CN117625739A - Sequencing adapter composition for simultaneously sequencing genome and methylation group, library building method and sequencing method - Google Patents

Abstract

The invention provides a sequencing joint composition, a library building method and a sequencing method for simultaneously sequencing genome and methylation group, wherein the sequencing joint composition comprises the following components: the first sequencing connector and the second sequencing connector are Y-shaped connectors; wherein the non-complementary end of one strand of the first sequencing adapter and the non-complementary end of one strand of the second sequencing adapter are at least partially complementarily paired. The sequencing library constructed by the sequencing joint composition can simultaneously retain Watson and Crick two-chain information of a target molecule, and can simultaneously carry out genome and methylation group sequencing analysis on the target molecule, so that the accuracy of methylation sequencing information is greatly improved, and the genome characteristics of organisms are more comprehensively researched.

Description

Sequencing adapter composition for simultaneously sequencing genome and methylation group, library building method and sequencing method

Technical Field

The present invention relates to the field of biology. In particular, the invention relates to sequencing adapter compositions, library building methods and sequencing methods that perform simultaneous genome and methylation group sequencing.

Background

Large-scale genome sequencing has become an important research direction in the field of life sciences over the past few decades. Through large-scale sequencing technology, the genome of an organism can be subjected to comprehensive and deep research, including aspects of gene structure, gene expression, gene regulation, mutation, polymorphism and the like. Meanwhile, in many studies, the methylation status of genomic sequences is also a very important aspect, since methylation is a common form of DNA modification that plays an important role in the growth and development of many organisms.

Whole genome base resolution analysis of DNA methylation was achieved by bisulfite treatment followed by large-scale parallel gene sequencing. During bisulfite treatment, unmethylated cytosines are converted to uracil, while methylated cytosines and guanine on the opposite strand are unaffected. The separation of the two strands of the genomic fragment of interest may be caused by chemical (sulfite) or enzymatic treatment, wherein T may be T caused by genomic variation or may be amplified after deamination of C. In addition, bisulfite treatment may lead to DNA degradation and reduced complexity of genomic sequences, resulting in high strand bias and alignment errors in sequencing data. And C > T is also the most common form of base substitution (accounting for 35% of the total SNPs in the human dbSNP database), it is difficult to distinguish true C > T mutations from bisulfite-induced C > T conversions, and separate experiments are often required to obtain accurate sequence variation and DNA modification information.

In recent years, the literature has successively reported techniques for simultaneously performing genomic and methylation sequencing. For example, watson and Crick chains are locked together by hairpin-type double-stranded sulfite sequencing (DSBS), followed by sulfite treatment and library preparation. Two complementary conversion sequences are then provided by double ended sequencing, which can be deconvolved into the original four base sequence in a subsequent analysis step. This approach addresses some of the important drawbacks of direct conversion-based sequencing, but because both strands are converted, neither strand retains the original sequence information and therefore cannot be used in conjunction with conventional probe-based enrichment and hybridization techniques. Another technique is Methyl-SNP-seq, which locks the watson and crick chains together also by hairpin-type linkers, but it synthesizes the complementary strand of the DNA molecule by nick translation, and in the process, m5CTP is used instead of CTP as a source of nucleotides, thus preserving the original genomic information. However, this method retains both genomic and methylation information, but both of these information are derived from one strand of the DNA molecule and cannot be removed for noise introduced during sample processing and library preparation.

Thus, methods for simultaneous genomic and methylation sequencing are currently under investigation.

Disclosure of Invention

The present invention aims to solve at least one of the technical problems existing in the prior art to at least some extent. Therefore, the invention provides a sequencing joint composition, a kit and application thereof, a sequencing library and a construction method and application thereof, and a method for simultaneously sequencing genome and methylation group, and the sequencing library constructed by the sequencing joint composition can simultaneously retain Watson and Crick two-chain information of a target molecule, and can simultaneously carry out genome and methylation group sequencing analysis on the target molecule, so that the accuracy of methylation sequencing information is greatly improved, and the genome characteristics of organisms are more comprehensively studied.

