CN117720668A

CN117720668A - Method for preparing human prealbumin

Info

Publication number: CN117720668A
Application number: CN202311735730.1A
Authority: CN
Inventors: 黄黉; 颜青青; 蒋析文; 巩路; 梁国立; 何祖强
Original assignee: Guangzhou Nuclear Source Biotechnology Co ltd; Guangzhou Da'an Gene Co ltd
Current assignee: Guangzhou Nuclear Source Biotechnology Co ltd; Guangzhou Da'an Gene Co ltd
Priority date: 2023-12-15
Filing date: 2023-12-15
Publication date: 2024-03-19

Abstract

The invention discloses a method for preparing recombinant prealbumin by eukaryotic cell expression, in particular to a method for expressing recombinant prealbumin by adopting a genetic engineering 293F cell, wherein the recombinant prealbumin can be expressed in a 293F cell expression system with high efficiency and has higher protein stability.

Description

Method for preparing human prealbumin

Technical Field

The invention belongs to the field of biotechnology. And more particularly to a method for preparing human prealbumin.

Background

Prealbumin (PA), a plasma protein synthesized by hepatocytes, has important biological activity. In plasma, prealbumin binds to thyroxine and participates in the operation of thyroid hormone in blood, and can also associate with retinol and retinol binding protein to form a complex, and participate in the operation and metabolism of vitamin A. Prealbumin is widely studied in terms of vitamin a and thyroxine metabolism, protein malnutrition, hepatotoxicity and the like.

Some preparation methods of PA have been disclosed, mostly obtaining high concentration natural PA from serum. Because the PA protein and the Alb protein have similar isoelectric points and molecular weights, the separation and purification process in the prior art is difficult to distinguish the two proteins, so that the difficulty of purifying the natural PA is high, the yield is low, and the raw materials are difficult to obtain.

Thus, those skilled in the art are working to develop a process for preparing human prealbumin to reduce the cost of obtaining natural PA proteins.

Disclosure of Invention

The invention provides a method for preparing human prealbumin.

In a first aspect of the invention, there is provided a Prealbumin (PA) fusion protein selected from the group consisting of:

(A) A polypeptide having the amino acid sequence shown in SEQ ID NO. 1;

(B) A polypeptide having 90% or more homology (preferably 95% or more homology; preferably 96% or more homology; most preferably 97% or more homology) to the amino acid sequence shown in SEQ ID NO.1, and which retains the activity of the polypeptide shown in SEQ ID NO. 1;

(C) And (3) a derivative polypeptide which is formed by substituting, deleting or adding 1-5 amino acid residues in any one of the amino acid sequences shown in SEQ ID NO.1 and keeps the activity of the polypeptide shown in SEQ ID NO. 1.

In another preferred embodiment, the fusion protein is isolated.

In another preferred embodiment, the prealbumin fusion protein has the amino acid sequence shown in SEQ ID NO. 1.

In a second aspect of the invention there is provided an isolated codon optimised polynucleotide encoding the fusion protein of the first aspect of the invention.

In another preferred embodiment, the polynucleotide is selected from the group consisting of:

(a) A polynucleotide with a sequence shown as SEQ ID NO. 2;

(b) A polynucleotide having a nucleotide sequence having a homology of 95% (preferably 98%) or more with the sequence shown in SEQ ID NO. 2;

(c) A polynucleotide complementary to the polynucleotide of any one of (a) - (b).

In a third aspect of the invention there is provided an expression vector comprising a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the expression vector is a pcDNA3.4 expression vector.

In a fourth aspect of the invention there is provided a host cell comprising an expression vector according to the third aspect of the invention or having integrated into its genome a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the host cell is a eukaryotic cell, preferably the host cell is a 293F cell (human embryonic kidney cell).

In a fifth aspect of the present invention, there is provided a method for preparing recombinant Prealbumin (PA), comprising the steps of:

culturing the cell of the fourth aspect of the invention under conditions suitable for expression, thereby expressing the fusion protein of the first aspect of the invention; and isolating the recombinant Prealbumin (PA).

