CN117737138B

CN117737138B - Culture method for inducing high Li Gongniu Antrodia camphorata to produce bacterial compounds for inhibiting plant diseases

Info

Publication number: CN117737138B
Application number: CN202410173373.2A
Authority: CN
Inventors: 王毅; 王栋
Original assignee: Southwest Forestry University; Yunnan Academy of Forestry and Grassland Sciences
Current assignee: Southwest Forestry University; Yunnan Academy of Forestry and Grassland Sciences
Priority date: 2024-02-07
Filing date: 2024-02-07
Publication date: 2024-05-28
Anticipated expiration: 2044-02-07
Also published as: CN117737138A

Abstract

The invention belongs to the technical field of crop disease control, and particularly discloses a culture method for inducing high Li Gongniu Antrodia camphorata to generate a bacterial compound for inhibiting plant diseases, wherein the method comprises the steps of co-culturing high Li Gongniu Antrodia camphorata and Saccharomyces bayanus to obtain a co-culture, wherein the preservation name of high Li Gongniu Antrodia camphorata is Taiwanofungus gaoligongensis YAFTG001, and the preservation number is: the CCTCC M20232425 shortens the culture time of the high Li Gongniu Antrodia camphorata, and the prepared high Li Gongniu Antrodia camphorata and shellfish yeast co-culture has an inhibiting effect on citrus canker, cucumber bacterial angular leaf spot bacteria and potato soft rot bacteria, and provides a new disease-resistant way for citrus, cucumber and potato.

Description

Culture method for inducing high Li Gongniu Antrodia camphorata to produce bacterial compounds for inhibiting plant diseases

Technical Field

The invention belongs to the technical field of crop disease control, and in particular relates to high Li Gongniu antrodia camphorata and a culture method for inducing the antrodia camphorata to generate inhibition effects on citrus canker, cucumber bacterial angular leaf spot bacteria and potato soft rot bacteria.

Background

Antrodia camphorate is a unique and elegant edible and medicinal fungus containing a variety of active ingredients including polysaccharides, terpenes, ubiquinones, maleic acid and succinic acid derivatives, etc., and these secondary metabolites exhibit various biological activities such as anticancer, antidiabetic, immunomodulating, anti-inflammatory, antiviral, antiallergic and antioxidant activities. In addition, researches show that Antrodia camphorate has a good antibacterial effect: the compound separated from Antrodia camphorate fruiting body has good inhibition effect on helicobacter pylori causing gastritis; both the Antrodia camphorate ethyl acetate and chloroform extracts can obviously inhibit oral bacteria streptococcus mutans and porphyromonas gingivalis. At present, the artificial cultivation technology of Antrodia camphorate mainly comprises the following 4 types: tilia cultivation, solid state cultivation, dish cultivation and liquid submerged fermentation, the first 3 methods have longer cultivation period, and the basswood cultivation requires short resources of the camphor tree and has higher cost. In contrast, liquid fermentation is not only short in period and convenient for large-scale cultivation, but also can obtain various active ingredients by changing the components of the culture medium, the culture conditions and the like.

Crop diseases have important effects on the global ecological environment and the survival and development of human beings. The citrus canker is a serious bacterial disease affecting the development of global citrus industry, and is also a major quarantine disease at home and abroad. The pathogen harms tens of rutaceae plants, including most commercial cultivars in citrus, and it invades host tissue through natural pores, stomata, pintles or wounds, primarily leaves, branches, spines, trunks and fruits of citrus. Wounds, both in the mature and tender parts, provide a place for pathogenic bacterial infestation and disease exacerbation.

Meanwhile, as a canker pathogen, soft rot is caused in the cultivation, transportation and storage processes of various crops and ornamental plants. Wherein potato soft rot bacteria invade plant tissues by producing and secreting plant cell wall degrading enzymes such as soft rot enzymes, polygalacturonase, etc., and invade host tissues through natural pores (such as pits and pores) or wounds, resulting in softening of tubers, rhizomes and leaves. Soft rot fungi have been reported as the causative agent of the outbreak of many infectious crop diseases and are listed as the top 10 of the agriculturally important pathogens.