In one aspect of the invention, the invention provides a sequencing adapter composition. According to an embodiment of the invention, the sequencing adapter composition comprises: the first sequencing connector and the second sequencing connector are Y-shaped connectors; wherein the non-complementary end of one strand of the first sequencing adapter and the non-complementary end of one strand of the second sequencing adapter are at least partially complementarily paired.

In another aspect of the invention, the invention provides a kit. According to an embodiment of the invention, the kit comprises: the sequencing adapter composition described previously.

In a further aspect of the invention, the invention provides the use of a sequencing adapter composition or kit as described hereinbefore in the construction of a sequencing library.

In yet another aspect of the invention, the invention provides a method of constructing a sequencing library for simultaneous genomic and methylation group sequencing. According to an embodiment of the invention, the method comprises: 1) Fragmenting the genome DNA, and carrying out end repair and 3' -end addition of base A on the obtained DNA fragment; 2) Respectively adding a first sequencing joint and a second sequencing joint in the sequencing joint composition at two ends of the DNA fragment obtained in the step 1) through a ligation reaction to obtain a ligation product; 3) Carrying out a chain replacement reaction on the connection product to obtain a chain replacement product, wherein m5CTP is used for replacing CTP in a substrate of the chain replacement reaction; 4) Performing sulfite or bisulfite treatment on the strand displacement product to obtain a sulfite or bisulfite treatment product; 5) Amplifying the sulfite or bisulfite treated product serving as a template to obtain an amplified product; 6) And selecting fragments from the amplified products, and screening target fragments to form a sequencing library.

In yet another aspect of the invention, the invention provides a sequencing library. According to an embodiment of the invention, the sequencing library is obtained by the construction method of the sequencing library described above.

In a further aspect of the invention, the invention proposes the use of the foregoing sequencing library in sequencing.

In yet another aspect of the invention, the invention provides a method for simultaneously sequencing a genome and a methylation set. According to an embodiment of the invention, the method comprises: sequencing the sequencing library to obtain sequencing information; and analyzing the sequencing information to obtain genome information and methylation group information.

Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention.

Drawings

The foregoing and/or additional aspects and advantages of the invention will become apparent and may be better understood from the following description of embodiments taken in conjunction with the accompanying drawings in which:

FIG. 1 shows a schematic diagram of a sequencing adapter composition according to one embodiment of the present invention;

FIG. 2 shows a schematic representation of the ligation product structure of a sequencing adapter composition and a fragment of interest according to one embodiment of the invention;

FIG. 3 shows a schematic diagram of the structure of a strand displacement reaction product according to one embodiment of the present invention;

FIG. 4 shows a schematic flow diagram of a method of constructing a sequencing library for simultaneous genomic and methylation group sequencing according to one embodiment of the present invention.

Detailed Description

Embodiments of the present invention are described in detail below. The following examples are illustrative only and are not to be construed as limiting the invention.

It should be noted that the terms "first," "second," and "second" are used for descriptive purposes only and are not to be construed as indicating or implying a relative importance or implying a number of technical features being indicated. Thus, a feature defining "a first" or "a second" may explicitly or implicitly include one or more such feature. Further, in the description of the present invention, unless otherwise indicated, the meaning of "a plurality" is two or more.

The endpoints and any values of the ranges disclosed herein are not limited to the precise range or value, and are understood to encompass values approaching those ranges or values. For numerical ranges, one or more new numerical ranges may be found between the endpoints of each range, between the endpoint of each range and the individual point value, and between the individual point value, in combination with each other, and are to be considered as specifically disclosed herein.

The invention provides a sequencing joint composition, a kit and application thereof, a sequencing library and a construction method and application thereof, and a method for simultaneously sequencing a genome and a methylation group, which are respectively described in detail below.

Sequencing adapter compositions

In one aspect of the invention, the invention provides a sequencing adapter composition. According to an embodiment of the invention, referring to fig. 1, the sequencing adapter composition comprises: first sequencing linker 100 and second sequencing linker 200, first sequencing linker 100 and second sequencing linker 200 being Y-type linkers.