In a sixth aspect of the invention there is provided a kit comprising a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention or an expression vector according to the third aspect of the invention or a host cell according to the fourth aspect of the invention.

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to constitute new or preferred technical solutions. And are limited to a space, and are not described in detail herein.

Drawings

FIG. 1 shows the electrophoretogram after purification of the different codon expression products.

Detailed Description

The invention establishes a method for efficiently expressing and preparing exocrine PA, selects pcDNA3.4 vector suitable for secretory protein expression, adopts signal peptide capable of efficiently secreting PA, adds kozac sequence before initiation codon ATG, and screens codons suitable for efficient expression and secretion efficiency of 293F cells. The expressed protein has the advantages of high stability and high activity. The method for preparing the PA protein has the advantages of short production period, easy purification of an expression product, low cost and the like, and can realize mass production of the PA protein.

Before describing the present invention, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to a specifically recited value, the term "about" means that the value can vary no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values therebetween (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein.

Fusion proteins and their preparation

In the present invention, "fusion protein", "recombinant protein", "protein of the present invention" and "fusion protein of the present invention" are used interchangeably and refer to a protein having the amino acid sequence shown in SEQ ID NO.1 or a derivative thereof. The proteins of the invention may be monomers or multimers (e.g., dimers) formed from monomers. Furthermore, it is understood that the term also includes active fragments and derivatives of fusion proteins.

As used herein, "isolated" refers to a substance that is separated from its original environment (i.e., the natural environment if it is a natural substance). If the polynucleotides and polypeptides in the native state in living cells are not isolated or purified, the same polynucleotides or polypeptides are isolated or purified if they are separated from other substances that are present in the native state.

As used herein, an "isolated fusion protein" refers to a fusion protein that is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. The skilled artisan can purify fusion proteins using standard protein purification techniques. Substantially pure proteins can produce a single main band on a non-reducing polyacrylamide gel.

The polynucleotides of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand.

The invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the invention. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

As used herein, the term "primer" refers to the generic term for oligonucleotides that, when paired with a template, are capable of synthesizing a DNA strand complementary to the template from the primer under the action of a DNA polymerase. The primer may be natural RNA, DNA, or natural nucleotide in any form. The primer may even be a non-natural nucleotide such as LNA or ZNA, etc. The primer is "substantially" (or "essentially") complementary to a particular sequence on one strand of the template. The primer must be sufficiently complementary to one strand on the template to begin extension, but the sequence of the primer need not be perfectly complementary to the sequence of the template. For example, a primer that is complementary to the template at the 3 'end is added to the 5' end of a primer that is not complementary to the template, and such primer is still substantially complementary to the template. Primers that are not perfectly complementary may also form primer-template complexes with the template, so long as they are sufficiently long to bind to the template, thereby allowing amplification.

The full-length nucleotide sequence of the fusion protein of the present invention or a component thereof or a fragment thereof can be usually obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. Primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to vectors comprising the polynucleotides of the invention, as well as host cells genetically engineered with the vectors or fusion protein coding sequences of the invention, and methods for producing the proteins of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce recombinant proteins by conventional recombinant DNA techniques. Generally, there are the following steps:

(1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding a protein of the invention, or with a recombinant expression vector comprising the polynucleotide;

(2) A host cell cultured in a suitable medium;

(3) Separating and purifying the protein from the culture medium or the cells.

Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequences of the proteins of the invention and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

In addition, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a eukaryotic cell, such as a mammalian cell. Representative examples are: animal cells of CHO, NS0, COS7, or 293 cells, and the like; prokaryotic cells, such as E.coli, are also contemplated.

Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate co-precipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time.

The proteins obtained in the above methods can be isolated and purified by various separation methods using their physical, chemical and other properties, if necessary. Such methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods.

