccgctcttttttcagccctccagcgtcaactatataaatctaaaaccacccacctttgtcacatacgatcatagactgatgagaattgggcatcccgtccgctctgccacacacaagcatcagatcggtagattagtagttgggtgggtgaccaccagcgaatacctactgtcgtatg(SEQ ID NO:5)

the Tef1 promoter sequence is shown below:

cgagacagcagaatcaccgcccaagttaagcctttgtgctgatcatgctctcgaacgggccaagttcgggaaaagcaaaggagcgtttagtgaggggcaatttgactcacctcccaggcaacagatgaggggggcaaaaagaaagaaattttcgtgagtcaatatggattccgagcatcattttcttgcggtctatcttgctacgtatgttgatcttgacgctgtggatcaagcaacgccactcgctcgctccatcgcaggctggtcgcagacaaattaaaaggcggcaaactcgtacagccgcggggttgtccgctgcaaagtacagagtgataaaagccgccatgcgaccatcaacgcgttgatgcccagctttttcgatccgagaatccaccgtagaggcgatagcaagtaaagaaaagctaaacaaaaaaaaatttctgcccctaagccatgaaaacgagatggggtggagcagaaccaaggaaagagtcgcgctgggctgccgttccggaaggtgttgtaaaggctcgacgcccaaggtgggagtctaggagaagaatttgcatcgggagtggggcgggttacccctccatatccaatgacagatatctaccagccaagggtttgagcccgcccgcttagtcgtcgtcctcgcttgcccctccataaaaggatttcccctccccctcccacaaaattttctttcccttcctctccttgtccgcttcagtacgtatatcttcccttccctcgcttctctcctccatccttctttcatccatctcctgctaacttctctgctcagcacctctacgcattactagccgtagtatctgagcacttctcccttttatattccacaaaacataacacaaccttcacc(SEQ ID NO:6)

design primers, using KOD One ^TM PCR Master Mix, each fragment (left homology arm, gpd/5sRNA/Tef1 promoter, right homology arm, pUC plasmid backbone) was amplified according to the PCR system and conditions of Table 2, table 3. The constructed plasmid map is shown in figures 1-9.

TABLE 2 ordinary PCR reaction System (50. Mu.L)

Component (A)	Dosage of
		KOD OneTM PCR Master Mix	25μL
10 mu M primer F	2μL
		10 mu M primer R	2μL
Template	1-3μL(30-100ng)
		dd H2O	Add To 50μL

TABLE 3 ordinary PCR reaction procedure

Detecting and recovering: after detecting the size of the PCR band by agarose gel electrophoresis, the correct fragment was recovered using a SanPrep column type DNA gel recovery kit, and the concentration of the recovered product was detected.

Recombination: usingThe construction of each plasmid was carried out by high-fidelity DNA assembly premix, the recombination system is shown in Table 4, water bath is carried out at 50 ℃ for 15min, and the mixture is placed on ice after the reaction is finished.

Table 4 recombination System

Conversion: the recombinant product was added to competent BL21 and placed on ice for 30min and heat-shocked at 42℃for 90s. After the heat shock is finished, placing on ice for standing for 3-5min, adding 800 mu L of LB culture medium, and resuscitating for 45-60min at 37 ℃. After resuscitating, the mixture was centrifuged at 5000rpm for 3min, the supernatant was discarded, 100-200. Mu.L of resuspended cells were left, ampicillin-resistant plates (100. Mu.g/mL) were applied, and incubated overnight (16 h) at 37 ℃.

Sequencing: single colony is selected and cultured in LB test tube (A+), at 37 deg.C for 6-7 hr, 300 μL bacterial liquid is taken and sent to the biological sequencing of the Optimaceae family for bacterial protection. The sequencing results were analyzed and the correct plasmid for sequencing was extracted and stored at-80 ℃.

1.2 Construction of pAncas9-02 plasmid and sgRNA plasmid, amplification and acquisition of sgRNA, pInsert-DNA linearization fragment Taking out

Construction of Cas9 expression plasmid pAncas 9-02: in the construction process, primers, templates and the like are shown in Table 6, and each fragment is amplified and recombined in a plurality of fragments according to the same method as in example 1.1, and the plasmid with the correct construction is obtained after sequencing verification. The constructed plasmid map is shown in FIG. 10.