As used herein, the term "Y-adaptor" refers to a double-stranded nucleic acid molecule, a portion of which are complementarily paired, termed the "complementary region"; the other part is non-complementary paired, called "non-complementary region", and the complementary region is connected with the non-complementary region. Taking the first sequencing adapter 100 of FIG. 1 as an example, the 3 'end of the first strand (T base end) is complementarily paired with the 5' end of the second strand, and the 5 'end of the first strand is non-complementarily paired with the 3' end of the second strand.

According to an embodiment of the invention, the non-complementary end of one strand in the first sequencing adapter 100 and the non-complementary end of one strand in the second sequencing adapter 200 are at least partially complementarily paired.

Referring to FIG. 2, the fragment of interest (red line, T … A and its complement A … T) is flanked by a first sequencing linker 100 (left, black line) and a second sequencing linker 200 (right, green line), respectively. Then, a strand displacement reaction is performed using the ligation product as a template, and a non-complementary end (arrow) of one strand of the second sequencing linker is extended to the left as a reaction start position to displace one strand of the first sequencing linker, the target fragment A … T and a portion of one strand of the second sequencing linker, thereby obtaining a strand displacement product as shown in FIG. 3, which comprises an original upper strand (the first sequencing linker sequence), an intermediate sequence (comprising the target fragment T … A and the second sequencing linker sequence) and a synthetic lower strand (a partial sequence of one strand of the first sequencing linker, the target fragment A … T and one strand of the second sequencing linker). Thus, after the strand displacement reaction, both the Watson and Crick strand information of the target molecule can be retained on one strand at a time.

In the strand displacement reaction, the conventionally added substrates are dATP, dCTP, dGTP and dTTP, and the invention adopts dm5CTP to replace CTP, so that the original upper strand and the intermediate sequence are not involved in synthesis in the strand displacement process, the original gene sequence information is kept, and the original cytosine in the synthesis lower strand is changed into methylcytosine in the strand displacement process. In the subsequent sulfite or bisulfite treatment process, unmethylated cytosine in the intermediate sequence is converted into uracil, and methylated cytosine in the synthetic lower chain and guanine on the opposite chain are not affected, so that sequencing information of the two is analyzed, and genome information and methylation group information can be obtained simultaneously.

According to an embodiment of the invention, the non-complementary 3 'end of one strand in the first sequencing linker and the non-complementary 3' end of one strand in the second sequencing linker are at least partially complementarily paired.

According to an embodiment of the invention, the sequence length of at least part of the complementary pair is 20-30 bp. Thus, a relatively stable double-strand complementary structure can be formed, and thus a subsequent strand displacement reaction can be efficiently performed.

According to an embodiment of the invention, the first sequencing adapter and/or the second sequencing adapter contains a tag sequence. Therefore, the sequencing library of the specific areas of the genomes of the plurality of samples can be conveniently and simultaneously constructed, after the sequencing result is subjected to data analysis, the sequence information of the specific areas of the genomes of the plurality of samples and the methylation information of the specific areas of the genomes of the samples can be accurately distinguished based on the sequence information of the tags, so that the time can be saved, the cost can be reduced, and the sequencing library is suitable for high-throughput sequencing.

In some embodiments, the tag sequence comprises a UMI sequence. Thus, correction can be performed by the method of duplex sequencing.

According to an embodiment of the invention, the first sequencing linker has the sequence as set forth in SEQ ID NO:1 and 2 or a nucleotide sequence having at least 80% homology thereto, said second sequencing linker having a nucleotide sequence as set forth in SEQ ID NO:3 and 4 or a nucleotide sequence having at least 80% homology thereto.

AATGATACGGCGACCACCGAGATCTACACCTTGAACGGACTGTCCACT(SEQ ID NO：1)

CAAGCAGAAGACGGCATACGAGATCACCGAGCGTTAGACTACT(SEQ ID NO：3)

Wherein SEQ ID NO:1-4, wherein each C is methylation modified, N is A, G, C or T, and SEQ ID NO: the sequences shown in bold and underlined in 2 and 4 are complementary in reverse.

