CN117737091A - Single base missense mutation of bovine CYBB gene and application thereof - Google Patents

Abstract

The invention discloses a single base missense mutation of a bovine CYBB gene and application thereof, belonging to the technical field of genetic engineering. The invention discloses a single-base missense mutation of a bovine CYBB gene, and the nucleotide sequence of the single-base missense mutation bovine CYBB gene is shown as SEQ ID NO. 1. The important mononucleotide mutation of the bovine CYBB functional gene achieves the effect of reducing iron death caused by the infection of macrophages by mycobacterium tuberculosis, and simultaneously reduces the proliferation capacity of the mycobacterium in cells.

Description

Single base missense mutation of bovine CYBB gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a single-base missense mutation of a bovine CYBB gene and application thereof.

Background

The problem of epidemic disease of dairy cow breeding in China is outstanding, and the problem of prevention and control of severe epidemic disease such as tuberculosis can not be solved by conventional breeding and the existing epidemic disease prevention and control measures; tuberculosis caused by mycobacterium tuberculosis (Mycobacterium tuberculosis, mtb) infection is currently an international important infectious disease that endangers the health of human bodies; about 1/4 of the population worldwide is a latent infected person of Mtb. Meanwhile, bovine tuberculosis (Bovine tuberculosis, bTB) is a chronic respiratory infectious disease of livestock caused by intracellular mycobacterium bovis (m.bovis) infection, particularly in dairy cows, which is conservatively predicted to cause economic losses of up to 30 million merits to farmers worldwide each year. Currently, the functional genes for excavating the antituberculosis of cows are very limited.

The CYBB gene (also called gp91phox, NOX2, etc.) encodes the Cytochrome B-245Beta Chain, an important component of the human reduced Nicotinamide Adenine Dinucleotide Phosphate (NADPH) oxidase complex. It is mainly expressed in phagocytes (including granulocytes, monocytes and macrophages), belongs to a protein-coding gene, and the mutation of the gene is easy to cause hereditary immunodeficiency disorder-X-CGD (X-linked chronic granulomatosis); CYBB is again an important gene for MSMD (hereditary mycobacterial susceptibility syndrome mendelian susceptibility to mycobacterial disease), but the mechanism is not yet known. Meanwhile, CYBB is an important driver for iron death. Whether iron death in cells caused by Mtb infection of macrophages is related to CYBB gene regulation or not, and whether Mtb is regulated by CYBB to obtain intracellular iron and other specific mechanisms are not known.

Therefore, providing a single base missense mutation of bovine CYBB gene and its use is a problem to be solved by those skilled in the art.

Disclosure of Invention

In view of this, the present invention provides a single base missense mutation of bovine CYBB gene and its application.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

the nucleotide sequence of the single-base missense mutant bovine CYBB gene is shown as SEQ ID NO. 1.

Further, a vector containing the single base missense mutation of the bovine CYBB gene.

Further, a host bacterium containing the single base missense mutation of the bovine CYBB gene.

Further, the single base missense mutation of the bovine CYBB gene, the vector or the application of the host bacteria in preparing anti-tuberculosis preparations.

Further, the single base missense mutation of the bovine CYBB gene, the vector or the host bacterium are applied to the preparation of the preparation for resisting the mycobacterium tuberculosis infection.

Further, the single base missense mutation of the bovine CYBB gene, the vector or the host bacterium are applied to the preparation of preparations for reducing proliferation of mycobacterium tuberculosis in macrophages.

Further, single base missense mutations of the bovine CYBB gene reduce proliferation of mycobacterium tuberculosis in macrophages by controlling host iron death.

Furthermore, the single base missense mutation of the bovine CYBB gene, the vector or the application of the host bacteria in breeding of antituberculous cows.

The wild type (bCBB-WT) and c.105614637A of bovine CYBB gene were found by infecting macrophage RAW264.7 and J774A.1 cells with Mycobacterium tuberculosis H37Ra&The T single base mutant (bYBB-mut) can extremely obviously reduce intracellular Fe in 24H of H37Ra infection ²⁺ Is a concentration of (2); however, bCBB-WT extended intracellular Fe of the cells 24h after infection ²⁺ The content of bCYBB-mut can obviously reduce intracellular Fe after 24h infection compared with pCMV-HA empty load and bCYBB-WT ²⁺ Is contained in the composition. In addition, bCYBB-mut can reduce intracellular large amount of lipid peroxide malondialdehyde MDA caused by infection of bound mycobacterium, and can remove large amount of reactive oxygen species ROS released by mitochondria. Thereby inhibiting proliferation of H37Ra in cells and realizing megaphagyThe cells are immune to Mycobacterium tuberculosis.