Construction of sgRNA, neoR Frame plasmid: plasmid GLSg1.0 (FIG. 11), neomycin resistance gene Neo plasmid (FIG. 12) was synthesized by gene synthesis company. NeoR Frame plasmid was constructed on the basis of Neo plasmid, see FIG. 13. Construction of the sgRNA plasmid GLSg2.0 containing the N20 sequence on the basis of the GLSg1.0 plasmid and the NeoR Frame plasmid is shown in FIG. 14. The sgRNA plasmids pSg-GloA-01, pSg-GloD-01 and pSg-GloL-01 containing different N20 sequences (Table 5) were constructed on the basis of the GLSg2.0 plasmid for GloA, gloD, gloL, see FIG. 15, FIG. 16 and FIG. 17, respectively. The amplification and multi-fragment recombination of each fragment was performed in the same manner as in example 1.1, and the correct construction of the sgRNA plasmid was obtained after sequencing verification.

TABLE 5 construction of sequences containing different N20 for GloA, gloD, gloL

Gene	N20 sequence	SEQ ID NO:
			GloA	AAGACCAAGCGGTACATGGC	1
GloD	AACCACGCGTATAGTGGGCA	2
			GloL	TCTGCGTTCTCTGCAAGGAG	3

TABLE 6 construction of pAncas9-02, sgRNA plasmids

Linearization of sgRNA/pINsert fragment: each linearized fragment was amplified using the primers and templates of Table 7, and the fragments were prepared and recovered as in example 1.1.

And (3) precipitation recovery: adding 1/10 volume of 3M sodium acetate into the recovered solution, uniformly mixing, adding equal volume of isopropanol, uniformly mixing, standing at-80 ℃ for 1h, melting on ice after white floccules appear, centrifuging at 4 ℃ for 5min at 13000rpm, and forming white precipitates at the bottom/wall of the tube. The supernatant was discarded and washed 2 times with 75% ethanol. After the supernatant is discarded for the last time, the supernatant is required to be centrifuged briefly, the 10 mu L gun head is used for sucking up ethanol as much as possible, and then the supernatant is dried in an ultra-clean bench, and a small amount of sterile water at 70 ℃ is used for redissolving and measuring the concentration for later use.

TABLE 7 sgRNA, pINSERT-DNA linearization amplification primers

1.3 protoplast preparation and transformation

(1) Culture medium and reagent:

potato dextrose agar (PDA medium): 40.1g/L,250mL Erlenmeyer flask.

YPG medium: yeast powder 10g/L, peptone 20g/L, glycerin 20g/L,150mL round bottom conical flask. The primary shake flask does not contain glass beads, and 6-8 large glass beads are added into the secondary shake flask.

KST Buffer:0.7M potassium chloride, 0.8M sorbitol, 20mM Tris-HCl (pH 6.8), pH adjusted to 5.8-6.4, and sterilized at 121℃for 15min.

STC Buffer:1.2M sorbitol, 5.5g/L CaCl ₂ ·H ₂ O,10mL of 1M Tris-HCl (pH 7.5), and sterilized at 121℃for 15min.

Protoplast regeneration medium: PDA media powder 10.25g, 0.8M sucrose was weighed into a 250mL Erlenmeyer flask, 250mL deionized water was added and autoclaved at 121℃for 15min.

(2) Preparing related antibiotics and mother liquor:

ampicillin antibiotics (Amp) ⁺ ): preparing mother solution of 100mg/mL, filtering and sterilizing.

Hygromycin antibiotics (Hyg) ⁺ ): preparing mother liquor 100mgand/mL, filtering and sterilizing.

G418 antibiotics (G418) ⁺ ): preparing mother solution of 100mg/mL, filtering and sterilizing.

Heparin: 10mg/mL of 10X mother liquor is prepared, filtered and sterilized.

60% peg4000:60g PEG4000 was dissolved in 20-40mL water, heated in a microwave oven to dissolve, and 1mL 1M Tris-HCl (pH 7.5) was added, followed by 5mL1M calcium chloride solution. And (3) when the solution is hot, the deionized water is fixed to 100mL, and the solution is sterilized for 15min at 121 ℃. Is left at room temperature to avoid precipitate formation.

(3) Protoplast preparation:

the glycerol bacteria producing the pneumocandin B0 strain ATCC20868 are inoculated to a potato dextrose agar (PDA culture medium) inclined plane, cultured for 7-10d at 24 ℃ and 60% humidity, and inoculated to YPG culture medium for culturing at 24 ℃ and 220rpm for 7-10d according to 1% inoculum size, inoculated to YPG culture medium for culturing at 24 ℃ and 220rpm for 6-10d according to 2% inoculum size, after the culturing is finished, liquid culture is obtained, mycelium is collected by centrifugation at 4000rpm for 20min at room temperature, the mycelium is resuspended in 40mL KST Buffer, evenly mixed, and centrifuged at 4000rpm for 20min at room temperature for two times, and mycelium is collected.