Kit for detecting a substance in a sample

In another aspect of the invention, the invention provides a kit. According to an embodiment of the invention, the kit comprises: the sequencing adapter composition described previously. Therefore, the sequencing library constructed by the kit can not only simultaneously reserve the Watson and Crick two-chain information of the target molecule, but also simultaneously carry out genome and methylation group sequencing analysis on the target molecule, thereby greatly improving the accuracy of methylation sequencing information and researching the genome characteristics of organisms more comprehensively.

The kit of the invention may also have other conventional reagents that can be used to construct sequencing libraries, particularly sequencing libraries that are used to construct sequencing libraries that are used to perform both methylation group sequencing and genomic sequencing simultaneously, and can be flexibly selected by those skilled in the art.

It should be noted that the features and advantages described above for the sequencing adapter composition are equally applicable to the kit and are not described here.

Sequencing adapter composition or kit application

In a further aspect of the invention, the invention provides the use of a sequencing adapter composition or kit as described hereinbefore in the construction of a sequencing library. Therefore, the sequencing library constructed by the sequencing joint composition or the kit can not only simultaneously retain two chain information of target molecules Watson and Crick, but also carry out genome sequencing on the target molecules, and particularly can be used for simultaneously carrying out methylation group sequencing and genome sequencing, thereby greatly improving the accuracy of methylation sequencing information and researching the genome characteristics of organisms more comprehensively.

According to an embodiment of the invention, the sequencing library is used for simultaneously performing methylation group sequencing and genomic sequencing.

It should be noted that the features and advantages described above with respect to the sequencing adapter compositions and kits are equally applicable to this application and are not described in detail herein.

Method for constructing sequencing library

In yet another aspect of the invention, the invention provides a method of constructing a sequencing library for simultaneous genomic and methylation group sequencing. According to an embodiment of the present invention, referring to fig. 4, the method includes steps 1) to 6), which will be described in detail below, respectively.

Step 1) fragmenting the genomic DNA, and performing end repair and 3' -end addition of base A to the obtained DNA fragment.

The term "DNA" as used in the present invention may be any polymer comprising deoxyribonucleotides, including but not limited to modified or unmodified DNA. It will be appreciated by those skilled in the art that the source of genomic DNA is not particularly limited and may be obtained from any possible source, either directly from commercial sources, from other laboratories, or directly from samples. According to an embodiment of the present invention, genomic DNA may be extracted from a sample. According to one embodiment of the invention, the method of constructing a sequencing library may further comprise the step of extracting genomic DNA from the sample. According to some specific examples of the invention, the sample may be derived from at least one of a mammal, a plant, and a microorganism. According to some embodiments of the invention, the mammal may be at least one of a human and a mouse. According to one embodiment of the invention, the genomic DNA may be human whole blood genomic DNA, preferably peripheral blood mononuclear cell genomic DNA.

According to an embodiment of the invention, fragmentation is the random disruption or cleavage of genomic DNA using physical or chemical means.

According to an embodiment of the invention, the fragmentation is performed using physical sonication or enzymatic reaction.

According to an embodiment of the invention, end repair is performed using a Klenow fragment, a T4 DNA polymerase and a T4 polynucleotide kinase. Wherein the Klenow fragment has a 5 '. Fwdarw.3' polymerase activity and a 3 '. Fwdarw.5' polymerase activity, but lacks a 5 '. Fwdarw.3' exonuclease activity. Thus, the DNA fragment can be conveniently and accurately subjected to end repair. According to an embodiment of the present invention, a step of purifying the DNA fragment subjected to the end repair may be further included, whereby the subsequent treatment can be conveniently performed.

According to embodiments of the invention, end repair may also include phosphorylation, particularly with nucleotide kinases such as T4 polynucleotide kinase.

According to the examples of the present invention, the addition of base A at the 3' -end was performed using rTaq enzyme or Klenow polymerase. Thus, a DNA fragment having the cohesive end A was obtained. According to an embodiment of the present invention, a step of purifying the DNA fragment having the cohesive end A may be further included, whereby the subsequent treatment can be conveniently performed.

