CN117730156A - Double-stranded DNA (deoxyribonucleic acid) joint for preparing DNA nanospheres, preparation method thereof, kit and application of double-stranded DNA joint - Google Patents

Double-stranded DNA (deoxyribonucleic acid) joint for preparing DNA nanospheres, preparation method thereof, kit and application of double-stranded DNA joint Download PDF

Info

Publication number
CN117730156A
CN117730156A CN202280048808.XA CN202280048808A CN117730156A CN 117730156 A CN117730156 A CN 117730156A CN 202280048808 A CN202280048808 A CN 202280048808A CN 117730156 A CN117730156 A CN 117730156A
Authority
CN
China
Prior art keywords
strand
double
stranded dna
dna
sequencing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280048808.XA
Other languages
Chinese (zh)
Inventor
杨林
杨贵芳
聂自豪
张韶红
张艳艳
吕硕
王业钦
陈芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MGI Tech Co Ltd
Original Assignee
MGI Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by MGI Tech Co Ltd filed Critical MGI Tech Co Ltd
Publication of CN117730156A publication Critical patent/CN117730156A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a double-stranded DNA joint for preparing a DNA nanosphere, a preparation method thereof, a kit and application thereof. Specifically, the double-stranded DNA adaptor for preparing a DNA nanosphere, wherein the double-stranded DNA adaptor has a first strand and a second strand that are complementary, wherein the first strand and the second strand each independently have a 3 'cohesive end at a 3' end; the second strand, and optionally the first strand, has a phosphorylation modification at the 5' end; and an optional notch is provided in the second strand, provided that when the first strand has a phosphorylated modification at the 5' end, the second strand has at least one of the notches.

