CN117701424A

CN117701424A - Novel lactobacillus rhamnosus strain with obesity prevention or treatment effect and application thereof

Info

Publication number: CN117701424A
Application number: CN202311636456.2A
Authority: CN
Inventors: 金容植; 朴斗常; 孙美英; 奇秀真; 金志宣; 吴贤宇; 李婑璃; 全晙亨; 郑先娥
Original assignee: Korea Research Institute of Bioscience and Biotechnology KRIBB; Industry Academy Cooperation Foundation of Soonchunhyang University
Current assignee: Korea Research Institute of Bioscience and Biotechnology KRIBB; Industry Academy Cooperation Foundation of Soonchunhyang University
Priority date: 2018-04-11
Filing date: 2019-04-11
Publication date: 2024-03-15
Also published as: KR20200084817A; KR20190118985A; WO2019199094A1; CN112672749A; CN112672749B; KR102206628B1; KR102156399B1

Abstract

The invention provides a novel bifidobacterium longum strain or lactobacillus rhamnosus strain with an obesity prevention or treatment effect and application thereof. Treatment with lactobacillus bifidobacterium longum strain and lactobacillus rhamnosus strain causes browning of white adipocytes. In particular, the treatment significantly increased the expression of genes specific for beige adipocytes and brown adipocytes compared to untreated controls. Furthermore, based on the results of high fat diet-induced obese mice experiments, it was confirmed that each strain showed significant inhibition of weight gain compared to negative control, and increased expression of thermogenic specific genes in mouse white adipocytes. Accordingly, each of the lactobacillus bifidobacterium longum strain and the lactobacillus rhamnosus strain exhibits an anti-obesity effect, and thus can be effectively used as a food, a drug or a feed for preventing or treating obesity, and is very useful in the related industry.

Description

Novel lactobacillus rhamnosus strain with obesity prevention or treatment effect and application thereof

[ field of technology ]

The present disclosure relates to a novel bifidobacterium longum (Bifidobacterium longum) strain or lactobacillus rhamnosus (Lactobacillus rhamnosus) strain having an obesity preventing or treating effect and uses thereof.

[ background Art ]

With the recent economic modernization, the living standard is improved, the intake of fat and sugar is increased, the intake of fiber is reduced, and particularly, the phenomenon of preference for high protein diet is remarkable due to the establishment of dining culture. In contrast, the reality is that the obese population is rapidly increasing due to the lifestyle of modern people with little physical activity. Obesity, particularly abdominal obesity, is becoming a serious social problem with increased intake of high calorie foods and decreased intake of fibers. Obesity (obesity) refers to a state in which adipose tissue is excessively increased, and weight gain due to obesity is mainly due to fat increase. The mechanism for achieving the obese state is that when excess sugar is ingested, the sugar contained in the food is digested into monosaccharides which are in turn absorbed into the body through the small intestine, thus increasing blood glucose levels and thus stimulating insulin secretion, wherein insulin acts on adipocytes to accept monosaccharides in the blood and convert them into fat.

The harm of obesity is not only that the fat tissue presses the abdomen, often causes constipation, dyspepsia, gastrointestinal disorder, but also is a risk factor for many adult diseases. Obesity is known to be directly associated with diabetes, hypertension, coronary artery disease and cancer, and WHO defines obesity as a chronic disease of the 21 st century. It is expected that its prevalence in korea will increase to more than 50% in 2030, and thus, economic burden of countries and individuals is expected to increase significantly. Accordingly, in korea and abroad, much attention and investment are being put into research for preventing and treating obesity.

Mouse adipocytes 3T3-L1 are cells that have differentiated into only mature white adipocytes and are the most widely used cell line in obesity research. In the present disclosure, the effect of lactic acid bacteria culture medium on the Browning of lactic acid bacteria culture medium (Browning) is studied, which is a process in which energy-accumulating white adipocytes consume energy and are converted into brown adipocytes that maintain exothermic reaction and thermal homeostasis. In addition, analysis of the expression patterns of brown and beige adipocyte factor-specific genes in mouse C3H10T1/2 mesenchymal stem cells allows the development of compositions for the prevention and treatment of obesity under new paradigms.

In this regard, in korean patent No. 1778734, there are disclosed "ESBP isolated from bifidobacterium longum KACC 91563 and antiallergic composition using the ESBP". Korean patent 1401530 discloses "a strain of bifidobacterium longum producing conjugated linoleic acid and use thereof". However, the above-mentioned document does not disclose "bifidobacterium longum strain or lactobacillus rhamnosus strain having an effect of preventing or treating obesity by inducing the formation of beige adipocytes and brown adipocytes and uses thereof" according to the present disclosure.

[ invention ]

[ problem ]

The present disclosure is based on the above-described needs. Unlike the conventional method of identifying an anti-obesity effect in terms of reducing the number of white adipocytes, according to the present disclosure, 3T3-L1, which is a precursor adipocyte matured to be most widely used for obesity research on white adipocytes and differentiated to be completed, is treated with each of bifidobacterium longum DS0956 strain and lactobacillus rhamnosus DS0508 strain medium to study the effect of the treatment on Browning of 3T3-L1 adipocytes (Browning), a process in which energy is consumed by energy-accumulating white adipocytes and converted into brown adipocytes maintaining exothermic reaction and thermal homeostasis.

As a result, treatment with each of lactobacillus longum DS0956 strain and lactobacillus rhamnosus DS0508 strain medium according to the present disclosure promoted expression of beige adipocyte and brown adipocyte-specific genes in white adipocyte 3T 3-L1. In addition, it was also confirmed that this treatment promoted the expression of the beige adipocyte-specific gene and the expression of the brown adipocyte-specific gene in the mouse C3H10T1/2 mesenchymal stem cells.

Furthermore, based on the results of studying the inhibitory or ameliorating effects of obesity by administering bifidobacterium longum and lactobacillus rhamnosus strains or a culture medium thereof according to the present disclosure to high fat diet-induced obese mice, the effects of inhibiting significant weight gain compared to negative controls, as well as the increased expression level and the induced effects of thermogenic specific genes or brown adipocyte/beige adipocyte specific genes in mouse white adipocytes were confirmed. In addition, the lowering effect of total cholesterol and Low Density Lipoprotein (LDL) was also demonstrated, suggesting an overall improvement in lipid metabolism characteristics of the obese mouse model.

Based on the above facts, it was confirmed that bifidobacterium longum strain and lactobacillus rhamnosus strain oxidize in vivo fat by activating gene expression associated with in vivo fat cell oxidation, and greatly reduce in vivo fat cell metabolism and fat cell accumulation, and significantly improve lipid metabolism characteristics of animals to which the strain is administered. Thus, the present disclosure has been completed.

[ technical solution ]

To achieve these objects, the present disclosure provides a novel bifidobacterium longum (Bifidobacterium longum) strain or lactobacillus rhamnosus (Lactobacillus rhamnosus) strain.

Furthermore, the present disclosure provides a pharmaceutical composition for preventing or treating obesity, which comprises at least one selected from the group consisting of a strain, a medium of the strain, a concentrate of the medium, a dried material of the medium, and an extract of the medium as an active ingredient.

Furthermore, the present invention provides a health functional food composition for preventing or improving obesity, which comprises at least one selected from the group consisting of a strain, a medium of the strain, a concentrate of the medium, a dried product of the medium, and an extract of the medium as an active ingredient.

Furthermore, the present invention provides a feed composition for preventing or improving obesity, which comprises at least one selected from the group consisting of a strain, a medium of the strain, a concentrate of the medium, a dried product of the medium, and an extract of the medium as an active ingredient.

[ advantageous effects of the invention ]

Treatment of each of the lactobacillus bifidobacterium longum strain and lactobacillus rhamnosus strain according to the present disclosure caused browning of 3T3-L1 that should only mature into white adipocytes. In particular, we demonstrate that this treatment has the effect of significantly increasing the expression of beige adipocyte and brown adipocyte specific genes in white adipocyte 3T3-L1 and mouse mesenchymal stem cell C3H10T1/2 cells, as compared to the untreated control.

Furthermore, we confirmed that when lactobacillus longum and lactobacillus rhamnosus strains or media according to the present disclosure are administered to a subject, weight gain due to ingestion of a high-fat diet is inhibited and the expression levels of genes associated with thermogenesis and brown fat/beige adipocyte-specific genes are increased, thereby reducing the amount of lipid components such as cholesterol and LDL.

Thus, both the lactobacillus longum strain and the lactobacillus rhamnosus strain exhibit an anti-obesity effect, and thus are useful as foods, medicines or feeds for preventing or treating obesity, improving lipid metabolism and related industries.

[ description of the drawings ]

FIG. 1a shows a selection scheme for selecting strains with anti-obesity efficacy from 55 lactic acid bacteria using 3T3-L1 cells which are preadipocytes.

FIG. 1b is the selection results after quantification using TG (triglyceride) and first treatment with 1, 5 and 10. Mu.l of lactic acid bacteria culture medium. A, 1 μl of lactobacillus culture medium; b, lactic acid bacteria culture medium 5 μl treatment group; c, 10 μl of lactobacillus culture medium; t, excluded from the second screening due to cytotoxicity. PA, negative control, preadipocytes, untreated with MDI differentiation medium; MDI (M: methyl-isobutyl-xanthine D: dexamethasone, I: insulin) adipocyte differentiation medium treated control; the positive control was Rosi (rosiglitazone) treated. Rosi is a PPAR-gamma agonist.

FIG. 2a is a graph showing comparison of Triglyceride (TG) relative accumulation of selected strain media (# 30 and #51 strains) compared to control. PA, MDI and Rosi are the same as described in fig. 1 b.

FIG. 2b is a microscopic image (5,000Xmagnification) of cells observed by TEM when 3T3-L1 cells are treated with the selected strain medium. White arrows indicate Lipid Droplets (LD).

FIG. 2c shows ORO staining (oil red O dye) of the selected strain medium (# 30 and #51 strains). 1 st, 1. Mu.l of lactic acid bacteria culture medium treatment group; 2, 5. Mu.l of lactic acid bacteria culture medium; 3, 10. Mu.l of lactic acid bacteria culture medium; negative control not treated with MDI differentiation medium; (+), MDI differentiation medium treatment group; positive control treated with Rosi (rosiglitazone). Rosi is a PPAR-gamma agonist. #30 and #51 refer to treatments with the selected lactobacillus culture medium.

FIG. 3a shows the effect of the selected lactic acid bacteria culture medium (strain #30, strain # 51) on brown adipocyte-specific gene expression in mouse preadipocytes 3T3-L1, and shows a relative expression level comparison of mRNA. FIG. 3b shows the effect of the selected lactic acid bacteria culture medium (strains #30 and # 51) on the specific expression of genes for brown adipocytes in mouse mesenchymal stem cells C3H10T1/2 cells, and shows a comparison of the relative expression levels of the gene mRNA. MDI (M: methyl-isobutyl-xanthine, D: dexamethasone, I: insulin) adipocyte differentiation medium-treated negative control; positive control treated with Rosi (rosiglitazone). Rosi is a PPAR-gamma agonist. #30 and #51 refer to treatments with the selected lactobacillus culture medium.

FIG. 4a shows the effect of the selected lactic acid bacteria culture medium (strain #30, strain # 51) on the expression of beige adipocyte-specific genes in mouse preadipocytes 3T3-L1, and shows a comparison of the relative expression levels of mRNA. FIG. 4b shows the effect of the selected lactic acid bacteria culture medium (strains #30 and # 51) on the specific expression of genes in the beige adipocytes in the mouse mesenchymal stem cells C3H10T1/2 cells, and shows the relative expression level comparison of the gene mRNA. MDI (M: methyl-isobutyl-xanthine, D: dexamethasone, I: insulin) adipocyte differentiation medium-treated negative control; positive control treated with Rosi (rosiglitazone). Rosi is a PPAR-gamma agonist. #30 and #51 refer to treatments with the selected lactobacillus culture medium.

FIG. 5a is a graph comparing the expression levels of the lipolytic related genes measured based on the relative amounts of mRNA when 3T3-L1 cells were treated with selected lactic acid bacteria media (strains #30 and # 51). FIG. 5b is a graph comparing the expression levels of the beta oxidation-related genes measured based on the relative amounts of mRNA.

FIG. 6 demonstrates whether PKA signaling is activated when lactic acid bacteria culture media of strain #30 and strain #51 are applied to 3T3-L1 cells. A demonstrates whether PKA is phosphorylated. B represents the results of treatment with H89 as a PKA phosphorylation inhibitor. C is a graph of the level of thermogenesis-related gene expression resulting from H89 treatment based on the relative amount of mRNA measurement. D to F are graphs comparing the expression levels of the thermogenesis-related gene and the adipocyte differentiation-related gene based on the amount of mRNA and protein using siPKA cat a 1.

FIG. 7 demonstrates the change in lipolytic enzyme-related gene expression when 3T3-L1 cells were treated with lactobacillus culture media #30 and #51 (left panel, HSL S-660 and HSL S-563 refer to Ser, respectively ⁵⁶³ And Ser ⁶⁶⁰ Is shown), and confirms the presence or absence of AMPK phosphorylation and activation of the transcriptional regulator CREB (middle panel), and confirms the change in the presence or absence of lipolytic enzyme-related gene and CREB phosphorylation according to PKA inhibitor H89 treatment (right panel).

Figure 8 shows the measured weight change of high fat diet induced obese mice 12 weeks after administration of lactic acid bacteria strain or medium. ( G1, high fat diet non-treated group; g2, high fat diet administration group; g3, high fat diet and microbial medium administration group; g4, high fat diet and lactobacillus rhamnosus GG bacteria administration group; g5, high fat diet and #30 strain medium administration group; g6, high fat diet and #51 strain medium administration group; g7, high fat diet and #30 bacteria administration group; g8, high fat diet and #51 bacteria administration group. Others are the same as described above )

Fig. 9 shows H & E (hematoxylin and eosin) staining of white adipocytes in high fat diet induced obese mice 12 weeks after strain or culture medium administration.

FIG. 10 shows changes in glucose, total cholesterol (T-chol), high Density Lipoprotein (HDL) and Low Density Lipoprotein (LDL) levels in blood of obese mice induced by a high fat diet after 12 weeks of administration of lactic acid bacteria strains or culture medium to subjects who were mice induced to obesity by the high fat diet.

Fig. 11 shows the change in thermogenesis-specific gene expression in White Adipocytes (WAT), gonadal white adipocytes (gonadal WAT), peritoneal white adipocytes (peritoneal WAT) and mesenteric white adipocytes (mesenteric WAT) of mice with high fat diet induced obesity 12 weeks after administration of the lactobacillus strain or medium.

FIG. 12a is a graph comparing the relative mRNA expression levels of genes including M1 macrophage inflammatory-related cytokines in mice with high fat diet-induced obesity 12 weeks after administration of lactic acid bacterial strain or culture medium.

FIG. 12b shows a graph comparing the relative mRNA expression levels of M2 macrophage specific gene in mice with high fat diet induced obesity after 12 weeks of administration of lactic acid bacterial strain or culture medium.

[ detailed description ] of the invention

Hereinafter, the present disclosure will be described in detail.

Bifidobacterium longum strain and lactobacillus rhamnosus strain

According to one aspect of the present disclosure there is provided a novel bifidobacterium longum strain or lactobacillus rhamnosus strain.

The bifidobacterium longum strain may be bifidobacterium longum DS0956, preferably, but not limited to, bifidobacterium longum DS0956 strain deposited under accession number KCTC13505 BP. The bifidobacterium longum DS0956 strain was deposited at the institute of bioscience and biotechnology, korea under accession number KCTC13505BP, at 2018, month 3 and 26.

The lactobacillus rhamnosus strain may be lactobacillus rhamnosus DS0508, preferably, lactobacillus rhamnosus DS0508 strain with accession number KCTC13504BP, but is not limited thereto. Lactobacillus rhamnosus DS0508 strain was deposited at the institute of bioscience and biotechnology in korea under accession number KCTC13504BP, deposited at 2018, month 3 and 26.

Among the strains according to one embodiment of the present disclosure, bifidobacterium longum strain or lactobacillus rhamnosus strain is intended to induce the formation of beige adipocytes and brown adipocytes to promote an anti-obesity effect. Preferably, the bifidobacterium longum strain or lactobacillus rhamnosus strain increases the expression of thermogenesis-related genes and brown adipocyte-related genes in 3T3-L1 adipocytes and mouse mesenchymal stem cells C3H10T1/2 in a specific manner, thereby inducing the formation of beige adipocytes and brown adipocytes. More preferably, the bifidobacterium longum strain or lactobacillus rhamnosus strain increases the expression of the Ucp (uncoupling protein 1), pgc1a (peroxisome proliferator activated receptor gamma coactivator 1- α), prdm16 (PR/SET domain 16), pparg (peroxisome proliferator activated receptor gamma), CD137, fgf21 (fibroblast growth factor 21), P2RX5 (purinergic receptor P2X 5) and Tbx1 (T-box 1) genes to induce the formation of beige adipocytes and brown adipocytes. Most preferably, the bifidobacterium longum strain or lactobacillus rhamnosus strain increases the expression of the thermogenesis-related genes Ucp, pgc1a, prdm16 and brown adipocyte-related CD137 and Fgf21 genes in 3T3-L1 adipocytes and mouse mesenchymal stem cells C3H10T1/2 in a specific manner, thereby inducing the formation of beige adipocytes and brown adipocytes. However, the present disclosure is not limited thereto. The CD137 gene is also known as TNFRSF9 (TNF receptor superfamily member 9). Furthermore, the expression level of the Past1, resistin or sarcina 3k gene specifically expressed in white adipocytes can be reduced under treatment with the bifidobacterium longum strain or lactobacillus rhamnosus strain according to the present disclosure.

The strain according to the present disclosure increases the expression of brown adipocyte or beige adipocyte-specific genes in white adipocytes that have been differentiated, and can convert white adipocytes into brown or beige adipocytes. Because brown adipocytes and beige adipocytes are characterized by promoting lipolytic production of energy, the strain according to the present disclosure has an effect of inhibiting or ameliorating obesity.

In addition, bifidobacterium longum strain or lactobacillus rhamnosus strain increases the expression level of the genes Atgl, HSL, pnin or Pnin5 associated with lipolysis or may also increase the expression level of the genes LCAD, MCAD, LCPT or Abhd5 associated with beta-oxidation of lipids. The lipolysis-related gene or the beta-oxidation-related gene can promote the action of decomposing and removing accumulated fat. Thus, the strain of the present invention has an effect of suppressing or improving obesity by reducing accumulation of fat and suppressing weight gain.

In addition, bifidobacterium longum strains or lactobacillus rhamnosus strains may activate PKA signaling. The bifidobacterium longum strain or lactobacillus rhamnosus strain may activate the PKA signaling process to increase the amount of phosphorylated PKA, phosphorylated AMPK and phosphorylated transcription regulator CREB, thereby increasing the expression of genes related to thermogenic adipocyte differentiation, i.e. Ucp, pgc a, pparg or Ceba genes, thus achieving an effect of inhibiting or improving obesity by inducing white adipocyte browning.

The bifidobacterium longum strain or lactobacillus rhamnosus strain according to the present disclosure has an effect of improving or treating obesity by improving lipid metabolism characteristics when administered to an obese subject. To demonstrate the effect of improving lipid metabolism characteristics according to the present disclosure, in one particular embodiment of the present disclosure, a strain or culture of bifidobacterium longum or lactobacillus rhamnosus is administered to mice with high fat diet induced obesity to observe any changes. The results showed that the strain and the culture medium according to the present disclosure have the effect of inhibiting weight gain and increasing the expression levels of the genes associated with heat generation, brown adipocytes, and beige adipocyte-specific genes in white adipocytes of mice. An increase in the level of gene expression as described above may promote transdifferentiation (transdifferentiation) of white adipocytes into brown adipocytes or beige adipocytes in a subject, thereby inhibiting or ameliorating obesity. In addition, lipid metabolism can be improved by reducing the amount of lipid components such as cholesterol and LDL in a subject to whom the strain or medium is administered.

Furthermore, in another specific embodiment of the present invention, based on the results of studying the gene expression levels when a strain or culture of bifidobacterium longum or lactobacillus rhamnosus is administered to an obese subject, it was confirmed that the expression levels of each of the inflammation promoting M1 macrophage markers CD11c, CD68, IL-1b, mcp1 and TNF-a genes were reduced and the expression levels of the anti-inflammatory M2 macrophage markers, i.e., arg1 and CD206 genes, were increased in white adipocytes of the subject. Thus, when a strain or medium of the present disclosure is administered to a subject having obesity, a transformation occurs in which the amount of M1 macrophages is reduced and the amount of M2 macrophages is increased. Thus, it is suggested that administration of the strain or the medium to an obese subject may promote an effect of suppressing or improving obesity.

2. Composition comprising lactic acid bacteria

According to another aspect of the present disclosure there is provided a composition comprising lactic acid bacteria.

The lactobacillus comprises bifidobacterium longum or lactobacillus rhamnosus.

The composition comprising lactic acid bacteria contains at least one selected from the group consisting of a strain, a medium of the strain, a concentrate of the medium, a dried product of the medium and an extract of the medium as an active ingredient.

The composition comprising lactic acid bacteria according to the present disclosure may be prepared in unit dosage form or may be introduced into a multi-dose container by formulation using carriers, excipients and/or additives using methods that can be easily performed by one of ordinary skill in the art to which the present disclosure pertains. In this regard, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, capsule, gel (e.g., hydrogel) or lyophilized formulation. Additives, such as dispersants, stabilizers or cryoprotectants, may be additionally included therein.

In particular, when the additive is a cryoprotectant, the strain may be lyophilized with the cryoprotectant and may be used in powder form. The cryoprotectant may be skimmed milk powder, maltodextrin, dextrin, trehalose, maltose, lactose, mannitol, cyclodextrin, glycerol and/or honey. In addition, the composition may be mixed with a storage carrier, and the mixture may be absorbed and dried and cured for use. The storage carrier may be diatomaceous earth, activated carbon, and/or defatted rice bran.

The composition comprising lactic acid bacteria according to the present disclosure may be prepared by mixing at least one selected from the group consisting of a strain, a medium of the strain, a concentrate of the medium, a dry matter of the medium, and an extract of the medium with any one of a carrier, an excipient, or an additive.

The descriptions of strains, carriers, excipients and additives are as described above. When a cryoprotectant is used as an additive, a composition comprising lactic acid bacteria may be prepared in the form of a lyophilized powder, a mixture is prepared by mixing the strain and the cryoprotectant with each other, and frozen at-45 ℃ to-30 ℃, dried at 30 ℃ to 40 ℃, and the mixture is ground with a mixer to obtain a lyophilized powder. Specifically, the freezing process may be a process of vacuum freezing the mixture at a temperature condition of-45 ℃ to-30 ℃ and a pressure condition of 5 to 50 millitorr for 65 to 75 hours.

3. Use of a composition comprising lactic acid bacteria for preventing, treating or ameliorating obesity

According to another aspect of the present disclosure there is provided the use of a composition comprising lactic acid bacteria for the prevention, treatment or amelioration of obesity.

The composition comprising lactic acid bacteria may be a pharmaceutical product, a food or a feed. When the composition comprising lactic acid bacteria is a pharmaceutical product, the composition may be a pharmaceutical composition for preventing or treating obesity. When the composition comprising lactic acid bacteria is a food product, the composition may be a health functional food composition for preventing or improving obesity. When the composition comprising lactic acid bacteria is a feed, the composition may be a feed composition for preventing or improving obesity.

The present disclosure provides a pharmaceutical composition for preventing or treating obesity, which comprises at least one selected from the group consisting of a strain, a medium of the strain, a concentrate of the medium, a dry matter of the medium, and an extract of the medium as an active ingredient.

The strains described above, in one embodiment according to the present disclosure, the pharmaceutical compositions may be prepared in unit dosage form, or may be introduced into multi-dose containers by formulation using pharmaceutically acceptable carriers and/or excipients, using methods that may be readily performed by one of ordinary skill in the art to which the present disclosure pertains. In this regard, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granule, tablet, capsule or gel (e.g., hydrogel). The formulation may additionally comprise a dispersing agent or a stabilizing agent.

In addition, the strains contained in the pharmaceutical composition may be supported on a pharmaceutically acceptable carrier, such as a colloidal suspension, powder, physiological saline, lipid, liposome, microsphere (microsphere) or nanoparticle. They may be complexed or linked with a carrier (vehicle) and may be delivered in vivo using delivery systems known in the art, such as lipids, liposomes, microspheres, gold, nanoparticles, polymers, condensing agents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids.

In addition, pharmaceutically acceptable carriers can include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, rubber, calcium phosphate, alginates, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil and the like, which are commonly used in formulations. The present disclosure is not limited thereto. Further, in addition to the above components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifying agents, suspending agents, preservatives and the like may be contained therein. Suitable pharmaceutically acceptable carriers and formulations Remington's Pharmaceutical Sciences,19th ed.,1995 are described in detail.

The pharmaceutical composition of the present invention may be administered orally or parenterally at the time of clinical administration, and may be used in the form of general pharmaceutical preparations. That is, the pharmaceutical compositions according to the present disclosure may be administered in a variety of oral and parenteral dosage forms during actual clinical administration. Formulations may be prepared using diluents or excipients, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, and the like, which are commonly used. Solid formulations for oral administration may include tablets, pills, powders, granules, capsules and the like. These solid formulations may be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the herbal extract or the fermented herbal product. In addition, lubricants such as magnesium stearate and talc are used in addition to simple excipients. Liquid formulations for oral administration may include suspensions, liquid solutions, emulsions and syrups. In addition to water and liquid paraffin, which are generally used as simple diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be contained therein. Formulations for parenteral administration include sterile aqueous solutions, nonaqueous solvents, suspensions, emulsions, lyophilized formulations and suppositories. Propylene glycol, polyethylene glycol, vegetable oils (such as olive oil) and injectable esters (such as ethyl oleate) may be used as nonaqueous solvents and suspensions. Suppository bases may include Witepsol, macrogol, tween 61, cocoa butter, laurin, glycerin, gelatin, and the like.

The pharmaceutical compositions according to the present disclosure may be used alone or in combination with surgery, radiation therapy, hormonal therapy, chemotherapy and methods of using biological response modifiers for the inhibition and treatment of obesity.

The concentration of the active ingredient contained in the composition according to the present disclosure may be determined in consideration of the purpose of treatment, the condition of the patient, the time required, and the like, and is not limited to a specific concentration range. The pharmaceutical compositions according to the present disclosure are administered in a pharmaceutically effective amount. In the present disclosure, the term "pharmaceutically effective amount" refers to an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment. The effective dosage level may depend on factors including the type of disease, its severity, pharmaceutical activity, sensitivity to the drug, time of administration, route of administration and rate of excretion, duration of treatment, simultaneous use of the drug and other factors well known in the medical arts. The pharmaceutical composition according to the present disclosure may be administered as a single therapeutic agent, or may be administered in combination with a therapeutic agent for diseases caused by other contaminants, or a formulation for improving skin aging, or may be administered simultaneously, separately or sequentially with a conventional therapeutic agent, or may be administered singly or in multiple times. When considering all of the above factors, it is important to administer the composition in an amount that achieves maximum effect in a minimum amount and without side effects. Such amounts can be readily determined by one skilled in the art.

In particular, the effective amount of the pharmaceutical composition according to the present disclosure may vary according to the age, sex, condition, body weight, absorption of an active ingredient in vivo, inactivation rate, excretion rate, type of disease, and drug used in combination therewith of a patient, or may be increased or decreased according to the administration route, severity of obesity, sex, body weight, age, etc. For example, the composition according to the invention may be administered in an amount of about 0.0001 μg to 500mg, e.g. 0.01 μg to 100mg, per 1kg patient body weight per day. Furthermore, the composition may be administered separately several times a day, for example, 2 to 3 times a day at regular time intervals, at the discretion of a physician or pharmacist.

The present disclosure provides a method for preventing or treating obesity, comprising administering the pharmaceutical composition to a subject.

The subject may be a human or non-human animal, and may be in a non-obese state or in an obese state. When the subject is not in an obese state, obesity may be prevented by administering the pharmaceutical composition to the subject in a pharmaceutically effective amount. When the subject is in an obese state, obesity may be treated by administering the pharmaceutical composition to the subject in a pharmaceutically effective amount.

The formulation of the pharmaceutical composition, the method of administration thereof, the dosage thereof and the concentration of the active ingredient contained in the composition are as described above.

In the health functional food composition according to an embodiment of the present disclosure, the health functional food composition may inhibit weight gain or fat accumulation.

When the health functional food composition according to the present disclosure is used as a food additive, the health functional food composition may be added in an unchanged manner or may be used together with other foods or food raw materials, and may be suitably used according to conventional methods. The amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention or improvement). Generally, the health functional food composition according to the present disclosure may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the weight of raw materials when preparing food or beverage. However, for health purposes, the amount may be less than the above range for long term consumption. Because of no safety problem, the active ingredient may be used in an amount higher than this range.

The kind of the functional health food is not particularly limited. Examples of foods to which the health functional food composition may be added may include meat, sausage, bread, chocolate, candy, snack, candy (pizza), stretched noodles, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, and the like. The food may include all kinds of health foods in a general sense.

Furthermore, the health functional food composition according to the present disclosure may be prepared as a food, in particular a functional food. Functional food according to the present disclosure comprises ingredients that are typically added during food preparation. Examples thereof may include proteins, carbohydrates, fats, nutrients, and condiments. For example, when the food product is prepared as a beverage, natural carbohydrates or flavoring agents may be included therein as additional ingredients in addition to the active ingredient. Natural carbohydrates may include monosaccharides (e.g., glucose, fructose, etc.), disaccharides (e.g., maltose, sucrose, etc.), oligosaccharides, polysaccharides (e.g., dextrins, cyclodextrins, etc.), or sugar alcohols (e.g., xylitol, sorbitol, erythritol, etc.). The flavoring agent may be a natural flavoring agent (e.g., thaumatin (thaumatin), stevia extract, etc.) and a synthetic flavoring agent (e.g., saccharin, aspartame (aspartame), etc.).

In addition to the health functional food composition, the food may further comprise various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acids and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents for carbonated beverages, and the like. Although the content of the additive component is not very important, the content may be generally selected from the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health functional food composition according to the present disclosure.

The strain as described above, the composition can be added as a feed additive composition to prevent or improve obesity. The feed additive according to the present disclosure may be a supplementary feed under the feed management act.

In the present disclosure, the term "feed" may refer to any natural or artificial diet, meal or ingredient of a meal that is consumed, ingested and digested or applicable by an animal. The kind of the feed is not particularly limited. Feeds commonly used in the art may be used. Non-limiting examples of feeds may include plant feeds such as grains, root fruits, food processing byproducts, algae, fibers, pharmaceutical byproducts, oils and fats, starch, melon (gourd), or grain byproducts; and animal-based feeds such as proteins, minerals, oils, minerals, single cell proteins, zooplankton, foods, and the like. These may be used singly or in combination of two or more.

Hereinafter, the present disclosure will be described in detail based on embodiments. However, the following embodiments are only intended to specifically exemplify the present disclosure, and the disclosure according to the present disclosure is not limited to the following embodiments.

Materials and methods

Reagents used

Dexamethasone, IBMX (isobutyl-1-methylxanthine), insulin, rosiglitazone (Rosi), oil red O dye, MTT (bromo-3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyltetrazol) and 4% formaldehyde, purchased from Sigma Aldrich (san-loui, missouri, usa).

DMEM (Dulbecco Modified Eagle's Media), neonatal bovine serum (NBCS) and recombinant human BMP4, purchased from Gibco (gland Ai Lan, new york, usa). Fetal bovine serum was purchased from atlas biologics (kolin burg, colorado, usa). Penicillin-streptomycin solution was purchased from Hyclone Laboratories, inc. (southern lony, new york, usa).

Lactic acid bacteria isolation

For isolation of various lactic acid bacteria, MRS medium was used under absolute anaerobic conditions. For anaerobic conditions, N is used ₂ The gas removes oxygen present in the medium, and the medium is then sterilized. 0.1g of the collected fecal sample was suspended in 10ml of MRS medium, diluted stepwise, and plated on MRS plate medium or blood agar medium at 100. Mu.l, and cultured under anaerobic conditions at 37℃for 2 days. As a result, the single colonies obtained were subcultured, purified and isolated, and stored for a long period of time.

Identification of isolated lactic acid bacteria

For molecular biological identification of isolated lactic acid bacteria 27F (5 '-AGA GTT TGA TCM TGG CTC A-3': SEQ ID NO: 3) and 1492R (5 '-TAC GGY TAC CTT GTT ACG ACT T-3': SEQ ID NO: 4) were used as universal primers targeting the 16S rRNA gene. Nucleotide sequence analysis of the 16S rRNA gene was performed. The nucleotide sequences obtained by analysis were identified by an identification search in EZbiocloud (http:// www.ezbiocloud.net /).

Anti-obesity Activity Studies

To study anti-obesity activity, 5% CO was used ₂ A tank containing 10% NBCS and 1% penicillin-chain therein at 37 DEG C3T3-L1 cells were cultured in DMEM Glutamax of mycin. When the cell concentration of 3T3-L1 cells was in the range of 70 to 80%, cells were seeded into 48-well plates. When the cell concentration reached 100%, the medium was replaced with adipocyte differentiation medium MDI (insulin, dexamethasone, isobutyl-1-methylxanthine (IBMX)). On day 2, each of insulin, a combination of insulin and ROSI, and a combination of insulin and sample (strain medium) was added thereto. On day 4, insulin was added thereto only. Then, on day 6, the cells were fixed without sample treatment. At this time, 1, 5 and 10. Mu.l of samples were added to the medium on day 0 and day 2, respectively, for the anti-obesity effect of the lactic acid bacteria solution, and MDI was replaced with new MDI every 2 days during cell differentiation. Day when the cell concentration became 100% was defined as day 0. On day 0, each of MDI, a combination of ROSI and MDI, and a combination of sample and MDI was added thereto. In this experiment, three independent tests were performed for each sample. To observe the cells, 3T3-L1 cells were cultured in 24-well plates for 6 days, fixed, and stained with Oil Red O (ORO) stain. Briefly explaining the experimental method, cells were first washed once with 1×pbs, and then fixed with 10% formalin at room temperature for 1 hour. Then, the mixture was dyed with 0.3% ORO solution at room temperature for 20 minutes, and then washed with distilled water 4 times. After washing, the altered phenotype was observed with an Axiovert-25 microscope and photographed. The stained cells were then lysed in 100% isopropanol, and the amount of ORO therein was measured based on absorbance at 520nm using victoritmx 3.

In addition, C3H10T1/2 mouse mesenchymal stem cells were purchased from Korean cell line bank (KCLB-10226) and used 5% CO at 37 ℃ ₂ The incubator was cultured in high concentration glucose DMEM medium containing 10% nbcs and 1% penicillin-streptomycin. To induce differentiation (typing), C3H10T1/2 cells were seeded therein at 20 to 30% cell concentration. To differentiate into adipocytes, the cells were treated with 50ng/mL human recombinant BMP4 until the cell concentration became 100%. Thereafter, the medium was replaced with fresh medium every 2 to 3 days. Day 48 hours after the cell concentration became 100% was defined as day 0. At a predetermined concentrationThe differentiation was induced by replacing the medium with DMEM containing 10 μg/ml insulin (MDI), 10% fbs, 0.5mM IBMX and 1 μm dexamethasone under conditions where the cells were treated with Rosi or lactic acid bacteria medium. Differentiated cells were exposed to 500 μm dibutyryl-cAMP for 4 hours to stimulate thermogenesis.

qRT-PCR analysis

To find expression of genes in cells treated with lactic acid bacteria medium, total RNA was extracted from them using RNA extraction kit (valencia Qiagen, california) according to the manufacturer's instructions. The concentration was measured using a Scandrop Analytik Jena AG spectrometer (Jena, germany). 1. Mu.g of RNA was synthesized into cDNA using Maxime RT Premix kit (Korean iNtRON Biotechnology). The PCR reaction was performed in a Veriti 96-well thermal cycler (Singapore Applied Biosystems). Using iQ ^TM SYBR Green Supermix kit (Singapore Bio-Rad), CFX96 ^TM Quantitative real-time PCR was performed on a real-time PCR detection system (Singapore Bio-Rad). The sequences of the primers are listed in table 1. The expression level was quantified with Gapdh (glyceraldehyde 3-phosphate dehydrogenase) (Yoon D, imran KM, kim YS.2018Toxicol Appl Pharmacol.Feb 1; 340:9-20).

[ Table 1 ]

Primer set used in this experiment

Gene name	Forward (5 '. Fwdarw.3') (SEQ ID NO)	Reverse (5 '. Fwdarw.3') (SEQ ID NO)
			Ucp1	ACAGCTTTCTGGGTGGATT(5)	ACAGCTTTCTGGGTGGATT(6)
Pgc1a	ACAGCTTTCTGGGTGGATT(7)	TGAGGACCGCTAGCAAGTTT(8)
			Prdm16	CAGCACGGTGAAGCCATTC(9)	GCGTGCATCCGCTTGTG(10)
Tbx1	GGCAGGCAGACGAATGTTC(11)	TTGTCATCTACGGGCACAAAG(12)
			Fgf21	AGATCAGGGAGGATGGAACA(13)	TCAAAGTGAGGCGATCCATA(14)
CD137	ACAGCTTTCTGGGTGGATT(15)	ACAGCTTTCTGGGTGGATT(16)
			Cox2	GACTGGGCCATGGAGTGG(17)	CACCTCTCCACCAATGACC(18)
P2RX5	CTGCAGCTCACCATCCTGT(19)	CACTCTGCAGGGAAGTGTCA(20)
			Gapdh	GACATGCCGCCTGGAGAAAC(21)	AGCCCAGGATGCCCTTTAGT(22)

Investigation of anti-obesity efficacy by administration of high fat diet-induced obese mice

After inducing the obesity model by letting the mice ingest a high fat diet, the intestinal microbial medium or microbial cells are administered to the mice for 12 weeks. The efficacy was checked. The mice used in this study were 3 week old C57BL/6SPF male mice. Of the 7 day acclimated mice, only healthy animals were used for testing. Mice were fed a high fat Diet using 45% kcal high fat Diet D12451 (Research Diet) for 12 weeks to establish a Diet-induced obesity (DIO) mouse model. The composition of the groups used in the experiments is illustrated in table 2 below. The application amount of lactobacillus is 10 ⁹ Cells/kg. 1ml of the medium for each animal was freeze-dried and then dissolved in 150. Mu.l of distilled water and administered once per day.

[ Table 2 ]

For all animals, the general symptoms were observed once daily until necropsy, and body weight and food amounts were measured five times per week during the test period. After the end of the test period, anesthesia is performed in a respiratory anesthesia mode, and blood is collected therefrom by cardiac blood collection. Fat fractions were excised from each group of 2 mice and stored in 4% paraformaldehyde solution or RNA storage solution (ThermoFisher). Blood cell analysis was performed using a hemocytometer (Beckman Coulter). Then, the sample subjected to the blood cell analysis is centrifuged to obtain plasma. The samples were then analyzed for total cholesterol, HDL, LDL, and glucose using plasma. Adipose tissue contained in 4% pfa solution was used for paraffin block preparation.

Statistical analysis

All data for this experiment are expressed as mean ± Standard Deviation (SD) of three or more independent experiments. Unless otherwise indicated, MDI treated sample groups were used to identify changes in data compared to control groups. Significant differences between the data of the control group and the other treatment groups were calculated using student t-test. * P <0.05, < P <0.01, < P <0.001.P values less than 0.05 are considered statistically significant.

Example 1 search for anti-obesity active Strain

To observe the possibility of using 55 lactobacillus strains to convert to beige and brown adipocytes in 3T3-L1 preadipocytes, each lactobacillus strain was cultured in MRS medium for 48 hours, and then centrifuged to obtain a supernatant. The resulting supernatant was freeze-dried, and then sterile distilled water having an initial volume of 1/10 was added to the supernatant to prepare a concentrate thereof. 1, 5 and 10 μl of each of the concentrates were applied to 3T3-L1 cells, wherein the accumulation of triglycerides was quantified by oil red O staining. Thus, active candidate groups (bars filled with diagonal lines) causing browning and beige adipocytes were selected in the lactic acid bacteria medium. Furthermore, candidate groups (filled with dotted bars) that inhibited adipocyte formation were selected therefrom (fig. 1B).

In the group with 10 to 20% increase in proliferation of adipocytes treated with each of 1, 5, and 10 μl of lactic acid bacteria concentrate (with Rosi as control), the active candidate group producing browning adipocytes was first selected from the group with a relatively high treatment concentration of 10 μl. For #51, which had an effect of inhibiting adipocyte formation, the active candidate group was selected from the group with a relatively high concentration of 10 μl in the three concentration test. After the first screening based on the amount of triglyceride accumulated as described above, the selected candidate group was further screened through the second and third screening processes based on whether UCP1, which is one of the brown adipocyte-specific genes, was expressed, thereby selecting four candidates. Then, lactic acid bacteria strains #30 and #51 were finally selected from the four candidate strains.

To determine the effect of the final selected #30 and #51 on adipocytes, treatments were performed with each of 1, 5, and 10 μl thereof. The amount of triglycerides was then investigated by oil red O staining. Lipid Droplets (LD) present in adipocytes were identified (fig. 2A to 2C). As a result, when treated with lactobacillus strains #30 and #51, accumulation of triglycerides was increased, and lipid droplets were not bonded to each other, and their sizes were small. Thus, it was found that #30 and #51 selected were strains expected to have the effect of inhibiting maturation of 3T3-L1 cells into white adipocytes and enhancing their conversion into brown adipocytes.

EXAMPLE 2 lactic acid bacteria Medium for the expression of genes specific for mouse Brown adipocytes and Miquel adipocytes Influence of

The beige adipocytes can express UCP1 (uncoupling protein 1) genes that are not expressed in white adipose tissue. It is known that expression of this gene in white adipocytes indicates that transdifferentiation from white adipocytes into beige adipocytes or brown adipocytes has occurred, and that transdifferentiation of cells occurs reversibly depending on feeding or external environment. Thus, in this experiment, the effect of the selected strain medium on the expression of beige adipocyte and brown adipocyte specific genes was studied.

The effect of lactic acid bacteria culture medium on the expression of genes specific to brown adipocytes and beige adipocytes in mice was studied. As shown in fig. 3A, in the 3T3-L1 adipocytes treated with #30 lactobacillus culture medium, the expression of the uncoupling protein 1 (UCP 1) gene, which is called brown adipocyte-specific gene, and the gene associated with heat production was significantly increased. Other brown adipocyte-specific genes were identified, namely, increased expression of Pgc a (peroxisome proliferator-activated receptor gamma coactivator 1-alpha) and Prdm16 (PR/SET domain 16). Furthermore, it has been found that the expression of peroxisome proliferator-activated receptor gamma (Pparg), which is important for general adipocyte differentiation, is increased. It was identified that treatment with lactobacillus culture #51 did not significantly increase expression of the brown adipocyte-specific gene, but increased expression of the Prdm16 gene.

Furthermore, in order to verify the effect of the lactobacillus culture medium again, the expression levels of the thermogenesis-related and brown adipocyte-related genes Ucp, pgc a and Prdm16 were identified when C3H10T1/2 cells as mouse mesenchymal stem cells were treated with the strain culture medium. From the identification results, it was confirmed that the treatment with the culture media of lactic acid bacteria #30 and #51 of the present disclosure increased the expression level of brown adipocyte-specific genes (fig. 3B).

Then, we identified the effect of #30 on the transdifferentiation of white adipocytes into beige adipocytes. Thus, it was characteristically identified that in 3T3-L1 adipocytes treated with lactobacillus culture medium #30, the expression of several beige adipocyte-specific markers, such as fibroblast growth factor 21 (Fgf 21), tbx1, P2RX5, CD137, cytochrome c oxidase subunit II (Cox 2), was significantly increased. In addition, it was confirmed that the expression of CD137 and Fgf21, which are genes important for the expression of beige adipocytes, was significantly increased in the cells treated with the #51 medium (fig. 4A).

Furthermore, in order to confirm the effect of the selected lactic acid bacteria strain or culture medium again, the strain culture medium was applied to mouse C3H10T1/2 mesenchymal stem cells. Then, the expression levels of the beige adipocyte-specific genes Fgf21, P2RX5, CD137 and Tbx1 (T-box 1) were identified. The results showed that the expression level of the beige adipocyte-specific gene was increased in the cells treated with the lactobacillus culture media #30 and #51 of the present invention (fig. 4B).

EXAMPLE 3 expression of the lactic acid bacteria Medium on lipolysis and beta-Oxidation related genes and on PKA Signaling Influence of activation of a procedure

To further identify the effect of the lactic acid bacteria culture medium according to the present disclosure, the lactic acid bacteria culture medium was applied to 3T3-L1 cells, and then the expression levels of genes Atgl, HSL, plin, plin5 associated with lipolysis were identified. Expression levels of the genes LCAD, MCAD, LCPT and Abhd5 associated with beta oxidation of lipids were identified.

As a result, the expression levels of Atgl, HSL, plin, plin5 gene and LCAD, MCAD, LCPT and Abhd5 genes were higher than the control in 3T3-L1 cells treated with lactic acid bacteria culture media #30 and #51 according to the present disclosure. (FIGS. 5A and 5B). Thus, it was confirmed that the treatment has an effect of suppressing fat accumulation and weight gain by inducing an effect capable of decomposing fat or oxidizing lipid components.

Furthermore, the lactobacillus culture medium according to the present invention was applied to 3T3-L1 cells, and then the activation of PKA signaling was measured. Whether phosphorylated PKA was increased was identified by Western blotting (FIG. 6A). Cells were then treated with 10mm h89 as a PKA inhibitor (fig. 6B). The phosphorylated PKA is then re-identified. Thus, it has been determined that treatment of cells with lactic acid bacteria culture media #30 and #51 of the present invention has the effect of activating the PKA signaling process based on an increase in phosphorylated PKA. After treatment of the cells with the PKA inhibitor H89, changes in the expression levels of the thermogenesis-related genes Ucp1 and Pgc a (C in fig. 6) were identified. Thus, it was again demonstrated that the practical H89 treatment reduced the expression levels of the Ucp and Pgc1a genes. Thus, it was confirmed again that the lactic acid bacteria culture medium of the present invention induces an increase in the expression level of the thermogenesis-related genes through PKA activation. Furthermore, si-PKA cat a1 was used to identify the expression of genes related to thermogenesis, genes related to adipocyte differentiation, and changes in the expression levels of these proteins. Thus, it was identified that the expression of the Ucp, pgc1a, pparg and Ceba genes was inhibited, while the amount of Ucp, pparg and Pgc1a proteins was also reduced. Thus, it was again determined that the lactobacillus culture medium of the present invention induced an increase in the level of thermogenesis-related gene expression by PKA activation (D to F in fig. 6).

Furthermore, it has been determined that lipolytic enzyme, AMPK phosphorylation and CREB phosphorylation as transcriptional regulator are increased when lactic acid bacteria #30 and #51 of the present invention are applied to 3T3-L1 cells. The effect of the present invention was again determined based on the results of the inhibition of lipolytic enzyme and CREB phosphorylation described above caused by treatment of H89 as a PKA inhibitor (see fig. 7).

Example 4 study of anti-obesity efficacy due to administration of obese mice induced based on a high fat diet

During the test, no general abnormal symptoms were observed in all groups. However, the weight of mice fed the high fat diet increased significantly by 34.0% compared to the normal group. In particular, in the strain medium #30 administration group (G5) and the strain cell #51 administration group (G8), the weight was reduced by 10.8% and 5.7%, respectively, on average, compared to the negative control (G2). Average weight loss occurred in both experimental groups (fig. 8). Furthermore, based on the results of analyzing the H & E pathology (area measurement) of each adipose cell tissue, gonadal fat reduction (19.6% reduction, 18.9% reduction, respectively), peritoneal fat reduction (21.2% reduction, 22.4% reduction, respectively), mesenteric fat reduction (33.9% reduction, 24.4% reduction, respectively) and white adipose tissue reduction (26.2% reduction, 23.4% reduction) in the G5 and G8 groups compared to the negative control (G2) were identified (fig. 9). Thus, the strains #30 and #51 or the culture medium thereof of the present invention were identified to have an effect of reducing fat accumulation.

Furthermore, based on the results of biochemical analysis, it was determined that the levels of total cholesterol and LDL were significantly reduced in the G5 and G8 groups compared to the negative control (fig. 10). Therefore, it was confirmed that administration of both the strain of the present invention and the culture medium to animals had an effect of lowering cholesterol and LDL components. Based on the results of identifying the expression levels of genes associated with thermogenesis or lipolytic enzymes, i.e., ucp1, pgc, 1a and Prdm16, in each adipose tissue, it was identified that the expression levels in four adipose tissues of mice were significantly increased in the group to which the strain or medium of the present invention was administered (fig. 11).

Furthermore, the effect of the lactic acid bacterial strain or the culture medium according to the present disclosure on the inflammation-associated macrophage polarization of white adipose tissue in the group of mice to which the strain or the culture medium was administered was identified. We identified changes in the expression levels of the pro-inflammatory M1 macrophage markers CD11c, CD68, IL-1B, mcp and TNF-a genes (FIG. 12A) and the anti-inflammatory M2 macrophage markers Arg1 and CD206 genes (FIG. 12B). It has been determined that in adipocytes of subjects in an obese state, the inflammatory response is promoted, a transformation from M2 macrophages to M1 macrophages occurs, inducing a change in macrophage polarity. Thus, we demonstrate that the lactic acid bacterial strain or the culture medium according to the present disclosure has an effect of inhibiting or improving obesity. As a result, in the mice to which the lactic acid bacterium strain or the medium of the present invention is administered, the expression level of the M1 macrophage marker gene is decreased, and the expression level of the M2 macrophage marker gene is increased. Thus, it was confirmed that the strains #30 and #51 of the present invention or the culture medium thereof have an effect of suppressing or improving obesity.

Example 5 identification of selected strains

As a result of the first screening, two strains (# 30 and # 51) having excellent anti-obesity activity were selected. Based on the results of their 16S rRNA gene analysis (SEQ ID Nos. 1 and 2), these two strains were identified as bifidobacterium longum subspecies longum (Bifidobacterium longum spp.longum) and Lactobacillus rhamnosus (Lactobacillus rhamnosus), respectively. These two strains were designated as bifidobacterium longum DS0956 (homology of 16S rRNA to bifidobacterium longum JCM 1217T 99.86%) and lactobacillus rhamnosus DS0508 (homology to lactobacillus rhamnosus JCM 1136T 100%), respectively. These two strains were then deposited in a proprietary manner under accession numbers KCTC13505BP and KCTC13504BP, respectively. Based on the results of their genome analysis, it was found that bifidobacterium longum DS0956 and lactobacillus rhamnosus DS0508 have genome sizes of 2.43Mbp and 3.01Mbp, respectively, on one chromosome thereof, and are free of plasmids.

The present disclosure has been described in detail above with reference to only the embodiments. However, it is apparent to those skilled in the art that various modifications and variations thereof are possible within the scope of the technical idea according to the present disclosure. Such modifications and variations fall within the scope of the appended claims.

[ PREPARATION METHOD ]

Preservation agency name: korean institute of life and engineering

Accession number: KCTC13505 BP

Preservation date: 2018, 3, 26

Preservation agency name: korean institute of life and engineering

Accession number: KCTC13504BP

Preservation date: 2018, 3, 26

Claims

1. Lactobacillus rhamnosus DS0508 strain deposited under accession number KCTC13504 BP.

2. A pharmaceutical composition for preventing or treating obesity, comprising at least one selected from the group consisting of the strain of claim 1, a culture solution of the strain, a concentrate of the culture solution, a dried product of the culture solution, and an extract of the culture solution as an active ingredient.

3. The pharmaceutical composition of claim 2, wherein the pharmaceutical composition induces the formation of white adipogenic beige adipocytes or brown adipocytes.

4. The pharmaceutical composition of claim 3, wherein the strain increases expression of each of Ucp, pgc1a, prdm16, pparg, CD137, fgf21, P2RX5, and Tbx1 genes in adipocytes, thereby inducing formation of beige adipocytes or brown adipocytes.

5. The pharmaceutical composition of claim 2, wherein the pharmaceutical composition promotes degradation of fat or beta-oxidation of lipids in adipocytes.

6. The pharmaceutical composition of claim 2, wherein the pharmaceutical composition reduces accumulation of cholesterol or low density lipoproteins in a subject suffering from obesity.

7. The pharmaceutical composition of claim 2, wherein the pharmaceutical composition is prepared as one formulation selected from the group consisting of a capsule, a powder, a granule, a tablet, a pill, or a lyophilized formulation.

8. A health functional food composition for preventing or improving obesity, comprising at least one selected from the group consisting of the strain of claim 1, a culture solution of the strain, a concentrate of the culture solution, a dried product of the culture solution, and an extract of the culture solution as an active ingredient.

9. A feed composition for preventing or improving obesity, comprising at least one selected from the group consisting of the strain according to claim 1, a culture solution of the strain, a concentrate of the culture solution, a dry matter of the culture solution, and an extract of the culture solution as an active ingredient.