Step 2) adding a first sequencing linker and a second sequencing linker in the sequencing linker composition to both ends of the DNA fragment obtained in the step 1) through a ligation reaction to obtain a ligation product.

Step 3) carrying out a strand displacement reaction on the connection product to obtain a strand displacement product, wherein dm5CTP is substituted for CTP in a substrate of the strand displacement reaction.

Referring to FIG. 2, the non-complementary end of one strand of the second sequencing linker (at the arrow) is extended to the left as the reaction start position and replaces part of one strand of the first sequencing linker, the target fragment A … T and one strand of the second sequencing linker, resulting in a strand displacement product as shown in FIG. 3, comprising the original upper strand (first sequencing linker sequence), the intermediate sequence (comprising the target fragment T … A and the second sequencing linker sequence) and the synthetic lower strand (part of the sequence of one strand of the first sequencing linker, the target fragment A … T and one strand of the second sequencing linker). Thus, after the strand displacement reaction, both the Watson and Crick strand information of the target molecule can be retained on one strand at a time.

In the strand displacement reaction, the conventionally added substrates are dATP, dCTP, dGTP and dTTP, and the invention adopts dm5CTP to replace CTP, so that the original upper strand and the intermediate sequence are not involved in synthesis in the strand displacement process, the original gene sequence information is kept, and the original cytosine in the synthesis lower strand is changed into methylcytosine in the strand displacement process. In the subsequent bisulfite treatment process, unmethylated cytosine in the intermediate sequence is converted into uracil, and methylated cytosine in the synthetic lower chain and guanine on the opposite chain are not affected, so that sequencing information of the two is analyzed, and genome information and methylation group information can be obtained simultaneously.

According to an embodiment of the present invention, the strand displacement reaction is performed using phi29 DNA polymerase.

Step 4) sulfite or bisulfite treatment is carried out on the strand displacement product to obtain a sulfite or bisulfite treatment product. Thus, unmethylated cytosines in the intermediate sequence are converted to uracils, while methylated cytosines in the synthetic lower strand and guanines on the opposite strand are unaffected, facilitating subsequent sequencing analysis to learn both genomic and methylated genomic information.

And 5) amplifying the sulfite or bisulfite treated product serving as a template to obtain an amplified product. The sulfite or bisulfite treatment conditions are not strictly limited, and can be flexibly selected based on methods known in the art and combined with conventional technical means.

Step 6) selecting fragments from the amplified products, and screening target fragments to form a sequencing library. Fragment selection includes separation and purification of amplified products, the present invention is not particularly limited with respect to a method of separation and purification of amplified products, and according to a specific example of the present invention, can be performed by at least one selected from the group consisting of magnetic bead purification, purification column purification, and agarose gel electrophoresis. According to some specific examples of the invention, the library fragment length of the sequencing library is 300-500 bp, so that the sequencing library has good repeatability, the sequencing result is true and reliable, and the methylation information of a specific region of a genome is complete.

In yet another aspect of the invention, the invention provides a sequencing library. According to an embodiment of the invention, the sequencing library is obtained by the construction method of the sequencing library described above. Therefore, the sequencing library disclosed by the invention can be used for simultaneously keeping the Watson and Crick chain information of a target molecule and simultaneously carrying out methylation group sequencing and genome sequencing, so that the accuracy of the methylation sequencing information is greatly improved, and the genome characteristics of organisms are more comprehensively researched.

It should be noted that the features and advantages described above for the sequencing adapter composition are equally applicable to the method of constructing the sequencing library and the sequencing library, and are not described in detail herein.

Application of sequencing library in sequencing and sequencing method

In yet another aspect of the invention, the invention provides the use of a sequencing library in sequencing. Therefore, the sequencing library can be used for simultaneously carrying out methylation group sequencing and genome sequencing, so that the accuracy of methylation sequencing information is greatly improved, and the genome characteristics of organisms are more comprehensively researched.