The important single base mutation of the gene and the discovery of the mutant obtain important functions, and the gene is hopeful to utilize a gene editing technology to create new materials for breeding high-yield and disease-resistant cows, thereby improving the self-raising and innovation capability of the breeding industry.

Compared with the prior art, the invention discloses the single base missense mutation of the bovine CYBB gene and the application thereof, and the important single nucleotide mutation of the bovine CYBB functional gene achieves the effect of reducing iron death caused by the infection of macrophages by mycobacterium tuberculosis, and simultaneously reduces the proliferation capacity of the mycobacterium in cells.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the geographical distribution of the T and A alleles of the CYBB genes of the invention throughout 52 bovine breeds worldwide;

FIG. 2 is a diagram showing Sanger sequencing patterns of pCMV-HA-bCYBB-WT and pCMV-HA-bYBB-mut of the present invention;

FIG. 3 is a diagram showing vector maps of pCMV-HA-bCBB-WT and pCMV-HA-bCBB-mut of the present invention;

FIG. 4 is a graph showing the detection result of the Ferroorange intracellular ferrous ion fluorescent probe;

wherein A: RAW264.7 cells; b: j774a.1 cells;

FIG. 5 is a graph showing total iron and ferrous iron measurements in RAW264.7 and J774A.1 cells of the present invention;

wherein, bCBB-WT: pCMV-HA-bCBB-WT; bCBB-mut: pCMV-HA-bCYBB-mut;

FIG. 6 is a graph showing the results of the RAW264.7 and J774A.1 intracellular MDA assays of the present invention;

wherein, bCBB-WT: pCMV-HA-bCBB-WT; bCBB-mut: pCMV-HA-bCYBB-mut;

FIG. 7 is a graph showing the results of intracellular active oxygen assay of RAW264.7 and J774A.1 of the present invention;

wherein A: RAW264.7 cells; b: j774a.1 cells;

FIG. 8 is a graph showing the results of CFU experiments after the RAW264.7 and J774A.1 cells of the present invention are subjected to bacterial attack;

wherein, bCBB-WT: pCMV-HA-bCBB-WT; bCBB-mut: pCMV-HA-bCBB-mut.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Example 1

The present invention discovers a potential functional site of CYBB gene by the whole genome associated data GWAS and big data mining.

One potential critical missense mutation in the CYBB gene was mined from GWAS data from 52 bovine breeds worldwide, an allele mutation that was highly selected in european cattle and chinese cattle. The geographical distribution of the CYBB gene T and a alleles (c.105614637 a & T, rs 435291920) among 52 bovine breeds worldwide is shown in fig. 1; the site is leucine (L) in normal cattle and methionine (M) in tumor cattle. (note: tumor cattle have stronger anti-tuberculosis ability than normal cattle).

CYBB (Bos taurus, cytochrome b-245beta chain) CDS sequence: 1713bp.

Wherein, the 709 th site of CDS sequence is A, which is tumor cattle (single base missense mutation), and is shown in SEQ ID NO. 1. If the 709 th site of CDS sequence is T, it is normal bovine (wild type).