In a preferred embodiment of the present invention, the amino acid sequence of the recombinant Prealbumin (PA) according to the present invention is as follows:

ATMKWVTFISLLFSSAYSASHRLLLLCLAGLVFVSEAGPTGTGESKCPLMVKVLDAVRGSPAINVAVHVFRKAADDTWEPFASGKTSESGELHGLTTEEEFVEGIYKVEIDTKSYWKALGISPFHEHAEVVFTANDSGPRRYTIAALLSPYSYSTTAVVTNPKEHHHHHH(SEQ ID NO.1)

base sequence optimized for synonymous codon preference of E.coli:

GCCACCGCCACCATGAAGTGGGTGACTTTTATCAGTCTACTATTTAGCTCTGCCTACTCCGCAAGTCATCGACTACTACTACTATGCCTGGCTGGACTGGTGTTTGTGTCCGAGGCTGGCCCCACAGGCACCGGCGAATCCAAGTGCCCTCTGATGGTGAAGGTGCTGGACGCCGTGCGGGGATCTCCTGCCATCAACGTGGCCGTGCACGTGTTCCGGAAGGCTGCCGACGATACCTGGGAGCCTTTCGCCTCTGGCAAGACCTCTGAGTCCGGCGAACTGCACGGCCTGACCACCGAGGAAGAGTTCGTGGAAGGCATCTACAAGGTCGAGATCGACACCAAGTCCTACTGGAAGGCCCTCGGCATCAGCCCCTTCCACGAGCATGCTGAAGTGGTGTTCACCGCCAACGACTCCGGCCCTAGAAGATACACCATCGCCGCTCTGCTGAGCCCATATTCTTACTCCACCACAGCTGTCGTGACCAACCCTAAAGAGCATCATCACCATCACCAT(SEQ ID NO.2)。

genetically engineered cells

The present invention provides a genetically engineered cell (host cell) which is a eukaryotic cell (preferably a 293F cell) and has integrated into its genome an expression cassette for a fusion protein of the present invention; or the cell contains an expression vector containing the expression cassette of the fusion protein of the invention.

In a preferred embodiment, the expression cassette of the fusion protein of the invention comprises the following elements operably linked 5 'to 3': a promoter, a start codon, an ORF sequence of the fusion protein and a stop codon.

In the present invention, the term "operably linked" means a configuration in which a regulatory sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the regulatory sequence directs the expression of the coding sequence.

The invention has the beneficial effects that:

(1) The recombinant human prealbumin has high expression quantity in eukaryotic cells and good stability.

(2) The method for preparing the recombinant human prealbumin has extremely high expression efficiency, so that the recombinant human prealbumin can be prepared at low cost, and the large-scale preparation of the high-purity human prealbumin is realized.

The present invention will be described in further detail with reference to the following examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The following examples are not to be construed as limiting the details of the experimental procedure, and are generally carried out under conventional conditions such as those described in the guidelines for molecular cloning laboratory, sambrook.J.et al, (Huang Peitang et al, beijing: scientific Press, 2002), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise indicated. The experimental materials and reagents used in the following examples were obtained from commercial sources unless otherwise specified.

EXAMPLE 1 expression and purification of recombinant proteins

1) The gene of human PA provided by NCBI is taken as a reference, the experiment design requirement of the invention is combined, synonymous codon preference optimization is carried out, different signal peptides are connected at the N end for screening test, the vector is pcDNA3.4, the C end (His) 6 tag, and the Nanjing Jinsri is entrusted for gene synthesis and cloned on the vector.

Through testing, the optimal protein amino acid sequence of the recombinant expression PA is as follows (SEQ ID NO. 1):

ATMKWVTFISLLFSSAYSASHRLLLLCLAGLVFVSEAGPTGTGESKCPLMVKVLDAVRGSPAINVAVHVFRKAADDTWEPFASGKTSESGELHGLTTEEEFVEGIYKVEIDTKSYWKALGISPFHEHAEVVFTANDSGPRRYTIAALLSPYSYSTTAVVTNPKEHHHHHH

for the above fusion proteins, codon optimization was performed, and a representative codon optimization sequence was as follows:

codon optimized sequence 1 (SEQ ID NO. 2):

GCCACCGCCACCATGAAGTGGGTGACTTTTATCAGTCTACTATTTAGCTCTGCCTACTCCGCAAGTCATCGACTACTACTACTATGCCTGGCTGGACTGGTGTTTGTGTCCGAGGCTGGCCCCACAGGCACCGGCGAATCCAAGTGCCCTCTGATGGTGAAGGTGCTGGACGCCGTGCGGGGATCTCCTGCCATCAACGTGGCCGTGCACGTGTTCCGGAAGGCTGCCGACGATACCTGGGAGCCTTTCGCCTCTGGCAAGACCTCTGAGTCCGGCGAACTGCACGGCCTGACCACCGAGGAAGAGTTCGTGGAAGGCATCTACAAGGTCGAGATCGACACCAAGTCCTACTGGAAGGCCCTCGGCATCAGCCCCTTCCACGAGCATGCTGAAGTGGTGTTCACCGCCAACGACTCCGGCCCTAGAAGATACACCATCGCCGCTCTGCTGAGCCCATATTCTTACTCCACCACAGCTGTCGTGACCAACCCTAAAGAGCATCATCACCATCACCAT

codon optimized sequence 2 (SEQ ID No. 3):

GCCACCGCGACGATGAAATGGGTGACATTCATCTCTTTGTTGTTTTCTAGTGCGTATTCTGCATCACATCGCCTTCTCTTGCTCTGTCTCGCCGGCCTGGTTTTTGTTAGTGAGGCAGGTCCCACGGGTACGGGGGAGTCTAAGTGTCCTTTGATGGTGAAAGTGTTGGATGCCGTGCGCGGCTCTCCTGCCATCAATGTGGCGGTACACGTTTTTAGGAAAGCCGCGGATGATACCTGGGAACCTTTTGCTTCAGGAAAGACCTCTGAGAGTGGTGAGCTGCATGGGCTCACTACGGAAGAGGAGTTCGTTGAAGGTATCTACAAAGTCGAAATAGACACTAAAAGTTATTGGAAGGCACTTGGCATTTCACCCTTTCACGAGCACGCAGAGGTGGTATTCACCGCTAATGACTCAGGTCCCCGACGGTACACAATAGCAGCACTCCTGAGTCCTTACTCCTATTCCACGACTGCTGTGGTTACCAACCCCAAGGAACATCATCACCACCATCAT

codon optimized sequence 3 (SEQ ID No. 4):

GCCACCGCCACCATGAAGTGGGTGACCTTCATCAGCCTGCTGTTCAGCAGCGCCTACAGCGCCAGCCACCGCCTGCTGCTGCTGTGCCTGGCCGGCCTGGTGTTCGTGAGCGAGGCCGGCCCCACCGGCACCGGCGAGAGCAAGTGCCCCCTGATGGTGAAGGTGCTGGACGCCGTGCGCGGCAGCCCCGCCATCAACGTGGCCGTGCACGTGTTCCGCAAGGCCGCCGACGACACCTGGGAGCCCTTCGCCAGCGGCAAGACCAGCGAGAGCGGCGAGCTGCACGGCCTGACCACCGAGGAGGAGTTCGTGGAGGGCATCTACAAGGTGGAGATCGACACCAAGAGCTACTGGAAGGCCCTGGGCATCAGCCCCTTCCACGAGCACGCCGAGGTGGTGTTCACCGCCAACGACAGCGGCCCCCGCCGCTACACCATCGCCGCCCTGCTGAGCCCCTACAGCTACAGCACCACCGCCGTGGTGACCAACCCCAAGGAGCACCACCACCACCACCAC

2) Expression of PA in 293F cells

The plasmid prepared in step (1) of example 1 was picked up, DH 5. Alpha. Competent cells (tenna) were transformed with the plasmid, and single colonies were picked up for identification. And (3) taking the bacterial liquid with the correct sequencing result into 100ml of LB culture medium, culturing at 37 ℃ overnight, and collecting the bacterial liquid to extract plasmids according to the specification of a plasmid extraction kit (Kaiji). Endotoxin was removed, concentration was measured, 260/280, endotoxin was detected as negative, and bands were detected by electrophoresis.