According to an embodiment of the invention, sequencing comprises methylation group sequencing and genomic sequencing.

In yet another aspect of the invention, the invention provides a method for simultaneously sequencing a genome and a methylation set. According to an embodiment of the invention, the method comprises: sequencing the sequencing library to obtain sequencing information; and analyzing the template strand information and the newly generated strand information to obtain template strand whole genome DNA methylation information. Therefore, the method can realize simultaneous genome and methylation group sequencing, and greatly improve the accuracy of methylation sequencing information so as to more comprehensively study the genome characteristics of organisms.

It should be noted that the features and advantages described above for the sequencing library are equally applicable to the application and the sequencing method, and are not described here again.

Advantageous effects

1. The invention links the target DNA molecule Watson and Crick chains together, retains the information of the target DNA molecule Watson and Crick chains in one sequencing molecule, and can be used for error correction by comparing the information of the target DNA molecule Watson and Crick chains. At the same time, the method can introduce UMI into the joint and further correct the joint by a duplex sequencing method. Therefore, the defect that only genome information and methylation information on one chain are reserved in the traditional library construction method for simultaneously sequencing genome and methylation group in Methyl-SNP-seq is overcome.

2. The invention can adopt the probe capturing method to sequence, and solves the defect that the existing library construction method DSBS for simultaneously carrying out genome and methylation group sequencing cannot be used for the probe capturing method methylation sequencing due to double-chain simultaneously carrying out sulfite treatment.

3. The invention can simultaneously sequence the genome and methylation group information by one-time library establishment, avoids the separate library establishment of the conventional genome and methylation group, and reduces the input amount of the original DNA. The invention can be used for cfDNA or genome DNA sequencing analysis with small sample size, and saves library building reagent and library building time.

The scheme of the present invention will be explained below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1

1. Construction of a sequencing library for simultaneous genome and methylation group sequencing

1) And (3) joint annealing treatment:

the adaptor quadruplicates were prepared by diluting 4 100. Mu.M oligonucleotides (SEQ ID NOS: 1-4, respectively) to 5. Mu.M with low TE buffer and 100mM NaCl, heating at 85℃for 3min, cooling to 20℃per minute at-1℃and incubating at room temperature for 12 h. The annealed conjugate was kept at-20 ℃ for use.

2) And (3) joint connection:

the 1.8 volume ratio of AMPure XP beads was purified before the ligation step, and then eluted with 40. Mu.l of low TE buffer. 5. Mu.M linker conjugate was diluted to 500nM with linker dilution buffer (10 mM Tris-HCl,1mM EDTA,10mMNaCl,pH 8); 40ng of NA12878 genomic DNA, 0.25ng of lambda phage genomic DNA and 0.25ng of pUC19 were sonicated to a 100-150bp fragment, end-repaired and 3 '-terminal-added with A base according to the instructions using KAPA HyperPrep Kit (Roche, 07962363001), then the fragment of interest was ligated with the linker, the ligation time was prolonged to 1h, and 3. Mu.l of 5' -dealyase (NEB, M0331S) was added during ligation.

3) Strand displacement reaction:

displacement extension (40. Mu.l of sample, 10. Mu.l of 10 Xbuffer, 0.2mM dNTP, where CTP is replaced with d5mCTP, 1. Mu.l of polymerase with 100. Mu.l of nuclease free water) was performed with phi29 DNA polymerase (NEB, M0269L) at 30℃for 20 minutes, followed by 0.75 XAMPure XP bead purification.

4) Sulfite treatment:

the strand displacement product was subjected to 1.8 volume-ratio of AMPure XP magnetic bead purification, and then the eluate was subjected to bisulfite conversion with EpiTect Plus DNA Bisulfite kit (catalog No. 59124). To increase the conversion of bisulphite, 20. Mu.l of eluate was subjected to a second round of conversion using EpiTect Plus DNA Bisulfite kit.