Cucumber is one of the oldest vegetable crops, and is currently planted in a number of climatic regions worldwide. China, russia and turkish are major production countries. Bacterial leaf spot is one of the major biological factors limiting the production of open-field melon. Pathogens often colonize the interstitial spaces of leaf tissue, resulting in limited water immersion lesions of the veins, which in turn, are necrotic. Symptoms occur mainly on leaves, but may also occur on petioles, stems and fruits, resulting in serious yield loss and quality degradation.

At present, copper-based pesticides and antibiotics are mainly used for controlling crop pathogens, but a large amount of chemical bactericides are used for a long time, so that the problems of soil and water pollution, pesticide residues, drug resistance and the like are easily caused. Therefore, the development of safer and environment-friendly biological control means is not easy.

Disclosure of Invention

The invention provides a method for culturing bacterial compounds for inducing high Li Gongniu Antrodia camphorata to generate and inhibiting plant diseases, which is a method for inducing high Li Gongniu Antrodia camphorata to generate and inhibiting plant diseases by using a co-culture method, and improves the antibacterial activity of co-culture high Li Gongniu Antrodia camphorata crude extract.

In order to achieve the above purpose, the present invention is realized by the following technical scheme:

The invention provides a culture method for inducing high Li Gongniu Antrodia camphorata to produce antibacterial compounds, which comprises the steps of co-culturing high Li Gongniu Antrodia camphorata and Saccharomyces bayanus to obtain a co-culture, wherein the preservation name of high Li Gongniu Antrodia camphorata is Taiwanofungus gaoligongensis YAFTG001, and the preservation number is: CCTCC M20232425 is preserved in China center for type culture Collection, and the preservation address is the university of Chinese Wuhan; preservation date: 2023, 12, 1; the preservation number is CCTCC M20232425.

Further, the culture method specifically comprises the following steps:

S1: activating Antrodia camphorata strains with the height Li Gongniu;

S2: activating the saccharomyces bayanus;

S3: adding 1 ml of each activated bail yeast into an activated high Li Gongniu Antrodia camphorata culture solution of 100 ml, wherein the bail yeast OD ₆₀₀ =0.7, the high Li Gongniu Antrodia camphorata culture solution OD ₆₀₀ =1, and then placing in a constant-temperature shaking table of 28 ℃ and 150rpm for co-culture for 3d to obtain a culture solution;

s4: filtering mycelium in the culture solution to obtain a bacterial solution, and adding the bacterial solution according to the volume ratio of 1:1 adding ethyl acetate, and then performing ultrasonic treatment for 30min; pouring into a separating funnel, standing to separate layers, and extracting supernatant; the co-culture was obtained by condensing, refluxing and drying with a rotary evaporator.

Further, in the step S1, a culture medium used for activating the high Li Gongniu antrodia camphorata strain is a modified malt extract broth, and the modified malt extract broth is: animal tissue pepsin digest 5g/L, yeast extract 5g/L, malt extract 5g/L, maltose 3g/L, glucose 7g/L and the balance of water, and the activation method comprises the following steps: culturing for 10d at 28 ℃ in a constant temperature shaking table at 150 rpm.

In step S2, the culture medium used for activating the saccharomyces bayanus is YPD culture medium, and the activation method is as follows: culturing for 10d at 28 ℃ in a constant temperature shaking table at 150 rpm.

The invention also provides a product containing the co-culture obtained by any one of the culture methods.

Further, the product is applied to crop disease control.

Further, the crop disease is a disease caused by pathogen Xanthomonas axonopodis, pseudomonas syringae pv. LACHRYMANS or Pectobacterium carotovorum subsp. Carotovorum.

Further, the crop disease is citrus canker, cucumber bacterial angular leaf spot or potato soft rot.

The invention has the following beneficial effects:

The invention obtains a strain of high Li Gongniu Antrodia camphorata fungus by separating and identifying the collected fruiting body of high Li Gongniu Antrodia camphorata, the preservation name is Taiwanofungus gaoligongensis YAFTG001, the preservation number is CCTCC M20232425,

By co-culturing the high Li Gongniu Antrodia camphorata and the shellfish yeast, the high Li Gongniu Antrodia camphorata is induced to generate antibacterial compounds. In 37 volume of Guangxi plant 2017, 8 th stage 1068-1073 "Antrodia camphorata fermentation broth extract antibacterial activity research" shows that the time for generating obvious antibacterial activity by Antrodia camphorata liquid culture is 40d, and the culture method provided by the invention can shorten the culture time to 13 days, thereby greatly improving the culture efficiency. Meanwhile, the crude extract produced after co-culture has obvious inhibition effect on citrus canker, cucumber bacterial angular leaf spot and potato soft rot and has important significance for controlling crop diseases.