Description

Double-stranded DNA (deoxyribonucleic acid) joint for preparing DNA nanospheres, preparation method thereof, kit and application of double-stranded DNA joint
PRIORITY INFORMATION
The priority and rights of the patent application number 202111161067.X filed on the year 09 and 30 of the present application request 2021 to the chinese national intellectual property office are incorporated herein by reference in their entirety.
Technical Field
The invention relates to a double-stranded DNA joint for preparing a DNA nanosphere, a preparation method thereof, a kit and application thereof. The invention is useful for applications in molecular biology, in particular for preparing DNA libraries.
Background
Along with the development of high-throughput gene sequencing technology, the gene sequencing cost is rapidly reduced, but the pretreatment of a second-generation sequencing sample, namely the preparation cost of a library, is still high, the process is still complex, and the sample treatment before sequencing becomes a bottleneck for restricting the large-scale application of the gene sequencing technology.
Multiple steps are required before and after preparation of the library, including DNA fragmentation, end repair, end addition a, linker ligation and PCR. The process is complicated, time-consuming and labor-consuming, and delays the research process to a certain extent.
Hua Dazhi the sequencing principle based on DNB (DNA Nano Ball) is adopted in the base signal amplification process, and the sequencing accuracy of the DNBSEQ sequencer is better than that of a bridge-based exponential amplification method (such as Illumina). The existing library preparation technology of the DNBSEQ platform comprises DNA fragmentation, end repair and end addition A, linker connection, PCR, library cyclization and DNB preparation, and the whole process comprises 6 steps, however, compared with library preparation methods of other platforms, the library preparation method of the platform has one more annular library preparation and nanosphere preparation process, and the sequencing accuracy is improved, but the library preparation link is correspondingly more complicated, and the burden of sample pretreatment is increased.
In addition, conventional library preparation requires a large amount of DNA input to meet the final library sequencing due to the number of steps, some of which are inefficient in DNA utilization, such as cyclization steps. And the trace DNA can meet the requirement of the machine after PCR.
Disclosure of Invention
Based on the inventor, the library construction method is optimized, the existing method for connecting the joints of the DNBSEQ library is based on linear bubble primers, and the greatest disadvantage of the method is that the DNB library can be prepared only by carrying out PCR and then carrying out special cyclization steps. The inventor develops a preparation method based on a linear library, and completes the cyclization of the library and the preparation of DNB simultaneously when the linker connection is carried out, thereby greatly reducing the steps of library preparation, improving the utilization efficiency of DNA, meeting the library construction requirement of trace nucleic acid, ensuring the original DNA information of the nucleic acid to the greatest extent without PCR step and avoiding library deviation caused by the PCR process.
In one aspect, the present invention provides a double-stranded DNA adaptor suitable for preparing a DNA nanosphere, the double-stranded DNA adaptor having first and second complementary strands, wherein the first and second strands each independently have a 3 'cohesive end at the 3' end; the second strand, and optionally the first strand, has a phosphorylation modification at the 5' end; and an optional notch is provided in the second strand, provided that when the first strand has a phosphorylated modification at the 5' end, the second strand has at least one of the notches.
In certain embodiments, the second strand has 1 to 5 gaps, alternatively 1, 2, or 3 gaps.
In certain embodiments, the gap is 1 to 20 bases in length, e.g., the gap is 2, 3, 4, 6, 7, 8, 9, 10, 11, 12, 13, 14, 16, 17, 18, or 19 bases in length.
In certain embodiments, the gap is 5 to 15 bases in length.
In certain embodiments, the first strand comprises at least one tag sequence.
In certain embodiments, the second strand comprises at least one tag sequence complementary to the tag sequence of the first strand or has the gap in at least one region corresponding to the tag sequence of the first strand.
In certain embodiments, the second strand comprises at least one tag sequence and/or notch.
In certain embodiments, the tag sequence of the first strand is complementary to the tag sequence of the second strand.
In certain embodiments, the position of the notch corresponds to the tag sequence of the first strand. The gap of the second strand corresponds to the tag sequence of the first strand, so that the variety of the oligo can be reduced, and the cost can be reduced.