ATGGGGAACTGGGTTGTGAATGAGGGCATCTCCATCTTTGTCATTCTGGTATGGCTGGGGATGAACGTCTTCCTTTTTGTCTGGTACTACCGGGTTTATGATATCCCAGATAAGTTCTTTTACACTCGAAAACTTCTTGGGTCAGCGCTGGCCCTGGCCAGAGCCCCTGCAGCCTGCCTGAATTTCAACTGCATGCTGATTCTGCTGCCTGTCTGTCGAAATCTGCTCTCCTTCCTCAGGGGTTCCAGTGCGTGCTGCTCAACAAGAATTCGGAGACAACTGGACAGGAACCTCACCTTTCATAAAATGGTGGCATGGATGATTGCACTTCACACTGCAATTCATACCATTGCACATCTATTTAATGTGGAGTGGTGTGTGAATGCCCGAGTCAACAATTCTGATCCTTATTCAATAGCACTCTCTGACATTGGAGATAAGCCTAATGAAACTTACCTCAATTTTGTTCGACAGAGAATCAAGAATCCTGAAGGAGGCCTGTATGTGGCTGTGACTCGGTTGGCAGGCATCACTGGAGTCGTCATTACACTGTGCCTGATATTAATTATCACATCCTCCACCAAAACCATCCGGAGGTCTTATTTTGAAGTGTTTTGGTACACACACCATCTCTTTGTGATCTTCTTCATTGGTCTCGCCATCCATGGAGCTCAGCGGATTGTACGTGGGCAGACTGCAGAGAGTTTGATGAAACACCAACCAAGAAACTGTTATCAAAACATCTCACAGTGGGGAAAAATAGAGAACTGCCCAATCCCAGAGTTCTCTGGGAACCCTCCTATGACTTGGAAATGGATAGTGGGTCCC ATGTTCCTGTATCTCTGTGAGAGGTTGGTACGGTTTTGGAGATCTCAACAGAAGGTGGTCATCACCAAGGTGGTCACTCACCCTTTCAAAACCATCGAGCTCCAGATGAAGAAGAAAGGATTCAAGATGGAGGTGGGCCAATACATTTTCGTCAAGTGTCCCGTGGTGTCCAAGCTGGAGTGGCACCCTTTCACCCTGACCTCTGCCCCTGAGGAAGACTTCTTTAGCATCCATATCCGCATCGTGGGGGACTGGACAGAGGGACTCTTCAAAGCTTGTGGCTGTGATAAGCAGGAGTTTCAAGATGCCTGGAAACTACCAAAGATAGCTGTTGACGGGCCCTTTGGCACTGCCAGTGAGGACGTGTTCAGTTACGAGGTGGTGATGTTAGTGGGAGCAGGGATCGGGGTTACGCCCTTTGCATCCATCCTCAAGTCGGTCTGGTACAAATATTGCAATAAAGCCCCAAATCTGAGGCTCAAAAAGATCTACTTCTACTGGCTGTGCCGGGACACACATGCCTTTGAGTGGTTTGCGGACCTGCTGCAGCTGCTGGAAACACAGATGCAGGAGAAGAACAACACGGACTTCCTCAGCTACAACATCTGCCTCACTGGCTGGGATGAGTCTCAGGCCAGTCACTTTGCTATGCATCATGACGAGGAGAAAGATGTAATCACAGGCCTGAAACAAAAGACCTTGTATGGACGACCCAACTGGGATAACGAGTTCAAGACCATTGGAAGTCAACATCCCAATACCAGAATAGGAGTCTTCCTCTGCGGACCGGAAGCCTTGGCTGACACCCTTAATAAGCAGTGCATCTCCAACTCCGACTCTGGCCCCAGGGGAGTGCATTTCATTTTCAACAAGGAAAACTTCTAA；SEQ ID NO.1。

EXAMPLE 2 vector construction of bCBB-WT/mut

Vector construction of (one) bCBB-WT

1) Extracting bovine lung tissue RNA:

(1) Fresh fetal bovine lung tissue is put into a vacuum flask containing normal saline, sent into a laboratory within four hours, and washed three times by the normal saline with the temperature of 37 ℃ after 3 to 5 seconds of 75 percent alcohol;

(2) Placing the bovine fetal lung tissue into an ultra-clean workbench which is sterilized in advance, separating the bovine fetal lung tissue, placing into a 1.5mL EP tube, transferring into liquid nitrogen, pre-cooling a mortar with the liquid nitrogen, mixing and grinding the tissue and the liquid nitrogen, turning into a powder, adding into a l.5mL EP tube, adding 1mL Trizol, shaking and uniformly mixing, and standing at room temperature for 5min;

(3) Adding 200 mu L chloroform/tube, shaking vigorously for 15s, observing that it is fully emulsified, and standing on ice for 10min;

(4) Transferring the upper aqueous phase into a new 1.5mL EP tube at 4deg.C, 12000rpm/min,15 min;

(5) Adding 100 mu L of cold isopropanol/tube, reversing the tube upside down for 10-15 times, and then placing the tube on ice for 10min;

(6) Supernatant was removed by pipetting at 4℃at 12000rpm/min for 10min;

(7) 200. Mu.L of cold 75% ethanol/tube was added and gently mixed for 1min;

(8) Removing alcohol at 4deg.C, 7500rpm/min for 5min, and air drying RNA precipitate on ice;

(9) Add 40. Mu.L of DEPC H ₂ O dissolves RNA precipitate;

(10) Detecting the concentration of RNA by a spectrophotometer, and detecting whether the RNA is degraded by electrophoresis; 260/280 is between 1.8 and 2.0 without degradation.

2) RNA reverse transcription cDNA:

(1) The system for removing genomic DNA is shown in Table 1.

TABLE 1 reaction system

The PCR reaction conditions were: at 42℃for 2min.

(2) Reverse transcription reaction to obtain cDNA: to 16. Mu.L of the reaction solution obtained in the step (1), 4. Mu.L of 5X HiScript IIQrt superMix II (Novain Co.) was added and mixed, and the reaction conditions were set in a PCR apparatus as follows: incubating at 55 ℃ for 15min;85 ℃,5s.

3) PCR amplification was performed using cDNA as template:

the amplified template is cDNA of cattle lung, and cattle CYBB gene is amplified by PCR with 2X Taq PCR MasterMix, and the primer sequences are as follows:

pCMV-HA-bCYBB-WT-F：

5′-GTCGACgATGGGGAACTGGGTTGTGAA-3′；SEQ ID NO.2；

pCMV-HA-bCYBB-WT-R：

5′-GGTACCTTAGAAGTTTTCCTTGTTGA-3′；SEQ ID NO.3；

the reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

TABLE 2 PCR amplification System for target Gene

TABLE 3 PCR amplification reaction conditions for the target Gene

The PCR final product is detected by gel electrophoresis, and a 1713bp band is obtained.

4) Amplification product recovery and identification:

PCR amplified product gel recovery (OMEGA Gel Extraction Kit D2500)

(l) Under the UV irradiation of a gel imaging system, the target strip gel is inscribed for 40 seconds, and a 2mL EP tube is transformed;

(2) Adding Binding Buffer (XP 2) to cover the glue block completely, placing in a 55 deg.C heater, shaking slightly, dissolving gel completely, transferring to ice, and placing for 3min;

(3) Transferring the prepared HiBindcTMDNA column and collecting tube at 700 μl volume per time, centrifuging at 12000rpm/min for 30s, discarding the solution, and adding all sol solution;

(4) Adding 300 mu L XP2 into the adsorption column, centrifuging at 12000rpm/min for 1min, and discarding the liquid;

(5) Adding 700 mu L of SPW washing buffer into the column, washing at 12000rpm/min for 1min, and discarding the liquid;

(6) Repeating the step 5;

(7) Carrying out air separation at 12000rpm/min for 1min, spin-drying residual liquid, and discarding a collecting pipe;

(8) Transferring the adsorption column to a new 1.5mL centrifuge tube, adding 20 μL deionized H at 55deg.C after 2min in a 37 deg.C oven ₂ O,12000rpm/min, centrifuging for 2min, detecting the concentration of the product, and preserving at-20 ℃ for standby.

The gel recovery product was sent to Shanghai Biotechnology for sequencing.

5) The CYBB fragment with successful sequencing is constructed into pCMV-HA empty vector by SalI and KpnI enzyme digestion connection method to obtain pCMV-HA-bYBB-WT vector.

The target bands and the skeleton carrier were subjected to double enzyme digestion, and the enzyme digestion system is shown in Table 4.

TABLE 4 cleavage reaction System

Enzyme digestion reaction procedure: after incubation at 37℃for 1h in a PCR apparatus, agarose electrophoresis was performed to recover the band expected to give a 1713bp band.

And (3) carrier connection: vector construction was performed using the Renzan Ligation Mix DNA ligase kit. And (3) carrying out enzyme digestion on the linearized carrier: molar mass of 1 or more fragments = 1:3, followed by addition of homologous recombination enzymes, and incubation at 37℃for 30min in a PCR instrument. The connection system is shown in Table 5.

Table 5 connection system

The calculation formula is as follows: linearized vector mass= [0.02×vector base number ] ng, target fragment mass= [0.06×target fragment base number ] ng. Wherein the linearized vector pCMV-HA was used in an amount of 0.03pmol and the total amount of all inserted fragments of interest was 0.09pmol.

(II) constructing a bCBB-mut vector:

1) PCR amplification is carried out by taking pCMV-HA-bCBB-WT vector as a template, and the primer sequences are as follows:

pCMV-HA-CYBB-mut-F-1：

5′-GTCGACgATGGGGAACTGGGTTGTGAA-3′；SEQ ID NO.4；

pCMV-HA-CYBB-mut-R-1：

5′-TGGTGTTTCATCAAACTCTC-3′；SEQ ID NO.5；

pCMV-HA-CYBB-mut-F-2：

5′-GAGAGTTTGATGAAACACCA-3′；SEQ ID NO.6；

pCMV-HA-CYBB-mut-R-2：

5′-GGTACCTTAGAAGTTTTCCTTGTTGA-3′；SEQ ID NO.7。

the amplification system and reaction conditions are the same as those of the amplification CYBB gene, and the 1 fragment (primer pCMV-HA-bCBB-mut-F-1, pCMV-HA-bCBB-mut-R-1) and the 2 fragment (primer pCMV-HA-bCBB-mut-F-2, pCMV-HA-bCBB-mut-R-2) are respectively amplified. Fragments 1 and 2 both contain a T-A mutation site. The bCbYBB-mut fragment was then amplified using the 1 fragment upstream primer pCMV-HA-bCBB-mut-F-1 and the 2 fragment downstream primer pCMV-HA-bCBB-mut-R-2 as PCR primers and the 1 and 2 fragments as substrates. The enzyme digestion connection reaction system is the same as the above. And constructing the fragment with the enzyme cutting site into the pCMV-HA empty vector to obtain the pCMV-HA-bYBB-mut vector.

And (III) transformation, plating and shaking:

adding 10 μl of ligation reaction solution (wild type or mutant carrier) into 100 μl of newly thawed Trans1-T1 cells, gently blowing and sucking for several times, adding ice for 30min, adding into a water bath at 42deg.C for 90s, adding ice for 2min, adding 900 μl of resuscitation solution, shaking at 37deg.C at 200rpm/min for 1 hr; centrifuge at 12000rpm/min for 1min, discard 800. Mu.L of supernatant, gently blow and mix the rest of the liquid with a pipette, drop the mixture into LB agar plates with ampicillin resistance, spread evenly, and place the mixture in an incubator at 37℃overnight. After 8-12h, individual colonies of the appropriate size were picked with a 10. Mu.L tip and transferred into 500. Mu.L of ampicillin-resistant broth and incubated for 10h at 37℃in a constant temperature shaker at 200 rpm/min.

And (IV) bacterial liquid PCR identification and sequencing:

and (3) taking 1 mu L of bacterial liquid for PCR, carrying out agarose gel electrophoresis after the reaction system is the same as the PCR amplification system, selecting a sample consistent with the expected sample, taking 200 mu L of bacterial liquid for sequencing, and judging whether the carrier construction is successful. Sequencing results of pCMV-HA-bCBB-WT and pCMV-HA-bCBB-mut are shown in FIG. 2, indicating successful vector construction. The vector map is shown in FIG. 3.

(V) extraction of endotoxin removal plasmid:

the bacterial liquid which was successfully sequenced was subjected to amplification culture, and plasmids were extracted using the endotoxin removal plasmid miniprep kit E.Z.N.A.endo-free Plasmid Mini Kit I from OMEGA.

(1) Centrifuging the bacterial liquid of the expansion culture at the room temperature of 12000rpm/min for 5min, discarding the supernatant, and leaving a precipitate;

(2) Adding 500 mu L of Solution I into the sediment, lightly blowing until the mixture is completely mixed, and transferring the mixture to a 2mL EP tube;

(3) Adding 500 μl of Solution II, mixing up and down until the liquid becomes clear, and standing at room temperature for 2min;

(4) Adding 250 μl of precooled N3 Buffer, reversing to mix, and centrifuging at 12000rpm/min at 4deg.C for 10min;

(5) Transferring the supernatant to a new 2mL EP tube, adding 0.1 times volume of ETR liquid, and shaking up and down for 4 times during 10min on ice;

(6) Incubating at 42 ℃ for 5min, and centrifuging at 12000rpm/min at room temperature for 3min;

(7) Transferring the supernatant to a new 2mL EP tube, adding 0.5 times of absolute ethyl alcohol, and uniformly mixing at room temperature for 2min;

(8) Adding 700 mu L of liquid into a column and a tube each time, centrifuging at 12000rpm/min for 1min, discarding the waste liquid, and filtering to obtain a complete part of liquid;

(9) Adding 500 mu L of HB Buffer into the column to remove residual protein, centrifuging at 12000rpm/min for 1min at room temperature, and discarding the waste liquid;

(10) Adding 700 mu L DNA Wash Buffer, and centrifuging at 12000rpm/min for 1min at room temperature;

(11) Repeating (10), carrying out air separation at 12000rpm/min for 2min, and putting into a baking oven at 37 ℃ for 2min;

(12) Adding 30 mu L of triple distilled water at 56 ℃ into an adsorption column, centrifuging at 12000rpm/min for 2min to obtain pCMV-HA-bCBB-WT and pCMV-HA-bCBB-mut plasmids respectively, and measuring the concentration for subsequent experiments.

EXAMPLE 3 culture of tubercle bacillus and cell infection

The mouse macrophages RAW264.7 and J774A.1 cells were used as cell models, respectively, the tuberculosis strain H37Ra was purchased from American standard cell bank (ATCC 25177), cultured in 7H9 culture medium (Fluka-SigmaAldrich, USA) at 37℃for a logarithmic period, H37Ra (this is 0 point) was added at a MOI of 20 (cell number: bacterial number=1:20), incubated at 37℃for 4 hours, then washed 3 times with PBS to remove uninfected bacteria, and fresh culture medium was replaced with DMEM cell culture medium containing 50. Mu.g/mL gentamycin after 1 hour of action to continue culturing the cells. The operation flow of the tapping experiment is used for the tapping experiment of the subsequent embodiment. 7H9 liquid medium: 90ml water+0.47 g 7H9+80. Mu.l Tween; the temperature was reduced to 60 mu or less after autoclaving, 10ml of one-tube stock solution from Kasolebao and 2ml of hydrogen peroxide solution. The 7H9 reagent was purchased from Millipore Sigma.

Example 4Ferroorange intracellular ferrous ion fluorescent Probe detection experiment

Iron is the most abundant transition metal element in organisms and is involved in various physiological process activities. In recent years, free iron in living cells has received a great deal of attention, and is most often present in its stable redox state, i.e., ferrous (Fe ²⁺ ) And iron ions (Fe) ³⁺ ). For researchers, in studying the intracellular reducing environment, metal transporters and Fe ²⁺ To understand Fe when it is water-soluble ²⁺ Behavior ratio of (1) understanding Fe ³⁺ Is more important. Ferroorange as a novel fluorescent probe for Fe in living cells ²⁺ Fluorescence imaging was performed.

The required materials are as follows: dimethyl sulfoxide (DMSO), dimethylformamide (DMF) or ethanol, HBSS, serum-free culture medium, micropipette

Preparing a solution: 35. Mu.l of DMSO was added to a tube containing 24. Mu.g of Ferroorange, and the mixture was stirred with a pipette to prepare a 1mmol/l Ferroorange solution. 1mmol/l of Ferroorange solution was diluted with HBSS (or serum-free medium) solution to prepare 1. Mu. Mol/l of Ferroorange working solution. (DMF or ethanol can also be used instead of DMSO. This solution is stable for 1 month at-20 ℃ C. 1mol/l Ferroorange working fluid is unstable. It is needed to be ready to use and used as soon as possible. Serum free medium can be used instead of HBSS, serum increases background if necessary).

The operation steps are as follows:

1) RAW264.7 and J774A.1 cells were inoculated, respectively, into fluorescent dishes at 37℃with 5% CO ₂ Culturing in an incubator overnight.

2) The supernatant was discarded and the cells were washed 1 time with PBS.

3) Replacement of fresh DMEM cell Medium, use3000 reagents, pCMV-HA empty, pCMV-HA-bYBB-WT and pCMV-HA-bYBB-mut plasmids were transfected into cells, respectively, according to the reagent instructions, at 37℃with 5% CO ₂ After culturing in an incubator for 24 hours, a challenge experiment of the Mycobacterium H37Ra was performed.

4) At 36h of challenge, the medium was removed and washed 3 times with HBSS or serum-free medium.

5) Adding Ferroorange working solution with concentration of 1 μmol/l (optimal dyeing concentration can be found in the range of 1-5 μmol/l if light is weak), heating to 37deg.C, and adding 5% CO ₂ Incubate in incubator for 30 minutes. * The culture is directly observed after the culture without cleaning.

6) The cells were observed under a fluorescence microscope and the results are shown in FIG. 4. The results in FIG. 4 show that bCYBB-mut significantly reduced intracellular, greatly increased ferrous ions in both macrophages due to Mycobacterium tuberculosis infection (orange fluorescence is ferrous ion staining).

Example 5RAW264.7 and j774a.1 intracellular total iron and ferrous determination

By means ofCell total iron colorimetric assay kit (Cell Total Iron Colorimetric Assay Kit), ->Cell ferrous colorimetric test box (Cell Ferrou)s Iron Colorimetric Assay Kit) is measured as described, with a microplate reader (590-600 nm, optimum detection wavelength 593 nm).

