CN117661124A

CN117661124A - Method and kit for constructing RNA library

Info

Publication number: CN117661124A
Application number: CN202311638841.0A
Authority: CN
Inventors: 殷雷; 孙再桥; 雷骏; 何柏晓; 陈鹏
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2023-11-30
Filing date: 2023-11-30
Publication date: 2024-03-08

Abstract

The invention provides a method for constructing an RNA library, which comprises the following steps: enriching mRNA from an RNA sample, wherein the mRNA is broken into mRNA small fragments in the enrichment process; performing reverse transcription and purification on the mRNA small fragment by using a first primer to obtain a first strand cDNA; amplifying the first strand cDNA by using a second primer and purifying to obtain a second strand cDNA; amplifying the two-chain cDNA by using a third primer to obtain an RNA library; the method can simplify the process of library establishment and effectively reduce the cost of library establishment, synchronously complete the reverse transcription of the template and the introduction of the double-end connector sequence through the synthesis of cDNA with the connector sequence in two rounds, complete the enrichment of the template, and realize the low-cost, rapid and efficient library establishment.

Description

Method and kit for constructing RNA library

Technical Field

The invention relates to the technical field of biotechnology and medicine, in particular to a method for constructing an RNA library.

Background

RNA second generation sequencing technology (RNANext-generation sequencing, RNA-seq) is generally a high-throughput large-scale transcriptome sequencing technology, and can simultaneously sequence hundreds of thousands or even millions of transcribed RNA molecules for identification of unknown pathogens, biological genetic evolution analysis, gene expression differential analysis, RNA synthesis and processing analysis, and the like. Thus, RNA-seq is widely used in the fields of scientific research, disease diagnosis, etc., and has achieved a number of breakthrough results. RNA library construction refers to the process of converting RNA into double-stranded DNA recognizable by a second-generation sequencer through reverse transcription, adaptor ligation and the like, and is a key step of RNA-seq. The RNA-seq library construction kit which appears in recent years mainly focuses on RNA strand specificity research, and the specific library construction process is as follows: (1) Fragmenting RNA, adding dUTP to synthesize double-stranded cDNA, and distinguishing the strand specificity through uracil U base; (2) Performing terminal filling repair on the cDNA and adding adenine A base to the 3' end of the cDNA to ensure that the 3' end of the cDNA double chain contains A base suspension and further matches with thymine T base at the 3' end of the joint to realize TA connection and complete database construction; (3) Two single-stranded joints are required to be designed and annealed to form double chains, and the double chains contain thiosulfate ester bond modification, so that the joint T base cannot fall off, and effective joint connection can be performed; (4) Finally, the second strand of the cDNA containing uracil U base is digested before PCR.

The existing process needs to carry out steps of RNA breaking to small fragments, generating double-chain cDNA, then carrying out double-chain filling, A adding, connecting joints, amplifying and library building and the like, so the process is long, usually needs 7-9 hours to complete the test, and the library building efficiency is low.

Therefore, there is a need to develop a method and kit for library construction with short procedures and high library construction efficiency.

Disclosure of Invention

The invention aims to provide a method for constructing an RNA library, which can simplify the library construction process and effectively reduce the library construction cost, synchronously complete the reverse transcription of a template and the introduction of double-end connector sequences through the synthesis of cDNA with connector sequences in two rounds, complete the enrichment of the template, and realize the low-cost, rapid and efficient library construction.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided a method of constructing an RNA library, the method comprising:

enriching mRNA from an RNA sample, wherein the mRNA is broken into mRNA small fragments in the enrichment process;

performing reverse transcription and purification on the mRNA small fragment by using a first primer to obtain a first strand cDNA;

amplifying the first strand cDNA by using a second primer and purifying to obtain a second strand cDNA;

amplifying the two-chain cDNA by using a third primer to obtain an RNA library;

wherein the first primer sequentially comprises a first adaptor sequence and a random sequence from a 5 'end to a 3' end; the second primer sequentially comprises a second adaptor sequence and a random sequence from a 5 'end to a 3' end;

the third primer comprises an upstream primer and a downstream primer, and the upstream primer sequentially comprises the following components from the 5 'end to the 3' end: an upstream sequencing platform sequence, a library index sequence and an upstream sequencing primer sequence, wherein the downstream primer sequentially comprises from a 5 'end to a 3' end: a downstream sequencing platform sequence, a library index sequence, and a downstream sequencing primer sequence, wherein the upstream sequencing primer sequence is identical to at least a portion of the sequence of the 5 'end of the second primer, and the downstream sequencing primer sequence is identical to at least a portion of the sequence of the 5' end of the first primer.

Further, the first linker sequence and the second linker sequence are each selected from the group consisting of P5 and P7 linkers, and the first linker sequence and the second linker sequence are different.

Further, the sequence of the first primer is shown as SEQ ID NO.1, the sequence of the second primer is shown as SEQ ID NO.2, the sequence of the upstream primer in the third primer is shown as SEQ ID NO.3, and the sequence of the downstream primer is shown as SEQ ID NO. 4.

Further, the RNA sample includes at least one of total RNA, mRNA, lncRNA, ribosomal removed RNA.

Further, when the first strand cDNA is amplified using the second primer, a DNA polymerase having a strand displacement function is used, and RNase H is added.

In a second aspect of the present invention, there is provided a primer combination for constructing an RNA library, the primer combination comprising a first primer, a second primer and a third primer, the first primer comprising a first adaptor sequence and a random sequence in order from the 5 'end to the 3' end; the second primer sequentially comprises a second adaptor sequence and a random sequence from a 5 'end to a 3' end; the third primer comprises an upstream primer and a downstream primer, and the upstream primer sequentially comprises the following components from the 5 'end to the 3' end: an upstream sequencing platform sequence, a library index sequence and an upstream sequencing primer sequence, wherein the downstream primer sequentially comprises from a 5 'end to a 3' end: a downstream sequencing platform sequence, a library index sequence, and a downstream sequencing primer sequence, wherein the upstream sequencing primer sequence is identical to at least a portion of the sequence of the 5 'end of the second primer, and the downstream sequencing primer sequence is identical to at least a portion of the sequence of the 5' end of the first primer.

Further, the sequence of the first primer is shown as SEQ ID NO.1, the sequence of the second primer is shown as SEQ ID NO.2, and the third primer comprises an upstream primer with a sequence shown as SEQ ID NO.3 and a downstream primer with a sequence shown as SEQ ID NO. 4.

In a second aspect of the invention, there is provided a kit for constructing an RNA library, said kit comprising said primer combination.

One or more technical solutions in the embodiments of the present invention at least have the following technical effects or advantages:

the invention provides a method for constructing RNA library, which is characterized in that reverse transcription is carried out on mRNA which is broken and enriched, random sequences in a first chain primer and a second chain primer can be combined with a template in a multipoint way after the mRNA is broken, two primer combining sites are not far apart, the subsequent PCR amplification and enrichment are facilitated, cDNA which is higher than the yield of the original template is obtained, and because two reactions respectively use different enzymes and linkers, the two random primers are respectively combined with different chains of DNA, the obtained RNA library has chain specificity, and the product length is also in a sequencing reasonable range due to the product sorting before PCR. The primer is directly connected with the connector sequence, so that the later-stage double-end connector connection is not needed, and the amplification efficiency and the library construction speed are greatly improved.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram of a flow chart for constructing an RNA library provided in the examples of the present application.

FIG. 2 shows the detection base factor comparison of DADCseq with other RNA-seq.

FIG. 3 is a comparison of coverage uniformity of gene regions of DADCseq with other RNA-seq.

FIG. 4 is a comparison of genomic alignment of DADCseq with other RNA-seq.

FIG. 5 shows the library GC content comparison of DADCseq with other RNA-seq.

FIG. 6 is a strand-specific comparison of DADCseq with other RNA-seq.

Detailed Description

The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.

Throughout the specification, unless specifically indicated otherwise, the terms used herein should be understood as meaning as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification will control.

Unless specifically indicated otherwise, the various raw materials, reagents, instruments, equipment, etc., used in the present invention are commercially available or may be obtained by existing methods.

The technical scheme of the embodiment of the application aims to solve the technical problems, and the overall thought is as follows:

an embodiment of the present invention provides a method for constructing an RNA library, as shown in fig. 1, the method comprising:

s1, enriching mRNA from an RNA sample, wherein the mRNA is broken into mRNA small fragments in the enrichment process;

in the step S1, the RNA sample includes at least one of total RNA, mRNA, lncRNA, ribosomal removed RNA.

The RNA sample may be extracted from the sample using conventional methods.

As a specific embodiment, the enrichment method comprises mRNA magnetic separation.

The most remarkable structural features of eukaryotic mRNA molecules are the 5 'end cap structure (m 7G) and the 3' end Poly (a) tail structure. The 3' end of most mammalian cell mRNAs has a Poly (A) tail of 20-30 adenylates, commonly denoted as Poly (A+). The structure provides a very convenient selective marker for extracting eukaryotic mRNA. NEBNEXt Poly (A) mRNA magnetic separation module can separate complete Poly (A+) RNA from total RNA. The specific separation flow is as follows: first, hybridization is performed with total RNA using magnetic beads with Oligo d (T) probes that bind to mRNA with Poly (A) tails, then the magnetic beads are recovered, and these mRNA with Poly (A) are eluted from the magnetic beads.

As a specific embodiment, the means by which the mRNA is broken into mRNA fragments during the enrichment process may include: the eluted mRNA was fragmented (fragment size: about 250-350 bp) with 1X Reverse transcriptionbuffer of magnesium ion at a concentration of 2.5mM

S2, carrying out reverse transcription and purification on the mRNA small fragment by adopting a first primer to obtain a first-strand cDNA;

in the step S2, the first primer sequentially comprises a first adaptor sequence and a random sequence from a 5 'end to a 3' end;

as a specific embodiment, the first linker sequence is selected from the group consisting of P5 and P7 linkers, and the sequence of the first primer is as shown in SEQ ID No. 1: 5'-GAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNN-3' (N represents any one of the ATGC).

Reverse transcriptase and buffer are also added to the reverse transcription, and the addition system is specifically shown in table 3.

S3, amplifying the first-strand cDNA by using a second primer and purifying to obtain a second-strand cDNA;

in the step S3, the second primer sequentially comprises a second adaptor sequence and a random sequence from a 5 'end to a 3' end;

as a specific embodiment, the second linker sequence is selected from the group consisting of P5 and P7 linkers, and the sequence of the second primer is shown in SEQ ID No. 2:

5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNN-3' (N represents any one of the ATGC).

When amplifying the first strand cDNA, a DNA polymerase having a strand displacement function is used, and RNase H is added.

The RNase H was added to remove RNA from the cDNA strand. The random primer is conveniently combined with cDNA chain, the second random primer has multiple combining sites, and the product has double-end connector sequence without connector connection.

The main components of Reverse transcription buffer used for RNA fragmentation include: 25mM Tris pH 8.3, 30mM NaCl,2.5mM MgCl ₂ 8mM DTT. In the synthesis of second strand cDNA, the DNA polymerase is Bsu enzyme in one embodiment of the present application, because of its efficient strand displacement activity. The addition system is specifically shown in table 5.

In the steps S2 and S3, the residual linker sequences are removed by purifying the first and second strand products to reduce subsequent non-specific amplification and reduce dimer production.

In a specific embodiment, the purification is performed by ethanol or water elution.

S4, amplifying the two-chain cDNA by using a third primer to obtain an RNA library;

in the step S4 of the above-mentioned process,

As a specific embodiment, the sequence of the upstream primer in the third primer is shown as SEQ ID NO.3, and the sequence of the downstream primer is shown as SEQ ID NO. 4.

An upstream primer:

5’-AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACA CGACGC-3’

a downstream primer:

5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTG TGCTCTT-3’

wherein XXXXXXXX is an index sequence.

As a specific embodiment, the index sequence can be referred to the Invozan company's reagent specifications https:// www.vazyme.com/product/694.Html, such as TATAGCCT, ATAGAGGC, CGAGTAAT, TCTCCGGA.

The amplification is also added with high-fidelity PCR enzyme, and the addition system is specifically shown in table 7.

A method of constructing an RNA library of the present application will be described in detail with reference to examples and experimental data.

Example 1 construction of RNA library

The construction scheme of the RNA library is shown in FIG. 1. The RNA library was constructed as follows: as shown in FIG. 1, reverse transcription is performed on a random primer with a first adaptor sequence to synthesize a first strand cDNA, then a random primer with a second adaptor sequence is added to synthesize a second strand, and then PCR amplification enrichment is performed to obtain an RNA library. The specific process is as follows:

1. mRNA enrichment

a. mRNACapture Beads, beads Wash Buffer and Tris Buffer, beads Binding Buffer were taken out of the vessel at 2-8deg.C and allowed to stand to equilibrate to room temperature.

b. Preparing an RNA sample: dissolving 0.01-4 μg of total RNA in nucleic-free ddH ₂ O was placed on ice until a total volume of 50. Mu.l was reached.

c. The mixture was gently inverted to mix mRNA Capture Beads thoroughly, 50. Mu.l was pipetted into the prepared RNA sample and gently blotted 10 times with a pipette.

d. The following procedure was run in the PCR instrument to allow the first binding of mRNA to magnetic beads:

TABLE 1

Temperature (temperature)	Time
		65℃	5min
25℃	5min

e. Samples were placed on a magnetic rack and after the solution was clear (about 5 min), the supernatant was carefully removed.

f. The sample was removed from the magnetic rack, 200 mu l Beads Wash Buffer resuspended beads were added, gently blotted 10 times with a pipette, mixed well and placed on the magnetic rack, and after the solution was clarified (about 5 min), the supernatant carefully removed.

g. The sample was removed from the magnetic rack, 50. Mu.l Tris Buffer was added and gently pipetted 10 times to mix the beads thoroughly.

h. The following procedure was run in a PCR instrument, eluting mRNA:

TABLE 2

Temperature (temperature)	Time
		80℃	2min
25℃	Hold

i. Add 50. Mu. l Beads Binding Buffer and gently blot 10 times with a pipette to mix thoroughly.

j. The reaction was allowed to stand at room temperature for 5min to bind mRNA to the beads.

k. The sample was placed on a magnetic rack to separate mRNA from total RNA, and after the solution became clear (about 5 min), the supernatant was carefully removed.

And l, taking out the sample from the magnetic rack, adding 200 mu l Beads Wash Buffer heavy suspension magnetic beads, gently sucking and beating 10 times by using a pipette, fully and uniformly mixing, placing the mixture on the magnetic rack, and carefully removing the supernatant after the solution is clarified (about 5 min). m, taking out the sample from the magnetic rack, adding 24 μl of 1× Reverse transcription Buffer, blowing with a pipette for 6 times, mixing well, reacting for 5min at 95deg.C, immediately placing on the magnetic rack for 5min, and carefully sucking 22 μl of supernatant into a new nucleic-free PCR tube after the solution is clarified.

2. Reverse transcription reaction

2.1 reverse transcription mix was formulated as in Table 1 below.

TABLE 3 reverse transcription mix

2.2 reverse transcription mix was placed on a PCR apparatus and reverse transcription was performed according to the procedure shown in Table 2 below to obtain a reverse transcription product, i.e., first strand cDNA.

TABLE 4 reverse transcription reaction procedure

Temperature (temperature)	Time
		25℃	5min
50℃	20min
		80℃	10min
4℃	Hold

cDNA product purification.

a. Taking out DNA clear Beads from 2-8deg.C 30min in advance, standing to equilibrate its temperature.

b. The DNAClean Beads were thoroughly mixed by inversion or vortexing, 20 μl (1×) was pipetted into the PCR product and gently blotted 10 times with a pipette.

c. Incubation was performed for 5min at room temperature to allow DNA to bind to the beads.

d. Samples were placed on a magnetic rack and after the solution was clear (about 5 min), the supernatant was carefully removed.

e. The sample is kept on a magnetic rack all the time, 200 μl of freshly prepared 80% ethanol is added to rinse the magnetic beads, and incubated at room temperature for 30s

f. Step e is repeated once.

g. The sample is kept on the magnetic rack all the time, and the magnetic beads are uncapped and dried for about 3-5min at room temperature.

h. The sample was removed from the magnetic rack, 22. Mu.l of Nuclease-free H2O was added, gently blotted with a pipette and thoroughly mixed, left standing at room temperature for 2min, and placed on the magnetic rack, after the solution was clear (about 5 min), 20. Mu.l of the supernatant was carefully aspirated into a new Nuclease-free PCR tube.

3. Two-chain synthesis

Preparation of two-chain Synthesis mix according to Table 5

TABLE 5

Name of the name	Volume (mu L)
		One-chain purified product	19.3
CWN6(10uM)	1
		dNTP	1
Bsu DNA polymarance	1
		RNase H	0.2
10×Bsu DNA polymarance buffer	2.5
		To ddH ₂ 0	25

The two-strand synthesis mix was placed on a PCR apparatus, and two-strand synthesis was performed according to the procedure shown in Table 4 below to obtain double-stranded DNA.

TABLE 6 reaction temperature for two-chain synthesis

Temperature (temperature)	Time
		25℃	5min
37℃	30min
		4℃	Hold

Adding 22ul magnetic beads into the two-strand DNA, sucking and beating, mixing uniformly, standing for 5min, placing on a magnetic rack until the mixture is clear, and discarding the supernatant; and washing the magnetic beads with 200ul of fresh 80% ethanol, eluting the magnetic beads with 23ul of nucleic-free H2O water after washing twice to obtain a purified two-chain product, and sucking 23ul of the two-chain product to enter a subsequent test.

4. PCR amplification

4.1. To the purified product of the previous step, 1ul of L5 and L7 primers and 25ul of high-fidelity PCR master mix (containing DNA polymerase) were added, and the mixture was blotted and mixed, and PCR amplification was performed according to the procedure of Table 5 to obtain an amplified product.

TABLE 7 PCR reaction mixtures

PCR reactions, which were performed according to Table 8

TABLE 8 PCR amplification run program

5. Product sorting

a. Will equilibrate to room temperatureDNASelection Beads magnetic beads are shaken or mixed upside down, 65 mu L of magnetic beads are added into the 100 mu L (diluted to 100 mu L by adding water) reaction system, and the mixture is gently beaten and mixed by a pipetting gun, and incubated for 5min at room temperature.

b. The PCR tube was briefly centrifuged and placed on a magnetic rack to separate the beads from the liquid, after which the solution was clarified (about 5 min) and the supernatant carefully transferred to a new PCR tube.

c. mu.L of magnetic beads were added to the new PCR tube, incubated at room temperature for 5min, placed on a magnetic rack, and after the solution was clarified (about 5 min), the supernatant was carefully removed.

d. The PCR tube was kept always in the magnetic rack, the beads were rinsed with 200 μl of freshly prepared 80% ethanol, and after 30sec incubation at room temperature the supernatant was carefully removed.

e. Step d) was repeated for a total of two rinses.

f. The PCR tube was kept in the magnetic rack all the time, and the magnetic beads were dried by uncapping until cracks had just occurred (about 3-5 min).

g. The PCR tube was removed from the magnet holder and eluted with 22. Mu.LddH 2O. Vortex shaking or lightly blowing with a pipette, mixing well, standing at room temperature, and incubating for 5min.

h. The reaction tube was briefly centrifuged and placed in a magnetic rack and after the solution was clear (about 5 min) 20 μl of supernatant was carefully aspirated into a clean PCR tube.

From the above, the method for constructing the RNA library provided in this embodiment only needs 3 amplification steps (fig. 1), the operation is simple, the overall experimental time is 4-4.5 hours, the time required for whole library construction is shortened by half, and the constructed RNA library is favorable for the popularization and application in the later stage.

Example 2 comparison of DADC-seq with other RNA establishment methods

1. The DADC-seq library construction of the invention is similar to that of example 1, other methods include the conventional methods Hieff NGS Ultima Dual-mode RNALibrary Prep Kit, and the library construction process is carried out according to the product specification. The RNA pooling procedure of this study is shown in FIG. 1, with reference to the SHERRY method (Di et al 2020).

TABLE 9 comparison of library costs

As can be seen from Table 9, the cost of the DADCseq method of the present invention compared with the cost of other RNA-seq is the lowest, the cost of the present invention is only about 30 yuan per sample, and the price is more favorable when the sample amount is large.

2. The comparison results of transcriptome alignment rates of the different methods are shown in Table 10.

TABLE 10 comparison of transcriptome alignment rates

	Genome alignment rate	Exon alignment	Number of gene assays
				DADCseq	83.08％±0.44％	84.03％±0.49％	14582±42
SHERRY	83.33％±0.31％	87.18％±0.35％	14055±118
				Hieff NGS	82.43％±0.15％	83.60％±0.14％	14930±50

As can be seen from Table 10, the comparison of the transcriptome alignment of the DADCseq method of the present invention with other RNA-seq is substantially identical to the comparison of the transcriptome alignment of DADCseq with other methods.