In certain embodiments, the second strand has the gap in at least one region corresponding to the tag sequence of the first strand.
In certain embodiments, the 3' cohesive ends of the first strand and the second strand are both bases T.
In certain embodiments, the double-stranded DNA adaptor is selected from at least one of a, b, c, d, e, f, g and h as shown in fig. 4. The linker can be provided with a split, and the displacer can carry out strand displacement and decomplexing reaction from the split of the linker, thereby realizing the extension of DNA and obtaining DNB products. The method has the advantages of greatly reducing the steps of library preparation, improving the utilization efficiency of DNA, meeting the requirement of library construction of trace nucleic acid, ensuring the original DNA information of the nucleic acid to the greatest extent without a PCR step, and avoiding library deviation caused by the PCR process.
In certain embodiments, the double-stranded DNA adaptor is adaptor 1, adaptor 2, adaptor a or adaptor B. The linker can be provided with a split, and the displacer can carry out strand displacement and decomplexing reaction from the split of the linker, thereby realizing the extension of DNA and obtaining DNB products. The method has the advantages of greatly reducing the steps of library preparation, improving the utilization efficiency of DNA, meeting the requirement of library construction of trace nucleic acid, ensuring the original DNA information of the nucleic acid to the greatest extent without a PCR step, and avoiding library deviation caused by the PCR process.
In another aspect, the present invention provides a method for preparing the double-stranded DNA adaptor described above, comprising equimolar mixing single-stranded DNA molecules having the first strand and the second strand, and annealing the mixture to obtain the double-stranded DNA adaptor.
In some embodiments, the single-stranded DNA molecules corresponding to table a are equimolar mixed and then annealed to obtain the double-stranded DNA adaptor a, wherein the B sequence represents a DNA sequence corresponding to a tag sequence (Barcode), and "B" may be any base.
Table A
In certain embodiments, the single-stranded DNA molecules corresponding to table B are equimolar mixed and then annealed to obtain the double-stranded DNA adaptor B, wherein the B sequence represents a DNA sequence corresponding to a tag sequence (Barcode), and "B" may be any base.
Table B
In still another aspect, the present invention provides a method of preparing a DNA nanosphere, comprising:
performing a ligation reaction on a double-stranded nucleic acid molecule with the double-stranded DNA adaptor to obtain a circular ligation product, the double-stranded nucleic acid molecule having two 3' nucleobases, the two 3' nucleobases matching the 3' cohesive end of the double-stranded DNA adaptor, the circular ligation product having at least one nick or notch; and
at least one round of rolling circle replication is performed on the circular ligation product to obtain the DNA nanospheres.
In certain embodiments, the ligation reaction and the rolling circle replication are performed in the same reaction system.
In certain embodiments, the rolling circle replication employs a polymerase with strand displacement activity, optionally the polymerase comprises at least one of Phi29, bst, and Bsm, and/or the ligation employs an ATP-dependent ligase comprising a T4 ligase.
In certain embodiments, the rolling circle replication is performed for 300 to 500 rounds.
In certain embodiments, the DNA nanospheres have a diameter of 200 to 250 nanometers.
In certain embodiments, the double-stranded nucleic acid molecule is obtained by a fragmentation, cleavage, or PCR amplification reaction.
In yet another aspect, the invention provides a sequencing method comprising:
preparing DNA nanospheres according to the method; and performing a sequencing reaction based on the DNA nanospheres.
In certain embodiments, the sequencing reaction may be adapted to be performed on a CG or MGI sequencing platform.
In certain embodiments, the sequencing reaction uses MDA-PE method for sequencing.
In yet another aspect, the invention provides a kit comprising: the double-stranded DNA adaptor; an alternative DNA ligase which is an ATP dependent ligase; and optionally a polymerase having strand displacement activity.
In certain embodiments, the DNA ligase and the polymerase are disposed in the same container.
In a further aspect, the invention provides the use of the double stranded DNA adaptor described above, the kit described above, in the construction of a sequencing library suitable for MDA-PE sequencing or sequencing on a CG or MGI sequencing platform.
Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.