The collected mycelium is resuspended in 70-100mL STC Buffer, and the volume is fixed to a concentration of 0.5g/10mL. The reaction mixture was digested with lywallase solution (Yatalase: 2%, lyicase: 3%, cellulase:1%,% expressed as g/100 ml), 120rpm,30℃for 3.5 hours. The plasma body fluid was filtered, the filtrate was centrifuged at 4000rpm for 10min at 4 ℃, the supernatant was discarded, washed 1 pass with STC Buffer, and centrifuged at 4000rpm for 10min at 4 ℃ to remove the supernatant. The protoplast cells were resuspended using STC Buffer and the protoplast concentration was concentrated to 1.0 x 10 ⁷ And (3) obtaining a protoplast suspension of the strain ATCC20868 for producing the neotame B0.

(4) Conversion:

the pAncas9-02 plasmid, linearized sgRNA/pINsert fragment (10. Mu.g: 15. Mu.g), 10 Xheparin (degerming) were mixed in the same amount and left at room temperature for 10min; uniformly mixing G.lozoyensis protoplast competence with the mixture of the linear fragment and heparin, and standing for 15-20 min at room temperature; adding 1mL 60% PEG4000 (sterilized), mixing, and standing at room temperature for 20-25 min; 10mL of 1M sorbitol (sterilized) was added, mixed well, centrifuged at 4000rpm for 10min, the supernatant was discarded, and a proper volume (200-400. Mu.L) was left for coating. Coated with double antigen plasmid regenerated plate hygromycin 150 μg/mL+G41820 μg/mL, cultured at 24℃under 60% humidity for 7-15d. Successfully regenerated transformants were obtained.

The strain containing gpd promoter was obtained by verification: GLIS0501 (GloA), GLIS0502 (GloD), GLIS0503 (GloL); strains containing 5sRNA promoter: GLIS0601 (GloA), GLIS0602 (GloD), GLIS0603 (GloL); strains containing the Tef1 promoter: GLIS0701 (GloA), GLIS0702 (GloD), GLIS0703 (GloL).

Example 2 production of neotame B0 Using strains

2.1 preparation of inclined plane and preparation of first-order seed culture medium

Taking part of thalli in a strain tube, adding 1.5mL of 20% glycerol, 2-3 large glass beads, vortex oscillating, dispersing mycelium, sucking 250 μL of mycelium on a PDA inclined plane, covering the surface with liquid, and culturing at 24 ℃ and 60% humidity for 8-10d.

Preparing a first-stage seed culture medium, adjusting pH to 6.0 according to the formula shown in Table 8, and sterilizing at 121deg.C for 30min. The culture conditions were 24℃and 220rpm, and the culture was continued for 5-7 days.

TABLE 8 Primary seed culture medium for fermentation

Component (A)	Final concentration g/L
		Cottonseed cake powder	25
Mannitol (mannitol)	50
		KH ₂ PO ₄	4
Glucose	10
		MgSO ₄ ·7H ₂ O	0.1
Chloramphenicol	0.1

2.2 preparation of fermentation Medium

Fermentation media were prepared according to Table 9 and sterilized at pH of about 6.0,121 ℃for 30min. The fermentation inoculation amount is 10 percent. Culturing at 24deg.C for 20d, and sampling.

TABLE 9 fermentation Medium

Component (A)	Final concentration g/L
		Soybean oil	8
Glucose	9
		Mannitol (mannitol)	110
Cottonseed cake powder	9
		Soybean concentrateDepsipeptide	9
Composite nitrogen source	3.5
		Proline (proline)	10
Monopotassium phosphate	8.5
		Chloramphenicol	0.1

2.3 determination of the yield of neotame B0

Taking 10mL of chromatographic grade methanol into a 50mL centrifuge tube, taking 1mL of fermentation liquor which is uniformly mixed into the centrifuge tube, carrying out ultrasonic crushing for 1 hour by using an ultrasonic cleaning instrument (the temperature is controlled to be about 10 ℃ before ultrasonic treatment, the ultrasonic finishing temperature is about 20 ℃), taking out after ultrasonic treatment for 30min, uniformly mixing by using a vortex mixer, and carrying out ultrasonic treatment for 30min. At the end of the sonication, 2mL of the extract was centrifuged at 12000rpm for 2min and filtered 1 time with a 0.22 μm organic phase filter, and used for HPLC determination. The detection spectrum of the standard substance of the neotame B0 shows that the peak time is 28.363min, and is shown in figure 18. The HPLC detection pattern of neotame B0 in the broth when the gpd promoter regulates GloA expression is shown in FIG. 19.