According to the invention, through separating and screening high Li Gongniu Antrodia camphorata, a fungus with antibacterial activity is obtained, and experiments show that the high Li Gongniu Antrodia camphorata and Saccharomyces bayanus co-culture liquid extract has a strong inhibition effect on citrus canker Xanthomonas axonopodis, cucumber bacterial angular leaf spot Pseudomonas syringae pv. LACHRYMANS and potato soft rot fungus Pectobacterium carotovorum subsp carotovorum, and has important significance for crop disease control.

Drawings

In order to more clearly illustrate the embodiments of the invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram of fruiting bodies of Antrodia camphorata with a height Li Gongniu according to the present invention;

FIG. 2 is a diagram showing the growth condition of mycelium of Antrodia camphorata with a height Li Gongniu according to the present invention;

FIG. 3 is a graph showing the results of TLC experiments on Antrodia camphorata with high Li Gongniu according to the present invention; respectively culturing the Saccharomyces cerevisiae, antrodia camphorata bacterial liquid crude extract and Antrodia camphorata co-cultured Saccharomyces cerevisiae bacterial liquid crude extract from left to right;

FIG. 4 is a chart showing the antibacterial activity detection diameter of Antrodia camphorate with high Li Gongniu according to the present invention;

FIG. 5 is a graph showing the inhibition of the bacterial canker of citrus after co-culturing the beta yeast with Antrodia camphorata at a height Li Gongniu, 1: a crude extract of Saccharomyces cerevisiae; 2: high Li Gongniu Antrodia camphorate bacterial liquid crude extract; ck: DSMO;3: high Li Gongniu Antrodia camphorate co-culture shellfish yeast crude extract;

FIG. 6 is a graph showing the inhibition of bacterial angular leaf spot bacteria of cucumber after co-culturing a shellfish yeast with high Li Gongniu. Camphorate according to the present invention, 1: a crude extract of Saccharomyces cerevisiae; 2: high Li Gongniu Antrodia camphorate bacterial liquid crude extract; ck: DSMO;3: high Li Gongniu Antrodia camphorate co-culture shellfish yeast crude extract;

FIG. 7 is a graph showing the inhibition of potato soft rot fungi by high Li Gongniu. Camphorata co-cultured with shellfish yeast according to the present invention, 1: a crude extract of Saccharomyces cerevisiae; 2: high Li Gongniu Antrodia camphorate bacterial liquid crude extract; ck: DSMO;3: high Li Gongniu Antrodia camphorate co-culture shellfish yeast crude extract;

Fig. 8: the inhibition effect of crude extract on citrus canker after culturing different yeasts together with Li Gongniu. Camphorata is compared; 1: high Li Gongniu Antrodia camphorate co-culture shellfish yeast crude extract; 2: co-culturing crude schizosaccharomyces japonica extract with high Li Gongniu Antrodia camphorata; ck: DSMO;3: high Li Gongniu Antrodia camphorata co-culture Codri kudria Azadirachta crude extract;

Fig. 9: high Li Gongniu Antrodia camphorate, co-culturing high Li Gongniu Antrodia camphorate and MBDD standard, HPLC chromatogram;

FIG. 10A phylogenetic tree display diagram of Antrodia camphorata with height Li Gongniu based on ITS is constructed.

Detailed description of the preferred embodiments

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described in the following in conjunction with the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1

Isolation and identification of Antrodia camphorata strain of high Li Gongniu

1. Separation of Antrodia camphorata with height Li Gongniu

The collected fruiting body sample of Antrodia camphorate (figure 1) with height Li Gongniu is washed clean, washed with flowing water for 48h, cut into 2cm pieces, washed with 1L distilled water, then soaked with 70% ethanol for 2 min, poured off ethanol, washed with 50mL sterilized water for 6 times, soaked with sodium hypochlorite (10%) solution for 1 min, poured off sodium hypochlorite solution, and washed with 50mL sterilized water for 10 times (50 mL each time).