The method for constructing the sequencing library has the following advantages: (1) The original cyclization step is not needed, the addition of the connector is completed in the connector connection process, the cyclization of molecules and the preparation of the DNA nanospheres are completed; (2) The PCR amplification step can be avoided, and the amplification error and deviation introduced by PCR can be reduced; (3) The method reduces the original 6-step reaction to the existing 2-step independent reaction, reduces the time, simplifies the steps, reduces the loss of samples among the steps, and improves the utilization efficiency of sample templates; (4) Double-chain connection cyclization is adopted, so that GC preference is reduced, denaturation and quenching are needed in a conventional single-chain cyclization mode, a template with high GC is easy to renature in the quenching process, cyclization is impossible, genome data of a high GC region is low, and a double-chain cyclization process without denaturation annealing is adopted, so that GC preference can be improved.
Drawings
The foregoing and/or additional aspects and advantages of the invention will become apparent and may be better understood from the following description of embodiments taken in conjunction with the accompanying drawings in which:
fig. 1 is a schematic structural view of a joint 1 of embodiment 1;
fig. 2 is a schematic structural view of the joint 2 of embodiment 1;
FIG. 3 is a schematic diagram of a method for preparing DNA nanospheres using the present invention;
FIG. 4 is a schematic diagram of a double-stranded DNA adaptor according to the present invention.
Detailed Description
Embodiments of the present invention are described in detail below. The following examples are illustrative only and are not to be construed as limiting the invention.
It should be noted that the terms "first," "second," and "second" are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implying a number of technical features being indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature. Further, in the description of the present invention, unless otherwise indicated, the meaning of "a plurality" is two or more.
The scheme of the present invention will be explained below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
Example 1: preparation of DNA linker
The three single-stranded oligos, linker 1 used in the following examples was annealed by equimolar mixing using 3 single-stranded oligos shown in Table 1 to give linker 1; the structure of the joint 1 is shown in fig. 1.
The linker 2 used in the following examples was prepared by mixing and annealing the two single-stranded oligos in equimolar amounts using the 2 single-stranded oligos shown in Table 2; the structure of the joint 2 is shown in fig. 2.
Both the linker 1 and the linker 2 can provide a split, and the substitution enzyme can perform strand substitution and polymerization reaction from the split of the linker to realize extension of DNA and obtain DNB products, so that the above four linkers can be applied to the following examples to achieve the corresponding experimental effects.
TABLE 1 linker 1 sequence
TABLE 2 linker 2 sequence
Remarks: within brackets are tag sequences
Example 2
2.1 Experimental design
DNA fragmentation is carried out on NA12878 commercial standard DNA, 10ng is taken, then DNA is respectively subjected to whole genome library preparation according to an invention method and a conventional method, and the library is subjected to on-machine sequencing on a DNBSEQ-2000 sequencer, sequencing type PE100 and sequencing depth of 30X, and then data analysis is carried out, wherein the performances comprise data utilization rate, comparison rate, repetition rate, GC preference and the like.
2.2 comparative example 1: conventional whole genome library preparation
Based on the way the single-ended cohesive end-linker is attached, the pooling step comprises fragmentation, end repair plus A, single-ended cohesive end-linker attachment, PCR, product cyclization and DNB preparation.
DNA is derived from a commercial standard (NA 12878), and a conventional library construction mode adopts a Shenzhen Dazhihua Zhizhen science and technology Co., ltd. Library construction kit (MGIEasy general DNA library preparation kit V1.0, MGIEasy cyclization kit) to carry out library preparation strictly according to the operation of a specification.
Limitations: (1) The whole library preparation process is more, the total number of the independent operations is 6, the operation is complex, the cost is higher, and the time consumption is longer; (2) With the PCR process, amplification bias and errors are additionally introduced.
2.3 experimental group 1: whole genome library preparation
2.3.1 DNA fragmentation, end repair and ADNA addition were derived from commercial standards (NA 12878), and disruption, end repair and A-tailed reactions were performed using the reagent from Syzygium Aristolochia, inc. (kit nameBuffer, cat. No. 12609ES 24), the reaction system was configured according to table 3, and the reaction was performed according to the procedure of table 4.
The obtained DNA product was subjected to bead purification by adding 24. Mu.L of XP beads (Beckman company Agencourt AMPure XP magnetic beads, cat. No. A63881) and the product was dissolved in 39.5. Mu.L of TE buffer.