As can be seen from the fermentation data in Table 10, the GLIS05 series GloA gene is introduced into gpd promoter, and the strain fermentation yield is improved by 37.4% compared with that of the wild strain; secondly, the GLIS07 series GloA gene is introduced into a tef1 promoter, the strain fermentation yield is improved by 16% compared with a wild strain, and the improvement of the expression quantity of the GloA through the regulation and control of the promoter is favorable for the improvement of the B0 yield.

TABLE 10 fermentation data

/>

Claims

1. A genetically engineered bacterium, the starting strain of which is a filamentous fungus Glarea lozoyensis, characterized in that the genetically engineered bacterium overexpresses a gene encoding a non-ribosomal peptide synthetase; the NCBI accession number of the non-ribosomal peptide synthetase is XP_008078276.1.

2. The genetically engineered bacterium of claim 1, wherein the NCBI accession number of the gene encoding the non-ribosomal peptide synthetase is xm_008080085.1; and/or, the filamentous fungus Glarea lozoyensis is g.lozoyensis ATCC 20868;

3. The genetically engineered bacterium of claim 2, wherein said strong promoter is integrated on the genome of g.lozoyensis ATCC20868 and overexpresses a gene encoding said non-ribosomal peptide synthase;

4. A method for preparing the genetically engineered bacterium of any one of claims 1-3, comprising the steps of: transforming a plasmid or linear fragment containing a strong promoter into a filamentous fungus Glarea lozoyensis cell, and replacing the original promoter of a gene encoding a non-ribosomal peptide synthase in the genome with the strong promoter to obtain a genetically engineered bacterium over-expressing the gene encoding the non-ribosomal peptide synthase; the strong promoter is selected from gpd promoter or Tef1 promoter; the nucleotide sequence of the gpd promoter is shown as SEQ ID NO. 4; the nucleotide sequence of the Tef1 promoter is shown as SEQ ID NO. 6;

5. The method of claim 4, wherein the filamentous fungus Glarea lozoyensis is enzymatically hydrolyzed to its cell wall by an enzymatic solution that lyses the cell wall prior to said transforming;

preferably, the enzyme solution comprises one or more of a filamentous fungal cell wall lytic enzyme, a lywallase, a cellulase;

6. A method for preparing neotame B0, comprising: fermenting under conditions suitable for culturing the genetically engineered bacterium of any one of claims 1-3;

preferably, the preparation method comprises culturing in seed culture medium, transferring to fermentation culture medium for fermentation;

the duration of the fermentation is 15-25 days, for example 20 days;

even more preferably, the seed culture mediumComprises cottonseed cake powder 25g/L, mannitol 50g/L, KH ₂ PO ₄ 4g/L, glucose 10g/L, mgSO ₄ ·7H ₂ 0.1g/L of O and 0.1g/L of chloramphenicol, wherein the fermentation medium comprises 8g/L of soybean oil, 9g/L of glucose, 110g/L of mannitol, 9g/L of cottonseed meal, 9g/L of soybean protein concentrate, 3.5g/L of compound nitrogen source, 10g/L of proline, 8.5g/L of monopotassium phosphate and 0.1g/L of chloramphenicol.

7. An expression cassette comprising a promoter, a gene encoding a non-ribosomal peptide synthetase, and a terminator;

the nucleotide sequence of the gpd promoter is shown as SEQ ID NO. 4;

the nucleotide sequence of the Tef1 promoter is shown as SEQ ID NO. 6;

8. A recombinant plasmid comprising the expression cassette of claim 7; preferably, the backbone plasmid of the recombinant plasmid is pUC57 plasmid.

9. A recombinant plasmid combination comprising a Cas9 expression plasmid, an sgRNA plasmid, and the recombinant plasmid of claim 8; the linear fragments of Cas9 expression plasmid and sgRNA plasmid for use in homologous recombination of the expression cassette of claim 7 into the genome of a producer of neotame B0;

preferably, the backbone plasmid of the Cas9 expression plasmid is a pFC333 plasmid and/or the backbone plasmid of the sgRNA plasmid is a pUC57 plasmid; and/or the expression cassette is in the recombinant plasmid of claim 8, and the recombinant plasmid is linearized prior to homologous recombination.

10. Use of a genetically engineered bacterium according to any one of claims 1 to 3 or an expression cassette according to claim 7 or a recombinant plasmid according to claim 8 or a recombinant plasmid combination according to claim 9 for the preparation of neotame B0.