3. The RNA input was 200ng, and the constructed library was quantified using Qubit, and the Agilent 2100 validated the library size distribution. The constructed library was sequenced and analyzed on an Illumina NovaSeq 6000 platform. The results are shown in FIGS. 2-6.

As can be seen from FIG. 2, the detection base factor comparison result of the DADCseq method and other RNA-seq is that the detection quantity of the DADCseq gene is close to HieffNGS and obviously more than that of the SHERRY method.

As can be seen from FIG. 3, the uniformity of coverage of the DADCseq method with other RNA-seq gene regions is consistent with HieffNGS, and the coverage of the DADCseq gene region is wider at the 5' end than that of the SHERRY method. As can be seen from FIG. 4, the comparison of the genomic alignment of the DADCseq method of the present invention with other RNA-seq is substantially identical to the other methods.

As can be seen from FIG. 5, the comparison of the GC content of the library of the DADCseq method of the present invention with other RNA-seq is also consistent with other methods.

As can be seen from FIG. 6, the strand-specific comparison of the DADCseq method of the present invention with other RNA-seq shows that DADCseq covers mainly the sense strand, hieffNGS covers mainly the antisense strand, and SHERRY has no strand-specificity.

In summary, the present invention provides a highly efficient and rapid RNA pooling technique, termed (DADCSeq). Compared with the traditional RNA library construction method, the DADCseq has the advantages of short time consumption, simple operation, low cost and the like, and compared with the traditional RNA-seq technology, the DADC-seq has the advantages of high gene detection rate, complete RNA information, chain specificity and the like (suitable for detecting lncRNA), is an efficient and sensitive transcriptome sequencing technology, can be widely applied to the fields of scientific research, disease diagnosis and the like, is simple and rapid to operate, and is beneficial to large-scale popularization.

Finally, it is also noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.

Claims

1. A method of constructing an RNA library, the method comprising:

amplifying the two-chain cDNA by using a third primer to obtain an RNA library;

2. The method of claim 1, wherein the first linker sequence and the second linker sequence are each selected from the group consisting of P5 and P7 linkers, and wherein the first linker sequence and the second linker sequence are different.

3. The method according to claim 1, wherein the sequence of the first primer is shown in SEQ ID NO.1, the sequence of the second primer is shown in SEQ ID NO.2, the sequence of the upstream primer in the third primer is shown in SEQ ID NO.3, and the sequence of the downstream primer is shown in SEQ ID NO. 4.

4. The method of claim 1, wherein the RNA sample comprises at least one of total RNA, mRNA, lncRNA, ribosomally depleted RNA.

5. The method according to claim 1, wherein the first strand cDNA is amplified using the second primer using a DNA polymerase having a strand displacement function, and RNase H is added.

6. A primer combination for constructing an RNA library, which is characterized by comprising a first primer, a second primer and a third primer, wherein the first primer sequentially comprises a first adaptor sequence and a random sequence from a 5 'end to a 3' end; the second primer sequentially comprises a second adaptor sequence and a random sequence from a 5 'end to a 3' end; the third primer comprises an upstream primer and a downstream primer, and the upstream primer sequentially comprises the following components from the 5 'end to the 3' end: an upstream sequencing platform sequence, a library index sequence and an upstream sequencing primer sequence, wherein the downstream primer sequentially comprises from a 5 'end to a 3' end: a downstream sequencing platform sequence, a library index sequence, and a downstream sequencing primer sequence, wherein the upstream sequencing primer sequence is identical to at least a portion of the sequence of the 5 'end of the second primer, and the downstream sequencing primer sequence is identical to at least a portion of the sequence of the 5' end of the first primer.

7. The primer combination for constructing an RNA library according to claim 6, wherein the sequence of the first primer is shown as SEQ ID NO.1, the sequence of the second primer is shown as SEQ ID NO.2, and the third primer comprises an upstream primer shown as SEQ ID NO.3 and a downstream primer shown as SEQ ID NO. 4.

8. A kit for constructing an RNA library, comprising the primer combination of any one of claims 5 to 6.

9. The kit for constructing an RNA library of claim 8, further comprising reverse transcriptase and DNA polymerase.