TABLE 3 Table 3
DNA(10ng) 22.5μL
Breaking buffer 5μL
Enzymes 2.5μL
Co-production 30μL
TABLE 4 Table 4
4℃ 1min
30℃ 6min
65℃ 20min
2.3.2 ligation and cyclization reactions and nanosphere preparation
Either method one or method two may be used to attach and cyclize the reaction and produce the nanospheres.
The method comprises the following steps: the DNA fragment obtained in the previous step was prepared into a system for preparing a ligation and nanospheres in a 200. Mu.L centrifuge tube according to the reaction system of Table 5, reacted on a PCR instrument, reacted according to the procedure of Table 6, and after completion of the reaction, 10. Mu.L of 10mM EDTA was added to terminate the reaction, thereby obtaining a prepared nanosphere.
The second method is as follows: the DNA fragment obtained in the previous step was prepared into a system for preparing a ligation and nanospheres in a 200. Mu.L centrifuge tube according to the reaction system of Table 7, reacted on a PCR instrument, reacted according to the procedure of Table 8, and after completion of the reaction, 10. Mu.L of 10mM EDTA was added to terminate the reaction, thereby obtaining a prepared nanosphere.
Enzymes used in method one and method two:
t4DNA Ligase Ligase (name T4DNA Ligase (Rapid), cat# L6030-HC-L) from enzyme company, T4DNA Ligase concentration: 400U/ul;
phi29 is prepared by Shenzhen Huazhi Dazhisha technology Co., ltd (name Phi29 DNA Polymerase, cat# BGE 002A), and the concentration of Phi 29: 10U/ul;
1X PHI29 buffer：50mM Tris-HCl，10mM MgCl 2 ，10mM(NH 4 ) 2 SO 4 ，4mM DTT；
BST enzyme was obtained from NEB company (name Bst 3.0 DNA Polymerase, cat. M0374S).
TABLE 5
DNA 38.5μL
10×phi29 buffer 5μL
T4 DNA Ligase 2.5μL
Joint 1 or 2 (concentration 2. Mu.M) 1μL
ATP(0.1M) 1μL
Phi29 polymerase 2μL
Co-production 50μL
TABLE 6
30℃ 25min
TABLE 7
DNA 38.5μL
10×phi29 buffer 5μL
T4 DNA Ligase 2.5μL
Joint 1 or 2 (concentration 2 uM) 1μL
ATP(0.1M) 1μL
BST 2μL
Co-production 50μL
TABLE 8
30℃ 15min
65℃ 25min
4℃ Hold
2.3.3 on-machine sequencing
The DNB products obtained by method one or method two were quantified and on-boarding on the DNBSEQ platform, the DNB products sequenced on this time were obtained by method two in 2.3.2, with run 1-linker 1 using linker 1 and run 1-linker 2 using linker 2, and the following data analysis was obtained.
2.3.4 data analysis
The analysis step included the step of filtering the adaptor primer sequences, the comparative basis, using FastQC (version v 0.11.8) to evaluate the overall sequencing quality of MGI, and using PRINSEQ (version v 0.20.4) to detect PCR repeats. The filtering of the raw data was performed using NGS QC Toolkit (version v 2.3.3). The data remaining after removal of the low quality and data carrying the joint will be subjected to the next analysis step-comparison. The study uses the mem module of BWA (version v0.7.12) to align the filtered data to the human genome (version GRCh 38), repeated labeling using Picard (version v2.6.0), local realignment and recalibration of the alkali matrix values using GATK (version v 3.3). And SNP and InDel mutation detection was performed using GATK, and the resulting mutation file was annotated with the dbSNP library. Overlay analysis was performed using SAMtools (version v 1.9).
As can be seen from tables 9 and 10: experiment group 1-linker 1 and experiment group 1-linker 2 can greatly simplify the experimental procedure and can effectively improve sequencing performance, wherein the repetition rate (duplicate rate) is much smaller than that of comparative example 1, and the number of detected mutations (Total SNPs and Total indexes) is also larger than that of comparative example 1.
Table 9: off-line data statistics
Table 10: mutation analysis
Example 3
3.1 Experimental design
A plurality of pairs of primers are designed for the HBB gene (Table 11), the amplified product of the primers covers the whole HBB gene, and all primers have phosphorylation modification at the 5-end. PCR amplification and DNA nanosphere library preparation were performed using 10ng commercial standard NA12878, and the prepared library was run on a DNBSEQ-2000 sequencer for on-machine sequencing, sequencing type PE100, sequencing data 0.1M reads, and then data analysis, including coverage, data utilization, comparison, etc.
3.2 comparative example 2: capture library preparation based on multiplex PCR
Based on the connection mode of the single-end sticky end connector, the library building step comprises PCR, end repair and A, connection of the single-end sticky end connector, PCR, cyclization of a product and DNB preparation.
The conventional library construction method adopts a Shenzhen Dazhizhen manufacturing science and technology Co., ltd. Library construction kit (MGIEasy general DNA library preparation kit V1.0) to carry out library preparation strictly according to the operation of the specification.
Limitations: the whole library preparation process is more, the total operation is 6 independent steps, the operation is complex, the cost is higher, and the time consumption is longer.