293F cells were transfected with 200ml of PEI MW25000 transfection reagent (next holy) according to the instructions and the adjuvant was added for about 24 hours. Temperature 36.5 ℃, rotation speed 95rpm,8% CO ₂ After 4 days of culture, the supernatant was collected by centrifugation at 13500rpm at 4℃for 30 min.

3) Purification of the expression product

200ml of transient cell supernatant was subjected to Ni-column affinity chromatography, and the target protein was obtained by eluting with 50mM Tris-HCl,50mM NaCl,200mM imidazole, pH 7.0. As shown in FIG. 1, lanes 1 and 2 are target proteins expressed by optimized codons 1 and 2, and the molecular weight is close to 16.58KD. Optimizing codon 3 expression cells did not produce the protein of interest.

The BCA method is used for detecting and optimizing the concentration of the protein expressed by the codon 1 cells, the total amount of the protein is 17mg, and the purity reaches more than 90 percent. The expression level of the target protein PA expressed by the optimized codon 1 in the supernatant of 293F cells is calculated to be 85.0mg/L.

Example 2 protein stability test

The target proteins expressed by the optimized codons 1 and 2 are respectively split-packed into 2mL EP tubes, 1 mL/branch, and sealed by a sealing film. 2, 1 in each batch are placed at 37 ℃ for 7 days of acceleration for identification, and the other is placed at-20 ℃ for stability identification by using the kit.

1-1 to 1-6 samples are proteins of interest that optimize expression of codon 1; 2-1 to 2-6 samples are proteins of interest that optimize expression of codon 2.

Conclusion of experiment: the concentration of the target protein expressed by the optimized codon 1 is within +/-5% after being placed at 37 ℃ for 7 days compared with the data of day 0. In conclusion, the PA protein has better stability. The target protein expressed by the optimized codon 2 is placed for 7 days at 37 ℃, the protein concentration is obviously reduced, and the poor stability of the PA protein is demonstrated.

The activity of the target protein expressed by the optimized codon 1 was calibrated using a commercially available kit,

the recombinant human Prealbumin (PA) activity expressed by the optimized codon 1 was calibrated using a human Prealbumin (PA) detection kit (product number: ARD 11428) from Orida Biotechnology Co., guangzhou, and the result shows that the recombinant human Prealbumin (PA) prepared by the invention has the same activity as the extracted natural human Prealbumin (PA).

All documents mentioned in this application are incorporated by reference as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the claims appended hereto.

Claims

1. A prealbumin fusion protein, wherein the prealbumin fusion protein is selected from the group consisting of:

(A) A polypeptide having the amino acid sequence shown in SEQ ID NO. 1;

2. The prealbumin fusion protein of claim 1 wherein the prealbumin fusion protein is isolated.

3. The prealbumin fusion protein of claim 1 wherein the amino acid sequence of the prealbumin fusion protein is shown in SEQ ID No. 1.

4. An isolated codon-optimized polynucleotide encoding the fusion protein of claim 1.

5. The polynucleotide of claim 4, wherein said polynucleotide is selected from the group consisting of:

(a) A polynucleotide with a sequence shown as SEQ ID NO. 3;

(b) A polynucleotide having a nucleotide sequence having a homology of 95% (preferably 98%) or more with the sequence shown in SEQ ID NO. 3;

6. An expression vector comprising the polynucleotide of claim 4.

7. A host cell comprising the expression vector of claim 6 or having integrated into its genome the polynucleotide of claim 4.

8. The host cell of claim 7, wherein the host cell is a eukaryotic cell.

9. A method for preparing recombinant prealbumin comprising the steps of:

culturing the cell of claim 7 under conditions suitable for expression to express the recombinant prealbumin of claim 1; and isolating the prealbumin.

10. A kit comprising the polynucleotide of claim 4 or the expression vector of claim 6 or the host cell of claim 7.