5) Library amplification:

PCR amplification was performed using KAPA HiFiHotStartReadyMix (Roche, 07958935001) and xGen Library Amplification Primer Mix (IDT, 1077677) according to the instructions for 2min; the PCR was followed by two 0.65 XAMPure XP bead purifications.

6) Sequencing.

2. Conventional methylation library building method WGBS

40ng of NA12878 genomic DNA, 0.25ng of lambda phage genomic DNA and 0.25ng of pUC19 were sonicated to a 100-150bp fragment, end-repaired and 3' -end-added with A base as indicated using KAPA HyperPrep Kit (Roche, 07962363001), the fragment of interest was ligated to a linker, the ligation product was purified by 1.8-fold volume ratio of AMPure XP beads, and the eluate was bisulphite-converted using EpiTect Plus DNA Bisulfite kit (catalog No. 59124). PCR amplification was performed using KAPA HiFiHotStartReadyMix (Roche, 07958935001) and xGen Library Amplification Primer Mix (IDT, 1077677) according to the instructions for 2min; after PCR, 0.65 XAMPure XP magnetic bead purification was performed twice and sequenced on the machine.

The results are shown in Table 1, and it can be seen that the library constructed by the method of the present invention has excellent overall performance compared to the conventional WGBS library construction method.

TABLE 1 comparison of performance of the inventive and conventional methylation database methods WGBS

While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

Claims (10)

1. A sequencing adapter composition comprising: the first sequencing connector and the second sequencing connector are Y-shaped connectors;

wherein the non-complementary end of one strand of the first sequencing adapter and the non-complementary end of one strand of the second sequencing adapter are at least partially complementarily paired.

2. The sequencing adapter composition of claim 1, wherein the non-complementary 3 'end of one strand in the first sequencing adapter and the non-complementary 3' end of one strand in the second sequencing adapter are at least partially complementarily paired;

optionally, the sequence length of the at least partially complementary pair is 20-30 bp;

optionally, the first sequencing adapter and/or the second sequencing adapter contains a tag sequence;

optionally, the first sequencing linker has the sequence set forth in SEQ ID NO:1 and 2 or a nucleotide sequence having at least 80% homology thereto, said second sequencing linker having a nucleotide sequence as set forth in SEQ ID NO:3 and 4 or a nucleotide sequence having at least 80% homology thereto.

3. A kit, comprising: the sequencing adapter composition of claim 1 or 2.

4. Use of the sequencing adapter composition of claim 1 or 2 or the kit of claim 3 in the construction of a sequencing library;

optionally, the sequencing library is used to simultaneously perform genomic and methylation group sequencing.

5. A method of constructing a sequencing library for simultaneous genomic and methylation group sequencing, comprising:

1) Fragmenting the genome DNA, and carrying out end repair and 3' -end addition of base A on the obtained DNA fragment;

2) Respectively adding a first sequencing joint and a second sequencing joint in the sequencing joint composition according to claim 1 or 2 to two ends of the DNA fragment obtained in the step 1) through a ligation reaction to obtain a ligation product;

3) Carrying out a strand displacement reaction on the connection product to obtain a strand displacement product, wherein dm5CTP is used for replacing CTP in a substrate of the strand displacement reaction;

4) Performing sulfite or bisulfite treatment on the strand displacement product to obtain a sulfite or bisulfite treatment product;

5) Amplifying the sulfite or bisulfite treated product serving as a template to obtain an amplified product;

6) And selecting fragments from the amplified products, and screening target fragments to form a sequencing library.

6. The method according to claim 5, wherein the fragmenting is a random disruption or cleavage of genomic DNA by physical or chemical means;

optionally, the strand displacement reaction is performed using phi29 DNA polymerase.

7. A sequencing library obtained by the method of construction of the sequencing library of claim 5 or 6.

8. Use of the sequencing library of claim 7 in sequencing.

9. The use of claim 8, wherein the sequencing comprises methylation group sequencing and genomic sequencing.

10. A method for simultaneous genome and methylation group sequencing comprising:

sequencing the sequencing library of claim 7 to obtain sequencing information;

and analyzing the sequencing information to obtain genome information and methylation group information.