3.3 experimental group 2: capture library preparation based on multiplex PCR
3.3.1 multiplex PCR amplification
DNA was obtained from commercial standard (NA 12878), and multiplex PCR amplification (name Multiplex PCR Readymix, cat. No. 01K02301 MM) was performed using multiple PCR enzymes of Shenzhen Dazhisha Zhizhen technology Co., ltd.) in a reaction system shown in Table 11, and the reaction was performed according to the procedure shown in Table 12, thereby obtaining a DNA product.
The obtained DNA product was subjected to bead purification by adding 60. Mu.L of XP beads (Beckman company Agencourt AMPure XP magnetic beads, cat. No. A63881) and the product was dissolved in 39.5ul of TE buffer.
TABLE 11
DNA(10ng) 1μL
2XPCR amplification system 25μL
Forward primer pool 2.5μL
Reverse primer pool 2.5μL
Distilled water 19μL
Co-production 50μL
Note that: primer pool information is shown in Table 13
Table 12
Table 13: HBB primer information
ID SEQ
HBB-F1 5phos/CAAAGCAAGACCCCATCTCTTA
HBB-F2 5phos/ATATAGCTTCTTGGCTATGACGGG
HBB-F3 5phos/GTTTGCTGTAGAGGCAGATGTTAATTTC
HBB-F4 5phos/CACATTGCATTTCTCTGATTCTGACTC
HBB-F5 5phos/GTGTAATCACAGGACCTTCAAAAGATG
HBB-F6 5phos/GCTGGTGCCTCGATATTCG
HBB-F7 5phos/GAAACAACAGATTATTGCTGATGGTTCTA
HBB-F8 5phos/TTCAGCCTCCCGATTAGCTAG
HBB-F9 5phos/ACGGTGAAACCCTGTCTTTACTAAATA
HBB-F10 5phos/AATCTCTCACCCCTAACACCAGATT
HBB-R1 5phos/GTTAACCCTGTGCGGCACT
HBB-R2 5phos/CTCCATCACATCTCCCTATTTCCTTAC
HBB-R3 5phos/GTTCCAGAGATTAGGATATGGACATCG
HBB-R4 5phos/GTATTACCTTGTAGTAGGTGGCGTAATG
HBB-R5 5phos/GCTTAAACAATGTACATTTACTTCCTTGTAGT
HBB-R6 5phos/CAACACCTTGATTTTAGCCCATCTTG
HBB-R7 5phos/TAACCCCAAGGGGATGGTATC
HBB-R8 5phos/CACCCTCATGACCTAATCACCTTG
HBB-R9 5phos/CTGAACACTGCTCCAGAACATAAGA
HBB-R10 5phos/GGGGATACAAACATTCAATTTATGACACC
3.3.2 ligation and cyclization reactions and nanosphere preparation
Either method one or method two may be used to attach and cyclize the reaction and produce the nanospheres.
The method comprises the following steps: the purified DNA fragment obtained in the previous step was subjected to a reaction on a PCR apparatus by the procedure of Table 15 by preparing a ligation and nanosphere preparation system in a 200. Mu.L centrifuge tube according to the reaction system of Table 14, and after completion of the reaction, 10. Mu.L of 10mM EDTA was added to terminate the reaction.
The second method is as follows: the purified DNA fragment obtained in the previous step was subjected to a reaction on a PCR apparatus by the procedure of Table 17 by preparing a ligation and nanosphere preparation system in a 200. Mu.L centrifuge tube according to the reaction system of Table 16, and after completion of the reaction, 10. Mu.L of 10mM EDTA was added to terminate the reaction.
In the first and second methods, enzymes are used:
t4DNA Ligase Ligase (name T4DNA Ligase (Rapid), cat# L6030-HC-L) from enzyme company, T4DNA Ligase concentration: 400U/ul;
phi29 is prepared by Shenzhen Huazhi Dazhisha technology Co., ltd (name Phi29 DNA Polymerase, cat# BGE 002A), and the concentration of Phi 29: 10U/. Mu.l;
1X PHI29 buffer：50mM Tris-HCl，10mM MgCl 2 ，10mM(NH 4 ) 2 SO 4 4mM DTT; BST enzyme was obtained from NEB company (name Bst 3.0 DNA Polymerase, cat. M0374S).
TABLE 14
DNA 38.5μL
10×phi29 buffer 5μL
T4 DNA Ligase 2.5μL
Joint 1 or 2 (concentration 2 uM) 1μL
ATP(0.1M) 1μL
Phi29 polymerase 2μL
Co-production 50μL
TABLE 15
30℃ 25min
Table 16
DNA 38.5μL
10×phi29 buffer 5μL
T4 DNA Ligase 2.5μL
Joint 1 or 2 (concentration 2 uM) 1μL
ATP(0.1M) 1μL
BST 2μL
Co-production 50μL
TABLE 17
30℃ 15min
65℃ 25min
4℃ Hold
3.3.3 on-machine sequencing
The DNB product obtained in the above step was quantified and on-boarding on the DNBSEQ platform, this time the on-boarding sequenced DNB product was obtained by method two in 3.3.2, wherein run 2-linker 1 was used with linker 1 and run 2-linker 2 was used with linker 2 and the following data analysis was obtained.
3.3.4 data analysis
The analysis step included the step of filtering the adaptor primer sequences, the comparative basis, and the overall sequencing quality was assessed using FastQC (version v 0.11.8). The filtering of the raw data was performed using NGS QC Toolkit (version v 2.3.3). The data remaining after removal of the low quality and data carrying the joint will be subjected to the next analysis step-comparison. The study uses the mem module of BWA (version v0.7.12) to align the filtered data to the human genome (version GRCh 38), uses GATK (version v 3.3) to locally realign and recalibrate the alkali matrix values for the bam file, and uses SAMtools (version v 1.9) for overlay analysis. As can be seen from table 14, example 2 greatly simplified the experimental procedure, with no significant difference between the data and the control group.
Table 18: off-line data statistics
In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, the different embodiments or examples described in this specification and the features of the different embodiments or examples may be combined and combined by those skilled in the art without contradiction.
While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