A2 cm piece of tissue was cut into pieces of 0.5cm in length and width, placed in a centrifuge tube, added with steel balls, 1mL of sterilized water, and crushed for 2 minutes (180 rpm). Further, the mixture was diluted 100-fold and plated on 10 KASMY plates (modified malt extract broth: 2.1 g/L+100. Mu.g/ml Karamycin, 100. Mu.g/ml ampicillin+100. Mu.g/ml streptomycin), and cultured for 20 days to give colonies, which were selected and identified as single colonies.

Transferring the grown mycelium to modified malt extract broth solid culture medium for 30 days, and performing molecular identification to the strain to obtain Antrodia camphorata with height Li Gongniu. The strain is shown in figure 2, fungi grow well on the modified malt extract broth solid culture medium, the surface of the bacterial colony is villiated, mycelia grow radially and circumferentially in orange yellow, mycelia are denser in the later growth stage, the bacterial layer is thinner, and the bacterial colony is in a regular round shape. The modified malt extract broth solid medium comprises the following components: 100 mL/bottle (pepsin digest of animal tissue, 5g/L, 5g/L yeast extract malt extract, 3g/L maltose, 7g/L glucose, 16g/L agar).

2. Identification of Antrodia camphorata with height Li Gongniu

(1) Identification of morphology

Fungi grow well on the modified malt extract broth solid medium, hyphae are yellow in color, the surface of a bacterial colony grows smoothly and radially to the periphery, the bacterial layer is thicker, and the bacterial colony is irregularly shaped.

(2) DNA extraction

① CTAB (cetyltrimethylammonium bromide) was heated in a 65℃water bath for 30min prior to the experiment;

② Taking 50mg of dried high Li Gongniu Antrodia camphorate mycelia in a 2mL centrifuge tube, adding 3 small steel balls, putting the centrifuge tube into liquid nitrogen for soaking for 6min, immediately crushing for 1.5min by a crusher, adding 1mL of preheated CTAB solution, blowing and mixing uniformly by a pipetting gun, transferring all into a centrifuge tube filled with 200 mu L of PVP (polyvinylpyrrolidone), suspending and adding 20 mu L of beta-mercaptoethanol in a fume hood, vibrating for 15s for full grinding, then putting into a 65 ℃ water bath for 1.5h, turning up and down for 5-6 times every 10min, and centrifuging for 10min at a temperature of 12000r/min and 4 ℃;

③ Taking 1mL of supernatant into a new centrifuge tube, adding 500 mu L of DNA phenol reagent and chloroform-isoamyl alcohol mixed solution, turning over up and down for 10min, centrifuging (4 ℃ C. 12000 r/min) for 10min (③ steps are repeated twice);

④ Taking 900 mu L of supernatant, placing into a new centrifuge tube, adding 50 mu L of 3mol sodium acetate solution and 900 mu L of 95% absolute glacial ethanol (-20 ℃), shaking, and placing into a refrigerator at-20 ℃ for precipitation for 3 hours;

⑤ Centrifuging (4 ℃ C. 12000 r/min) for 10min after precipitation, discarding supernatant, adding 500 μL 75% alcohol, turning over up and down for 2-3 times, standing for 3min, and discarding supernatant;

⑥ Adding 500 μL of 95% alcohol, turning over for 2-3 times, standing for 3min, centrifuging at room temperature (13000 rpm) for 3min, discarding ethanol, and standing to dry;

⑦ Adding 40 μl of elution buffer EB, and centrifuging at room temperature (13000 rpm) for 1.5min to obtain genome DNA of Antrodia camphorata with fungus height Li Gongniu.

(3) ITS analysis and identification

The fungal rDNA spacer sequence (containing ITS1 region, 5.8S region, ITS4 region) was amplified using fungal universal primers ITS1 (5'-CTTGGTCATTTAGAGGAAGTAA-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') and the resulting ITS sequencing sequence was shown in SEQ ID No. 1.

SEQ ID No.1

TTCCCTCCGGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCCTACCTGATTTGAGGTCAGAAGGTCATTAGAAAATCATCCCCCTGAAGGGACTTGCACCATTAGAAGCCGATCCCACCTCAGACAACCACGGCATAGATGACTATCACACCGATAAGGTCAATCCACAAGGGTTCAAGCTAATGCATTCAAGAGGAGGTGAATCAAAAAAAAGAGCCAGCAATTTAACCCTCCAAATCCAAGCCCATTCAACAAAAAGTCAAAAGGGTTGATAATTCCATGACACTCAAACAGGCATGCTCCTCAGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCACATTTCGCCGTGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTATACAATATGCGTTACACGCAACATACATTCTGTAACTGATACGGAGTCAATTTAAAAAACATAGGAAGGTCAAAACAGCTGTCTCCATCAGAGAAGACAACCGTTCAAAACCAACCTACAAAGCATGCACAGGTGTGAGAGAATATGAATGAACAGAGGTGTGCACATACCTCCCCCCTTTTCAAGAGGAGGTCAGCTACAACCCCTTTCAAATACAATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCTCTAATTGACCCAAGA.

(4) Construction of developmental trees

Based on ITS, utilizing MEGA software to construct phylogenetic tree (figure 10) of Antrodia camphorata with high Li Gongniu, comprehensive strain morphological identification and molecular biological identification result, the fungus has the closest relationship with Antrodia camphorata (Antrodia camphorata) so as to identify and preserve YAFTG001 strain as Antrodia camphorata (Taiwanofungus gaoligongensis) with high Li Gongniu.

EXAMPLE 2 high Li Gongniu crude extract of Antrodia camphorate co-cultured Saccharomyces cerevisiae

1. Liquid co-culture

1.1. Preparation of high Li Gongniu Antrodia camphorate culture solution: a fourth of mycelia in a 60mm culture dish with a high Li Gongniu Antrodia camphorata mycelium is scraped, placed in a 2mL sterilizing centrifuge tube, then 1mL sterile water is added, the mixture is crushed for 2min, 500 mu L of crushed sample liquid is respectively inoculated into a 250mL conical flask filled with 100 mL modified malt extract broth liquid culture medium (animal tissue pepsin digest 5g/L, yeast extract 5g/L, malt extract 5g/L, maltose 3g/L, glucose 7g/L and the balance water), and the mixture is placed in a constant temperature shaking table at 28 ℃ and 150rpm for 10d culture.

1.2. Preparation of a Saccharomyces bayanus culture solution: the monoclonal colony of the shellfish yeast is placed in a 2mL sterilizing centrifuge tube, 1mL sterile water is added, and the shellfish yeast is completely dissolved by shaking. Then, 500. Mu.L of the dissolved sample is inoculated into a 250mL conical flask filled with 100mL YPD culture medium, and the flask is placed in a constant-temperature shaking table at 28 ℃ and 150rpm for 1 day of culture.

1.3. Co-culturing high Li Gongniu Antrodia camphorate and shellfish yeast: 1ml yeast (OD ₆₀₀ =0.7) culture broth for 1 day was added to 100 ml high Li Gongniu Antrodia camphorata (OD ₆₀₀ =1) culture broth for 10 days. And (3) putting the mixture back into a constant temperature shaking table at 28 ℃ and 150rpm, and co-culturing the mixture for 3 days to obtain a co-culture fermentation broth.

2. Preparation of crude extract of co-culture fermentation broth

Filtering mycelium of the co-culture fermentation broth with gauze to obtain bacterial liquid. And (3) adding the bacterial liquid 1:1 ethyl acetate was added and then sonicated for 30min. Then poured into a separating funnel, and the mixture is kept stand for 5 hours to separate the mixture and extract supernatant. Condensing, refluxing and drying the extraction solution by using a rotary evaporator to obtain the crude extract of the co-culture bacterial liquid of the antrodia camphorata and the saccharomyces bayanus with the height of Li Gongniu.

Example 3 detection of antibacterial Activity of crude extract of bacterial liquid of Antrodia camphorata culture of high Li Gongniu

1. Activation of pathogenic bacteria

The method comprises the steps of adding 5 mu L of citrus canker Xanthomonas axonopodis, cucumber bacterial angular leaf spot Pseudomonas syringae pv. LACHRYMANS and potato soft rot fungus Pectobacterium carotovorum subsp. Carotovorum stored at low temperature into a 2mL centrifuge tube, adding 750 mu L of LB liquid culture medium (tryptone 10 g/L+sodium chloride 10 g/L+yeast extract 5 g/L), placing the centrifuge tube into a shaking table at a constant temperature of 37 ℃ and a rotating speed of 180 r min ^-1 for culturing for 12 hours to obtain pathogenic bacteria liquid, placing the pathogenic bacteria liquid into a refrigerator at 4 ℃ for standby, taking out the pathogenic bacteria liquid, and diluting the activated bacteria to 1/10 before use.

2. Filter paper sheet method for detecting antibacterial activity

Taking 0.01g of crude extract of high Li Gongniu Antrodia camphorata bacterial liquid and crude extract of high Li Gongniu Antrodia camphorata and shellfish yeast co-culture bacterial liquid in a 2mL centrifuge tube, adding 500 mu L of DMSO (dimethyl sulfoxide) solution, and diluting to 50mg/mL. Uniformly smearing the activated pathogenic bacteria liquid on LB solid culture medium (tryptone 10 g/L+sodium chloride 10 g/L+agar 15 g/L+yeast extract 5 g/L), airing, placing a 5mm filter paper wafer which absorbs the dissolved pathogenic bacteria liquid crude extract at a corresponding mark of the culture medium, dipping a Li Gongniu camphor (the operation steps are the same as those of the experimental group) with the 5mm filter paper wafer, taking the saccharomyces bayanus and DMSO solution as a reference, placing the culture medium in a constant temperature incubator at 37 ℃ for culturing for 12 hours, and observing whether a bacteriostasis ring appears or not, and measuring the diameter of the bacteriostasis ring by using a crisscross method. The antibacterial activity results of the crude extract showed that the antibacterial activity of the high Li Gongniu. Camphorata co-cultured shellfish yeasts was the greatest (FIGS. 5,6,7, 8).

3. Compared with the common culture of different yeasts, the antibacterial activity of the Antrodia camphorata with high Li Gongniu

Antibacterial activity of crude extract after co-cultivation with Saccharomyces cerevisiae Schizosaccharomyces Japonicus and Saccharomyces curvatus Saccharomyces kudriavzevii and Antrodia camphorata of high Li Gongniu was compared with co-cultivation with Schizosaccharomyces japonicus. The culture method, the medium formulation and the crude extract extraction method were adopted in accordance with example 2. Namely, after the Antrodia camphorata with the height Li Gongniu and the yeast are respectively cultured for 10 days, the yeast is inoculated into the Antrodia camphorata with the height Li Gongniu. The bacteria coated on the plate are selected from citrus canker, and the experimental operation method is consistent with the step 2. The antibacterial experiment result shows that the crude extract after co-culturing high Li Gongniu Antrodia camphorata and shellfish yeast has the maximum inhibition zone diameter (1.9 cm), the second is the inhibition zone diameter (1.2 cm) of high Li Gongniu Antrodia camphorata and Codria kudriana, and the crude extract after co-culturing high Li Gongniu Antrodia camphorata and Schizosaccharomyces japonica has no inhibition effect on citrus canker. The method shows that the components of the crude extract after the co-culture of the yeasts of different strains and the high Li Gongniu Antrodia camphorata are different, and the production effect of the antibacterial compound in the high Li Gongniu Antrodia camphorata is different. In this experiment, the crude extract obtained after coculturing the shellfish yeast and Antrodia camphorata of Li Gongniu had the best antibacterial effect (FIG. 8).

Experimental example 2 TLC experiment

Respectively taking a crude extract of high Li Gongniu Antrodia camphorata bacterial liquid, a crude extract of high Li Gongniu Antrodia camphorata co-cultured shellfish yeast liquid and a shellfish yeast solution sample, and adding acetone to prepare a solution containing 100mg per 1mL as an experimental solution. The experimental solution was sonicated for 10min, then placed in a centrifuge at 14000rpm for 3min to allow the crude extract to dissolve well. The top and bottom ends of the silica gel thin layer plate were marked 1cm apart as the final and initial lines of the TLC experiment, respectively. Spot samples were spotted at the starting line of the same TLC plate using a spotter and the experimental sample volumes were controlled to 5 μl with 1cm sample spacing. Ethyl acetate: petroleum ether (2:4) is used as a developing agent, developed, taken out, dried and taken out for observation under an ultraviolet lamp (302 nm). Then Godin and mercaptan are used as color developing agents, and are sprayed on a silica gel thin layer plate uniformly in sequence, and the silica gel thin layer plate is placed on a heating plate with constant temperature of 130 ℃ to develop color. The different color and different position spots on the silica gel plate in the TLC experiment represent different compounds. From the TLC silica gel plates of this experiment it can be seen that the co-cultivated Antrodia camphorata of height Li Gongniu produced a completely different compound sites than the original Antrodia camphorata of height Li Gongniu and Saccharomyces bayanus (FIG. 3). To continue analysis of the compound, further HPLC experimental analysis was performed.

Experimental example 3 HPLC experiment

Accurately weighing 0.05g of crude extracts of the co-cultured shellfish yeast liquid of Antrodia camphorata with a height of Li Gongniu and Antrodia camphorata with a height of Li Gongniu, adding methanol to prepare solutions with a concentration of 4%, performing ultrasonic treatment for 30min, filtering with a microporous filter membrane with a thickness of 0.45 μm, and collecting the subsequent filtrate. AGILENT HYPERSIL 5 ODS c18 (250 x 4.0mm,5 μm) was used as a column with methanol: water (70:30) was used as the mobile phase, the detection wavelength was full wavelength, the column temperature was 30deg.C, the sample injection amount was 4. Mu.L, and the flow rate was 200. Mu.L/min. The horizontal and vertical axes in the HPLC experiment result graph represent the retention time and peak height respectively, the peaks corresponding to different retention times represent different compounds, and the concentration of the compounds can be calculated through the peak area and the standard curve. According to the HPLC result of the experiment, the peak area of the MBBD compound of the antrodia camphorata with the height Li Gongniu after co-culture is obviously increased compared with the peak area of the antrodia camphorata with the height Li Gongniu, and according to the peak area calculation concentration formula Cx= (Ax-b)/k (Cx is the concentration of the compound in an unknown sample, ax is the integral area of the peak surface of the unknown sample, k is the slope of a calibration curve, and b is the intercept of the calibration curve), the concentration of the MBBD compound after co-culture can be calculated to be increased by nearly 11 times compared with that of the antrodia camphorata with the height Li Gongniu (figure 9).

Claims

1. A culture method for inducing high Li Gongniu Antrodia camphorata to produce antibacterial compounds is characterized in that co-culturing high Li Gongniu Antrodia camphorata and Saccharomyces bayanus to obtain co-culture, wherein the preservation name of high Li Gongniu Antrodia camphorata is Taiwanofungus gaoligongensis YAFTG001, and the preservation number is as follows: cctccc M20232425;

The method specifically comprises the following steps:

S1: high Li Gongniu Antrodia camphorata strain activation

The culture medium used for activating the high Li Gongniu Antrodia camphorata strain is an improved malt extract broth liquid culture medium, and the improved malt extract broth liquid culture medium is as follows: animal tissue pepsin digest 5g/L, yeast extract 5g/L, malt extract 5g/L, maltose 3g/L, glucose 7g/L and the balance of water, and the activation method comprises the following steps: culturing for 10d in a constant temperature shaking table at 28 ℃ and 150 rpm;

s2: activation of Saccharomyces bayanus

The culture medium used for activating the saccharomyces bayanus is YPD culture medium, and the activating method comprises the following steps: culturing for 10d in a constant temperature shaking table at 28 ℃ and 150 rpm;

2. A product comprising the co-culture obtained by the culture method according to claim 1.

3. The use of the product according to claim 2 for controlling crop diseases, wherein the crop diseases are diseases caused by citrus canker Xanthomonas axonopodis, cucumber bacterial angular leaf spot bacteria Pseudomonas syringae LACHRYMANS or potato soft rot bacteria Pectobacterium carotovorum subsp Carotovorum.

4. The use according to claim 3, wherein the crop disease is citrus canker, cucumber bacterial angular leaf spot or potato soft rot.