The cells were collected 1, 6, 12, 24, 36 and 48 hours after the challenge, and the intracellular total iron and ferrous ion content was measured according to the total iron and ferrous kit described above, respectively, using mouse macrophage RAW264.7 and j774a.1 cells as cell models, respectively transfected with pCMV-HA empty, pCMV-HA-bCYBB-WT and pCMV-HA-bCYBB-mut plasmids, and the results are shown in fig. 5. Finding wild type (bCBBB-WT) and c.105614637A of bovine CYBB Gene&The T single base mutant (bYBB-mut) can extremely obviously reduce intracellular Fe in 24H of H37Ra infection ²⁺ Is a concentration of (2); however, bCBB-WT extended intracellular Fe of the cells 24h after infection ²⁺ The content of bCYBB-mut can obviously reduce intracellular Fe after 24h infection compared with pCMV-HA empty load and bCYBB-WT ²⁺ Is contained in the composition.

Examples 6RAW264.7 and j774a.1 intracellular lipid peroxide assays

Malondialdehyde (MDA) is a compound formed after decomposition of lipid peroxides. Therefore, MDA is one of the most common indicators for detecting lipid peroxides in cells and tissues, and is widely used in research in the fields of oxidative stress, iron death, and the like. MDA Assay Kit can detect MDA concentration in a sample, and Malondialdehyde (MDA) in the sample is detected by absorbance or fluorescence intensity of a thiobarbituric acid (TBA) complex formed by the reaction of TBA with MDA generated by hydrolysis. The experiment was designed as five replicates of 4 samples each.

The operation steps are as follows:

(1) Substrate stock solution to the reagent kit of the Substrate tube (red cover) added to 400 u l DMSO, ultrasonic vibration to complete dissolution. * The prepared Substrate stock solution is stored at-20deg.C. (can be stably stored for 2 months)

(2) Preparation of Antioxidant PBS solution: PBS was added to the microtubes. Add the anaxidant to the PBS containing tube and mix well.

(3) Preparation of Working solution: diluionBuffer is added to the conical tube. To the conical tube containing the division Buffer was added the Substrate. * The prepared Working solution cannot be stored for a long time and is used up in the same day.

(4) Preparation of cell samples: 1) Cell suspension (RAW 264.7: 2.5X10 ⁷ cells，J774A.1：1.5×10 ⁷ cells) was added to a 1.5ml microtube; 2) The supernatant was removed by centrifugation at 300 Xg for 5min. 3) After adding 1ml of PBS and blowing to form a uniform cell suspension, the supernatant was removed by centrifugation at 300 Xg for 5min. 4) 100 mu l Antioxidant PBS solution is added, and the mixture is blown and evenly mixed.

(5) And (3) detection: 1) 100. Mu.l of Lysis Buffer was added to the sample tube and the standard tube, and the mixture was thoroughly mixed with a vortex oscillator and allowed to stand at room temperature for 5 minutes. * Because the viscosity of the solution is high, the solution cannot be fully and uniformly mixed by blowing, and a vortex oscillator is required to be used. 2) 250 mu l Working solution was added to each microtube and thoroughly mixed with a vortex shaker. 3) Culturing at 95deg.C for 15min. 4) Cooling on ice bath for 5min. 5) Centrifuge 10,000Xg for 10min. Mu.l of the supernatant was applied to a 96-well plate (blackboard). 6) Fluorescence intensity was measured by a fluorescence microplate reader (Ex: 540nm, em: 540 nm).

As shown in FIG. 6, the results are shown in FIG. 6, which shows that the intracellular excess lipid peroxide malondialdehyde MDA caused by Mycobacterium tuberculosis infection can be significantly reduced by using the mouse macrophage RAW264.7 and J774A.1 cells as cell models, dividing the experiment into four groups such as Control, and respectively transfecting pCMV-HA empty, pCMV-HA-bYBB-WT and pCMV-HA-bYBB-mut plasmids.

Examples 7RAW264.7 and j774a.1 intracellular active oxygen assay

ROS (Reactive Oxygen Species) is mainly a high reactive oxygen species produced when ATP is synthesized in mitochondria. ROS play an important role in immune functions such as intracellular signaling and phagocytosis. On the other hand, the oxidative effect of ROS on DNA and proteins is also one of the causes of various diseases and cellular aging. Recent studies have found that ROS are also of great interest in the field of research on a new cell death mode (iron death) caused by the Fenton reaction induced by ferrous iron, and the need and significance of detecting ROS are also increasing. Currently, the most used reagent in detecting ROS is DCFH-DA. However, DCFH-DA often has the problems of low sensitivity, insignificant difference between sample fluorescence and background, etc. The ROS Assay Kit-Highly Sensitive DCFH-DA high-sensitivity Reactive Oxygen Species (ROS) detection Kit is a high-sensitivity ROS detection Kit, and can detect ROS with high sensitivity under relatively lower cytotoxicity by matching the Buffer attached in the Kit.

The operation steps are as follows:

(1) Loading Buffer solution preparation: the Loading Buffer (10 x) was 10-fold diluted with ultrapure water to prepare Loading Buffer solution.

(2) Highly Sensitive DCFH-DA Working solution: highly Sensitive DCFH-DA Dye was diluted Loading Buffer solution times to prepare a Working solution.

(3) Cell treatment: after 36h of tapping on RAW264.7 and j774a.1 cells transfected with bCYBB, the medium was removed and the cells were washed 2 times with PBS. Removing supernatant, adding prepared Working solution,37 deg.C, 5% CO ₂ Culturing in an incubator for 30min. The Working solution was removed, the cells were washed 2 times with PBS and then again PBS was added for detection under a laser confocal microscope (Ex: 48nm; em:500-550 nm).

Taking mouse macrophage RAW264.7 and J774A.1 cells as cell models, dividing the experiment into four groups of Control and the like, and respectively transfecting pCMV-HA empty, pCMV-HA-bYBB-WT and pCMV-HA-bYBB-mut plasmids in the experimental groups; the experimental results are shown in FIG. 7, in both macrophages, CYBB-mut significantly reduced reactive oxygen species ROS (green fluorescence) released by intracellular mitochondria due to Mycobacterium tuberculosis infection.

Example 8RAW264.7 and J774A.1 post-cell-tapping CFU experiments

Colony forming units (CFU, colony forming units), which means each colony formed after a certain temperature and time of culture on an agar plate, are units for counting the number of bacteria or mold.

(1) In a 12Well plate according to RAW264.7: 6X 10 ⁵ Individual/well, j774a.1: 2.9X10 ⁵ Cells were plated per well. Tapping is completed (4 h, 12h, 24h, 36h, 48h, 72 h). PBS is washed for 3-5 times;

(2) Cells were lysed by adding 1ml of 0.1% Triton X-100 PBS, lysed for 5min at room temperature, spun down 4500g for 5min, the supernatant discarded and the pellet resuspended in 100. Mu.l PBS (stock).

(3) According to different tapping time, diluting the stock solution to 10 in 4h of tapping ^-1 Diluting the stock solution to 10 in 12h ^-2 Diluting the stock solution to 10 in 24 hours ^-2 Diluting the stock solution to 10 in 36h ^-3 Diluting the stock solution to 10 in 48h ^-4 Diluting the stock solution to 10 in 72h ^-4 The collected stock solutions were diluted to different orders of magnitude and plated in 7H10 solid medium, and the culture was performed for 3 days to count the number of individual colonies.

(7H 10 solid Medium: 90ml ddH ₂ O+1.947g 7H10+500. Mu.l glycerol; the temperature is reduced to below 60 ℃ after high-pressure sterilization, 10ml of one-tube bacteria increasing liquid and 2ml of hydrogen peroxide liquid of Soy Co are added, and after uniform mixing, the mixture is poured into a plate for four-degree storage); the 7H10 reagent was purchased from Millipore Sigma.

The experimental results are shown in FIG. 8, in both macrophages, CYBB-mut significantly reduced the intracellular proliferation of Mycobacterium tuberculosis.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims (8)

1. The single base missense mutation of bovine CYBB gene is characterized in that the nucleotide sequence of the single base missense mutation bovine CYBB gene is shown as SEQ ID NO. 1.

2. A vector comprising a single base missense mutation of the bovine CYBB gene of claim 1.

3. A host bacterium comprising a single base missense mutation of the bovine CYBB gene of claim 1.

4. Use of a single base missense mutation of the bovine CYBB gene of claim 1, the vector of claim 2 or the host bacterium of claim 3 in the preparation of an anti-tuberculosis formulation.

5. Use of a single base missense mutation of the bovine CYBB gene of claim 1, the vector of claim 2 or the host bacterium of claim 3 for the preparation of a formulation against mycobacterium tuberculosis infection.

6. Use of a single base missense mutation of the bovine CYBB gene of claim 1, the vector of claim 2 or the host bacterium of claim 3 for the preparation of a formulation for reducing proliferation of mycobacterium tuberculosis in macrophages.

7. The use according to claim 6, wherein the single base missense mutation of the bovine CYBB gene reduces proliferation of mycobacterium tuberculosis in macrophages by controlling host iron death.

8. Use of the single base missense mutation of the bovine CYBB gene of claim 1, the vector of claim 2 or the host bacterium of claim 3 in anti-tuberculosis cow breeding.