Claims (19)

  1. A double-stranded DNA adaptor suitable for preparing a DNA nanosphere, characterized in that the double-stranded DNA adaptor has a first strand and a second strand which are complementary, wherein,
    the first strand and the second strand each independently have a 3 'cohesive end at the 3' end;
    the second strand, and optionally the first strand, has a phosphorylation modification at the 5' end; and
    an optional notch is provided in the second chain,
    provided that when the first strand has a phosphorylation modification at the 5' end, the second strand has at least one of the gaps.
  2. The double-stranded DNA adaptor of claim 1, wherein the second strand has 1 to 5 gaps, optionally 1, 2 or 3 gaps.
  3. The double-stranded DNA adaptor according to claim 1, wherein the gap is 1 to 20 bases in length.
  4. The double-stranded DNA adaptor according to claim 1, wherein the gap is 5 to 15 bases in length.
  5. The double-stranded DNA adaptor according to any one of claims 1 to 4, wherein said first strand comprises at least one tag sequence.
  6. The double-stranded DNA adaptor of claim 5, wherein the second strand comprises at least one tag sequence and/or a nick.
  7. The double-stranded DNA adaptor of claim 6, wherein the tag sequence of the first strand is complementary to the tag sequence of the second strand.
  8. The double-stranded DNA adaptor according to claim 6, wherein the position of the notch corresponds to the tag sequence of the first strand.
  9. The double-stranded DNA adaptor of claim 1 wherein said 3' cohesive ends of said first strand and said second strand are each a base T.
  10. A method for producing the double-stranded DNA adaptor according to any one of claims 1 to 9, characterized in that,
    and (3) carrying out annealing treatment after equimolar mixing of the single-stranded DNA molecules with the first strand and the second strand, so as to obtain the double-stranded DNA adaptor.
  11. A method of preparing a DNA nanosphere comprising:
    performing a ligation reaction of a double stranded nucleic acid molecule with the double stranded DNA adaptor of any one of claims 1 to 9, so as to obtain a circular ligation product, the double stranded nucleic acid molecule having two 3' protruding bases, the two 3' protruding bases matching the 3' cohesive end of the double stranded DNA adaptor, the circular ligation product having at least one nick or notch; and
    at least one round of rolling circle replication is performed on the circular ligation product to obtain the DNA nanospheres.
  12. The method of claim 11, wherein the ligation reaction and rolling circle replication are performed in the same reaction system.
  13. The method of claim 11, wherein the rolling circle replication employs a polymerase having strand displacement activity, optionally the polymerase comprises at least one of Phi29, bst, and Bsm, and/or
    The ligation reaction employs an ATP-dependent ligase, including T4 ligase.
  14. The method of claim 11, wherein the double-stranded nucleic acid molecule is obtained by a fragmentation, cleavage or PCR amplification reaction.
  15. A method of sequencing comprising:
    preparing a DNA nanosphere according to the method of any one of claims 11 to 14; and
    and performing a sequencing reaction based on the DNA nanospheres.
  16. The method of claim 15, wherein the sequencing reaction is adaptable to be performed on a CG or MGI sequencing platform.
  17. A kit, comprising:
    the double-stranded DNA adaptor of any one of claims 1 to 9;
    an alternative DNA ligase which is an ATP dependent ligase; and
    an alternative polymerase, said polymerase having strand displacement activity.
  18. The kit of claim 17, wherein the DNA ligase and the polymerase are disposed in the same container.
  19. Use of the double stranded DNA adaptor of any one of claims 1 to 9, the kit of claim 17 or 18 in the construction of a sequencing library suitable for MDA-PE sequencing or sequencing on a CG or MGI sequencing platform.
CN202280048808.XA 2021-09-30 2022-07-07 Double-stranded DNA (deoxyribonucleic acid) joint for preparing DNA nanospheres, preparation method thereof, kit and application of double-stranded DNA joint Pending CN117730156A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN202111161067X 2021-09-30
CN202111161067 2021-09-30
PCT/CN2022/104453 WO2023050968A1 (en) 2021-09-30 2022-07-07 Double-stranded dna linker for preparing dna nano ball and preparation method therefor, kit, and uses thereof

Publications (1)

Publication Number Publication Date
CN117730156A true CN117730156A (en) 2024-03-19

Family

ID=85780420

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280048808.XA Pending CN117730156A (en) 2021-09-30 2022-07-07 Double-stranded DNA (deoxyribonucleic acid) joint for preparing DNA nanospheres, preparation method thereof, kit and application of double-stranded DNA joint

Country Status (2)

Country Link
CN (1) CN117730156A (en)
WO (1) WO2023050968A1 (en)

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8722585B2 (en) * 2011-05-08 2014-05-13 Yan Wang Methods of making di-tagged DNA libraries from DNA or RNA using double-tagged oligonucleotides
US20180044668A1 (en) * 2014-10-14 2018-02-15 Bgi Shenzhen Co., Limited Mate pair library construction
WO2016058134A1 (en) * 2014-10-14 2016-04-21 深圳华大基因科技有限公司 Linker element and method of using same to construct sequencing library
WO2018081666A1 (en) * 2016-10-28 2018-05-03 Silgentech Inc. Methods of single dna/rna molecule counting
CN108060191B (en) * 2017-11-07 2021-05-04 深圳华大智造科技股份有限公司 Method for adding adaptor to double-stranded nucleic acid fragment, library construction method and kit
SG11202105957YA (en) * 2018-12-05 2021-07-29 Egi Tech Shen Zhen Co Limited Rolling circle amplification method, method for preparing sequencing library, and dna nanosphere prepared therefrom
CN112226821B (en) * 2020-10-16 2024-02-06 鲲羽生物科技(江门)有限公司 Construction method of MGI sequencing platform sequencing library based on double-strand cyclization
CN113249457B (en) * 2021-06-21 2021-10-29 南京实践医学检验有限公司 Kit and method for constructing DNA nanospheres by one-step method

Also Published As

Publication number Publication date
WO2023050968A1 (en) 2023-04-06

Similar Documents

Publication Publication Date Title
Schirmer et al. Illumina error profiles: resolving fine-scale variation in metagenomic sequencing data
CN109689872B (en) DNA end repairing and A adding method
US20220403376A1 (en) Surface-Based Tagmentation
JP7240337B2 (en) LIBRARY PREPARATION METHODS AND COMPOSITIONS AND USES THEREOF
CN111100911B (en) Method for amplifying target nucleic acid
US20070207482A1 (en) Wobble sequencing
JP2022521766A (en) Compositions and Methods for Next Generation Sequencing
JP2019520828A (en) Single cell whole genome library and combined indexing method for producing the same
US20240158850A1 (en) Method and kit for the generation of dna libraries for massively parallel sequencing
CN114096678A (en) Multiple nucleic acid co-labeling support, and preparation method and application thereof
JP2020536525A (en) A method for concentrating the probe and the target region to which it is applied for high-throughput sequencing
CN112410331A (en) Linker with molecular label and sample label and single-chain library building method thereof
CN110628889A (en) Method for constructing introduced molecular tag by Illumina next-generation sequencing platform library, linker sequence and application
US20180100180A1 (en) Methods of single dna/rna molecule counting
CN117730156A (en) Double-stranded DNA (deoxyribonucleic acid) joint for preparing DNA nanospheres, preparation method thereof, kit and application of double-stranded DNA joint
US20040224330A1 (en) Nucleic acid indexing
WO2022144003A1 (en) Method for constructing multiplex pcr library for high-throughput targeted sequencing
KR20240024835A (en) Methods and compositions for bead-based combinatorial indexing of nucleic acids
JP2022546485A (en) Compositions and methods for tumor precision assays
WO2021252937A2 (en) Compositions and methods for dna methylation analysis
US11993771B2 (en) Methods and compositions for cell-free cloning
US20240018510A1 (en) Methods for sequencing polynucleotide fragments from both ends
JP2024523570A (en) Methods and compositions for bead-based combinatorial indexing of nucleic acids
CN117417981A (en) Sequencing library preparation and SNP typing method
CN117625739A (en) Sequencing adapter composition for simultaneously sequencing genome and methylation group, library building method and sequencing method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination