CN117660514A - Construction and application of bacillus subtilis self-induction efficient protein expression system - Google Patents

Construction and application of bacillus subtilis self-induction efficient protein expression system Download PDF

Info

Publication number
CN117660514A
CN117660514A CN202311662930.9A CN202311662930A CN117660514A CN 117660514 A CN117660514 A CN 117660514A CN 202311662930 A CN202311662930 A CN 202311662930A CN 117660514 A CN117660514 A CN 117660514A
Authority
CN
China
Prior art keywords
luxi
luxr
amyz1
pbhlir
subtilis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202311662930.9A
Other languages
Chinese (zh)
Inventor
姚动邦
汪斌
房伟
肖亚中
方泽民
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui University
Original Assignee
Anhui University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui University filed Critical Anhui University
Priority to CN202311662930.9A priority Critical patent/CN117660514A/en
Publication of CN117660514A publication Critical patent/CN117660514A/en
Pending legal-status Critical Current

Links

Landscapes

  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses construction and application of a bacillus subtilis self-induction efficient protein expression system, and belongs to the technical fields of genetic engineering and microbial engineering. The recombinant bacillus subtilis of the invention uses LuxI +.f of the Vibrio freudenreichiiThe R system is an self-induction system, uses pBH-amyZ1 as a vector skeleton and uses bacillus subtilis WB600 as an expression host. By inducing the module P in the self-induction system luxI The-10 region and-35 region of the promoter are modified, and the extracellular AmyZ1 activity of the obtained recombinant bacteria is 1.83 times of that of a control after shake flask fermentation, and reaches 213.67U/mL. Finally, when sucrase InvDz13 and levanase 39 are used as reporter proteins, the activity of extracellular InvDz13 and 39 obtained after fermentation of the recombinant bacteria is 2 times and 1.6 times that of the original control bacteria respectively, and the bacillus subtilis self-induction efficient protein expression system constructed in the invention is proved to have universality.

Description

Construction and application of bacillus subtilis self-induction efficient protein expression system
Technical Field
The invention relates to construction and application of a bacillus subtilis self-induction efficient protein expression system, and belongs to the technical fields of genetic engineering and microbial engineering.
Background
Bacillus subtilis (Bacillus subtilis) is a gram-positive bacterial model, the surface of which is flagellum, and the formed endospores in the body can survive against harsh external environments. Bacillus subtilis has the advantages of strong secretion capacity, difficult formation of inclusion bodies, no codon preference, clear physiological and genetic background, non-pathogenicity and the like. Based on the above advantages, an important industrial enzyme protein prokaryotic expression system has been developed.
The bacillus subtilis expression system is mainly divided into a constitutive expression system and an inducible expression system. Compared with constitutive expression, the inducible expression can effectively relieve contradiction between protein expression and bacterial growth, so that the high expression of the target protein is facilitated. Inducible expression systems are also classified into inducer-dependent expression systems and self-inducible expression systems, wherein the inducer-dependent expression systems are required to express a target protein under inducer induction, but use of an inducer results in an increase in production cost and is disadvantageous for separation and extraction of a subsequent target product. In contrast, self-induced expression systems do not require the addition of large amounts of an inducer to achieve the production requirements and can be self-monitored without human supervision.
The self-inducible expression system is mainly established depending on quorum sensing system (QS). QS is an information communication phenomenon between bacteria, during which bacteria synthesize and release signal molecules, and when extracellular signal molecules reach a critical concentration, expression of related genes in bacteria can be started to regulate biological behaviors of bacteria, such as fluorescence, so as to adapt to environmental changes.
At present, the quorum sensing mechanism of the bacillus subtilis self-induction system is divided into two types, one type is based on bacillus subtilis endogenous P srfA Quorum sensing systems based on promoters, the other being Vibrio fischeri (Vibrio fischeri) P luxI Quorum sensing systems for promoters. But based on Bacillus subtilis endogenous P srfA The quorum sensing system of (2) has low expression level of exogenous genes because signal molecules for expression of heterologous genes can interfere with other physiological functions of the bacterial body. In contrast, the LuxI/R system from Vibrio fischeri does not present this problem. The LuxI/R system of Vibrio fischeri consists of the luxR and luxICDABE operons, which regulate the bioluminescence phenomenon of Vibrio fischeri.
In recent years, researchers split the LuxI/R system into an inducer module comprising a luxI-luxR and a P-channel luxI Two parts of a response module mediating the expression of the target gene, thereby constructing an self-induction expression system in bacillus subtilis. However, the use of the LuxI/R system of Vibrio freudenreichii in Bacillus subtilis is mainly focused on the production of high value-added chemicals, little research is done on the production of enzyme proteins, and no report has been seen on the use of this system for the self-induction of extracellular expression of enzyme proteins in Bacillus subtilis. The reason is that the LuxI/R system of the Vibrio freudenreichii has low self-induction expression intensity in bacillus subtilis, so that the application of the LuxI/R system in the development of bacillus subtilis self-induction protein expression systems is limited.
In the early research, the self-induction expression intensity of the Vibrio fischeri in bacillus subtilis is improved mainly by modifying a LuxI/R system response module of the Vibrio fischeri, but the effect is generally poor. In contrast, studies for improving the self-induction expression intensity in bacillus subtilis by modifying the LuxI/R system induction module of Vibrio freudenreichii have not been reported at present.
Disclosure of Invention
For the purpose ofThe invention provides the construction and application of the bacillus subtilis self-induction efficient protein expression system. The invention relates to a LuxI/R group induction system based on Vibrio fischeri, which takes pBH-amyZ1 as a carrier framework and bacillus subtilis WB600 as an expression host, realizes the self-induced recombinant extracellular expression of raw starch alpha-amylase (amyZ 1) from marine Pontibollus sp.ZY in bacillus subtilis WB600 and modifies a promoter P in an induction module luxI The-35 region and the-10 region of the bacillus subtilis extracellular AmyZ1 activity is improved by 1.83 times. In addition, the self-induced expression effect was further verified with sucrase InvDz13 and levanase 39 as novel model enzymes.
The invention provides a bacillus subtilis self-induction efficient protein expression system, which is a LuxI/R quorum sensing system based on a Vibrio fischeri (Vibrio fischeri) source.
In one embodiment of the invention, the self-induction system consists of the self-induction promoter P, respectively R61 A mediated response module and an induction module comprising a luxR-luxI expression cassette.
In one embodiment of the invention, the promoter P is induced in the response module R61 The nucleotide sequence of (2) is SEQ ID NO.1.
In one embodiment of the invention, the nucleotide sequence of luxR in the induction module is SEQ ID NO.2.
In one embodiment of the invention, the nucleotide sequence of luxI in the induction module is SEQ ID NO.3.
In one embodiment of the invention, the bacillus subtilis self-induction expression system is constructed by taking a vector pBH-amyZ1 as a vector skeleton.
In one embodiment of the invention, the recombinant bacillus subtilis is constructed by taking bacillus subtilis WB600 as a host bacterium.
In one embodiment of the invention, the induction module comprises a promoter P luxI 。
The invention provides an auto-induction meterThe expression vector is connected with an induction module and a response module; the induction module is a promoter P with a nucleotide sequence shown as SEQ ID NO.8 luxR-luxI The nucleotide sequence of the expression module is the luxR-luxI expression frame of the luxR gene shown as SEQ ID NO.2 and the nucleotide sequence of the luxI gene shown as SEQ ID NO.3, and the response module contains P with the nucleotide sequence shown as SEQ ID NO.1 R61 Promoters and proteins of interest.
In one embodiment of the present invention, the promoter P is luxR-luxI The base TTATA at positions 187-192 in the middle sequence is replaced by TACAAT, TACAAT, TAAACT, GAAT or TAAAAT.
In one embodiment of the present invention, the promoter P is luxR-luxI The base TTACG at 167-172 in the middle sequence is replaced by TTGACA, TTGGAT or AGGATTT.
In one embodiment of the present invention, the promoter P is luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TAAACT, and the base TTACG at the 167-172 th position is replaced by AGGATTT;
in one embodiment of the present invention, the promoter P is luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TACAAT, and the base TTACG at the 167-172 th position is replaced by TTGGAT;
in one embodiment of the invention, the promoter P luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TAAAAT, and the base TTACG at the 167-172 th position is replaced by AGGATTT;
in one embodiment of the invention, the promoter P luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TAAAAT, and the base TTACG at the 167-172 th position is replaced by TTGGAT;
in one embodiment of the invention, the protein of interest includes, but is not limited to, amyZ1 protein, invdz13 protein, levan 39.
In one embodiment of the invention, the amyZ1 protein is alpha-amylase, and the amino acid sequence of the amyZ1 protein is shown in SEQ ID NO. 4.
In one embodiment of the invention, the amino acid sequence of the sucrase Invdz13 is shown in SEQ ID NO. 5.
In one embodiment of the invention, the amino acid sequence of the levanase 39 is shown in SEQ ID NO. 6.
The invention also provides a method for improving the expression quantity of the target protein, which comprises the step of adopting the expression vector to express the target protein.
In one embodiment of the invention, the protein of interest includes, but is not limited to, amyZ1 protein, invdz13 protein, levan 39.
In one embodiment of the invention, the amyZ1 protein is alpha-amylase, and the amino acid sequence of the amyZ1 protein is shown in SEQ ID NO. 4.
In one embodiment of the invention, the amino acid sequence of the sucrase Invdz13 is shown in SEQ ID NO. 5.
In one embodiment of the invention, the amino acid sequence of the levanase 39 is shown in SEQ ID NO. 6.
The invention also provides a recombinant cell, which contains the expression vector.
In one embodiment of the invention, the recombinant cell is a bacterial or fungal expression host.
In one embodiment of the invention, the recombinant cell is an expression host of bacillus subtilis.
In one embodiment of the present invention, the recombinant cell is an expression host of bacillus subtilis WB 600.
The invention also provides a method for improving the expression quantity of the target protein, which comprises the step of adopting the recombinant cell to express the target protein.
In one embodiment of the invention, the protein of interest includes, but is not limited to, amyZ1 protein, invdz13 protein, levan 39.
In one embodiment of the invention, the amyZ1 protein is alpha-amylase, and the amino acid sequence of the amyZ1 protein is shown in SEQ ID NO. 4.
In one embodiment of the invention, the amino acid sequence of the sucrase Invdz13 is shown in SEQ ID NO. 5.
In one embodiment of the invention, the amino acid sequence of the levanase 39 is shown in SEQ ID NO. 6.
The invention also provides a construction method of the recombinant bacillus subtilis, which comprises the following steps of luxI The-10 region and the-35 region of (C) were constructed by substitution and then transformed into Bacillus subtilis WB 600.
The invention also provides a construction method of the recombinant bacillus subtilis, which comprises the steps of promoter P luxI The-35 region and-10 region sequences of the bacillus subtilis are combined, overlapped and optimized, namely the sequences of the-35 region and the-10 region of a constitutive or inducible promoter which are commonly used in bacillus subtilis expression systems are respectively replaced, and then the bacillus subtilis WB600 is transformed.
In one embodiment of the invention, the vector transformation method is that the WB600 strain is streaked on a solid plate containing starch and cultivated overnight; then, monoclonal is inoculated into GMI solution for shake culture; and transferring the culture solution obtained in the previous step into GMII, and culturing for 60-100min by shaking to obtain competent cells, which can be directly used for transformation. When in transformation, a part of the bacterial liquid is taken, a proper amount of DNA (10-20 microliter) is added, the bacterial liquid is slowly shaken and kept at 30-37 ℃ for 2.5-4 hours, then a corresponding resistance plate is coated, and the bacterial liquid is cultured at 30-37 ℃ overnight.
In one embodiment of the invention, the GMI and GMII formulations are: GMI is T-base 20-60mL,30-60%glucose 0.2mL,2-8% MgCO 4 0.2-0.6mL,10-20% Bacto yeast extract 0.2.2-0.4 mL; GMII is T-base 10-50mL,50-60% glucose 0.1-0.4mL,2-4% MgSO 4 0.1-0.5mL,10-40% Bacto yeast extract 0.04-0.06mL,1-2%casamino acid 0.02-0.06mL,2-9mg/mL trp solution 0.25-0.7mL.
In one embodiment of the present invention, the bacterial culture medium comprises the following components: 1.6-2.8% TRYPTONE,0.5-1%YEAST EXTRACT,0.2-0.8% NaCl,10-100mg/mL kanamycin.
In one embodiment of the invention, the reporter protein of the self-induction expression vector is a marine Bacillus pompe-derived raw starch alpha-amylase AmyZ1, and the amino acid sequence of the reporter protein is shown as SEQ ID NO. 4.
The invention also provides a construction method of the recombinant bacillus subtilis, which comprises the step of replacing the reporter protein alpha-amylase AmyZ1 of the self-induced expression vector with sucrase InvDz13.
In one embodiment of the invention, the amino acid sequence of the sucrase Invdz13 is shown in SEQ ID NO. 5.
The invention also provides a construction method of the recombinant bacillus subtilis, which comprises the step of replacing the reporter protein alpha-amylase AmyZ1 of the self-induced expression vector with levan enzyme 39.
In one embodiment of the invention, the amino acid sequence of the levanase 39 is shown in SEQ ID NO. 6.
The construction and application modes of the bacillus subtilis self-induction high-efficiency protein expression system provided by the invention are beneficial to realizing high-efficiency extracellular expression of various target proteins with important application values, lay a theoretical foundation for subsequent industrial production, and promote development of a bacillus subtilis expression system and a quorum sensing system.
The invention also provides a method for preparing the target protein, which comprises the step of adding the recombinant cells into a culture medium for fermentation to prepare the target protein.
In one embodiment of the invention, the protein of interest includes, but is not limited to, amyZ1 protein, invdz13 protein, levan 39.
In one embodiment of the invention, the amyZ1 protein is alpha-amylase, and the amino acid sequence of the amyZ1 protein is shown in SEQ ID NO. 4.
In one embodiment of the invention, the amino acid sequence of the sucrase Invdz13 is shown in SEQ ID NO. 5.
In one embodiment of the invention, the amino acid sequence of the levanase 39 is shown in SEQ ID NO. 6.
In one embodiment of the invention, the method comprises the steps of activating the recombinant cells by streaking, inoculating the activated recombinant cells into a seed culture medium, and culturing the recombinant cells for 8-10 hours at a temperature of 25-35 ℃ and at a speed of 180-220 rpm to obtain seed liquid; inoculating the seed solution into a shake flask fermentation medium, and culturing for 45-50 h at 25-35 ℃ and 180-220 rpm to obtain the target protein.
The invention also provides the expression vector, the recombinant cell or the application of the method in preparing target protein and in the fields of food, medicine and textile.
Advantageous effects
(1) The invention discloses a LuxI/R self-induction system based on Vibrio fischeri (Vibrio fischeri), which is constructed by taking pBH-amyZ1 as a carrier skeleton and taking a self-induction expression carrier pBHLIR-amyZ1 and bacillus subtilis WB600 as an expression host, and successfully establishes a bacillus subtilis self-induction high-efficiency protein expression system.
(2) The self-induction vector pBHLIR-amyZ1 constructed based on the invention optimizes P in an induction module luxI Promoter, obtained P 43spo Effectively improves the expression intensity of the bacillus subtilis self-induction protein expression system. When the raw starch alpha-amylase AmyZ1 is used as a model enzyme, the extracellular AmyZ1 activity of the obtained recombinant bacteria after shake flask fermentation is 1.83 times of that of the original control bacteria.
(3) The bacillus subtilis self-induction protein expression system constructed based on the LuxI/R system of the vibrio freudenreichii has certain universality, besides the raw starch alpha-amylase AmyZ1, when sucrase InvDz13 and levanase 39 are used as reporter proteins, the activity of extracellular InvDz13 and 39 of the obtained recombinant bacteria after shake flask fermentation is 2 times and 1.6 times of that of original control bacteria respectively, and meanwhile, the bacillus subtilis self-induction high-efficiency protein expression system constructed in the invention is proved to be reliable.
Drawings
FIG. 1 is a schematic representation of the self-inducible expression vector pBHLIR-amyZ1.
FIG. 2 is a line drawing of the cell growth curve of recombinant B.subilis WB600/pBHLIR-amyZ1.
FIG. 3 shows the transformation of the inducible module promoter P luxI Recombinant bacterial extracellular alpha-amylase activity of region-10; wherein A is the strain B.subtilis WB600/pBHLIR-amyZ1; b is the strain B.subtilis WB600/pBHLIR-P luxR-veg10 -luxI-amyZ1; c is the strain B.subtilis WB600/pBHLIR-P luxR-ylB10 -luxI-amyZ1; d is strain B.subtilis WB600/pBHLIR-P luxR-srfA10 -luxI-amyZ1; e is the strain B.subtilis WB600/pBHLIR-P luxR-spoVG10 -luxI-amyZ1; f is the strain B.subtilis WB600/pBHLIR-P luxR-Hpall10 -luxI-amyZ1; g is the strain B.subtilis WB600/pBHLIR-P luxR-4310 -luxI-amyZ1; h is the strain B.subtilis WB600/pBHLIR-P luxR-sigW10 -luxI-amyZ1; i is the strain B.subtilis WB600/pBHLIR-P luxR-hag10 -luxI-amyZ1。
FIG. 4 is a diagram of a modified promoter P luxI Recombinant bacterial extracellular alpha-amylase activity of region-35; wherein A is the strain B.subtilis WB600/pBHLIR-amyZ1; b is the strain B.subtilis WB600/pBHLIR-P luxR-veg35 -luxI-amyZ1; c is the strain B.subtilis WB600/pBHLIR-P luxR-ylB35 -luxI-amyZ1; d is strain B.subtilis WB600/pBHLIR-P luxR-srfA35 -luxI-amyZ1; e is the strain B.subtilis WB600/pBHLIR-P luxR-spoVG35 -luxI-amyZ1; f is the strain B.subtilis WB600/pBHLIR-P luxR-Hpall35 -luxI-amyZ1; g is the strain B.subtilis WB600/pBHLIR-P luxR-4335 -luxI-amyZ1; h is the strain B.subtilis WB600/pBHLIR-P luxR-sigW35 -luxI-amyZ1; i is the strain B.subtilis WB600/pBHLIR-P luxR-hag35 -luxI-amyZ1。
FIG. 5 shows the promoter P of the inducer luxI The-10 region and the-35 region are combined to form the recombinant bacterium extracellular alpha-amylase activity after modification; wherein A is the strain B.subtilis WB600/pBHLIR-amyZ1; b is the strain B.subtilis WB600/pBHLIR-P luxR-spo1035 -luxI-amyZ1; c is the strain B.subtilis WB600/pBHLIR-P luxR-spoylB -luxI-amyZ1; d is strain B.subtilis WB600/pBHLIR-P luxR-vegspo -luxI-amyZ1; e is the strain B.subtilis WB600/pBHLIR-P luxR-vegylB -luxI-amyZ1; f is the strain B.subtilis WB600/pBHLIR-P luxR-srfAspo -luxI-amyZ1; g is the strain B.subtilis WB600/pBHLIR-P luxR-srfAylB -luxI-amyZ1; h isStrain B.subtilis WB600/pBHLIR-P luxR-43spo -luxI-amyZ1; i is the strain B.subtilis WB600/pBHLIR-P luxR-43ylB -luxI-amyZ1。
Detailed Description
The methods of implementation in the following examples are conventional, unless otherwise specified.
The detection method involved in the following examples is as follows:
the method for detecting the enzyme activity of the alpha-amylase comprises the following steps:
mu.L of a raw corn starch solution with an initial concentration of 2% and 270. Mu.L of 50mM Na, pH 7.0 + /K + Mixing phosphate buffer solution, preheating at 35deg.C for 5min, adding 30 μl of shake flask crude enzyme solution, shaking, mixing, reacting for 10min, adding 300 μl DNS, shaking, boiling for 10min, cooling rapidly, centrifuging at 10000xg for 2min, and concentrating at OD 540 Absorbance was measured (with inactivated enzyme solution as control).
Under the above conditions, the amount of enzyme required to produce 1. Mu. Mol of maltose per unit time was defined as 1U.
The enzyme activity detection method of the sucrase and the levanase comprises the following steps:
protein samples were diluted in an appropriate volume of citrate-phosphate buffer (50 mM, pH 6.5). In 430. Mu.L of citric acid-disodium hydrogen phosphate buffer (50 mM, pH 6.5), 120. Mu.L of sucrose substrate (final concentration 2%), 50. Mu.L of crude enzyme solution, 600. Mu.L of reaction mixture, incubation at 35℃for 10min, addition of 300. Mu.L of DNS to terminate the reaction, heating at 100℃at OD 540 Absorbance was measured.
Under the above conditions, the unit of invertase activity (U) is defined as the amount of enzyme required to hydrolyze 1. Mu. Mol of sucrose per minute under the assay conditions.
The following examples relate to the following media:
seed culture medium: 10g/L peptone, 5g/L yeast extract, and 10g/L sodium chloride.
Shake flask fermentation medium: yeast extract 10g/L, peptone 16g/L, sodium chloride 5g/L, caCl 2 The initial pH of the fermentation medium was 7.0 at 10mM, kanamycin, 30 mg/mL.
LB solid medium: 10g/L peptone, 5g/L yeast extract powder, 10g/L NaCl and 20g/L agar powder.
LB liquid medium: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl.
Preparation of competent saline solution (T-base): 2g/L (NH) 4 ) 2 SO 4 K at 18.3g/L 2 HPO 4 ·3H 2 KH of O, 6g/L 2 PO 4 Sodium citrate 2H at 1g/L 2 O。
GMI medium: salt solution (Tbase) 20mL, 50% (w/v) glucose 0.2mL, 2% (w/v) MgSO 4 0.2mL, 10% (w/v) yeast extract 0.2mL, 1% (w/v) casein hydrolysate 0.4mL, 2mg/mL tryptophan solution 0.5mL.
GMII medium: 10mL of salt solution (Tbase), 0.1mL of 50% (w/v) glucose, 2% (w/v) MgSO 4 0.1mL, 10% (w/v) yeast extract 0.04mL, 1% (w/v) casein hydrolysate 0.02mL, 6% (w/v) CaCl 2 0.01mL、10％(w/v)MgCl 2 0.05mL, 2mg/mL tryptophan solution 0.25mL.
Note that: the salt solutions were mixed and sterilized, and the remaining solutions were sterilized separately from the ingredients of the GMI and GMII media, and the tryptophan was filtered off and all components were mixed prior to use.
The procedure for the transfer of the plasmids referred to in the examples below into Bacillus subtilis is as follows:
the method comprises the following specific steps:
streaking bacillus subtilis WB600 on an LB solid plate, and culturing overnight at 37 ℃; one of the single clones was picked up with an inoculating loop and inoculated into 5mL of GMI solution, and cultured with shaking at 37℃and 200rpm for 12-16 hours. 1mL of fresh culture solution is taken in the next day and transferred into 9mL of GMI solution, and the culture is carried out for 4.5 hours at 37 ℃ and 200 rpm; then 1mL of the culture solution is taken from 9mL of GMI solution, transferred into 9mL of GMII, and cultured for 1.5h at 37 ℃ under shaking at 200rpm to obtain competent cells. Packaging competent cells into 500 mu L to 2mL sterilized centrifuge tubes for later use, wherein the competent cells are best used at present; at the time of transformation, an appropriate amount of DNA (. About.1. Mu.g) was added to 500. Mu.L of competent cells. Incubation was performed at 37℃with slow shaking (120 rpm) for 3h, and then plated onto plates containing 30mg/mL Kan, and incubated overnight at 37 ℃; the next day single colonies were picked for colony PCR validation and specific colony PCR reaction systems are shown in table 1.
Table 1: colony PCR reaction system
The POE-PCR reaction procedure was as follows: pre-denaturation at 98 ℃ for 10min; denaturation at 98 ℃,10s, annealing at 60 ℃,10s, extension at 72 ℃,2min,30 cycles; 72℃for 5min.
Example 1: construction of an alpha-amylase bacillus subtilis self-induction expression vector containing a Pongarus cell source
The method comprises the following specific steps:
(1) Obtaining of the Carrier skeleton
The vector backbone pBH-amyZ1 fragment was obtained from pBHSS142-amyZ1 using primers P1/P2 (the construction method of the pBHSS142-amyZ1 vector is disclosed in He Li, et al enhanced extracellular raw starch-degradation α -amylase production in Bacillus subtilis by promoter engineering and translation initiation efficiency optimization. Microb Cell face journal.2022.21 (1). 127); the primer sequences are shown in Table 2.
Table 2: primer sequences
Primer(s) Sequence (5 '-3')
P1 CTGCAGATTATAGGTAAGAGAGGAATG
P2 GGTACCCCCATAGATGAATCCG
The PCR amplification procedure was as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 98 ℃,10s, annealing at 60 ℃,10s, extension at 72 ℃,4min,30 cycles; 72℃for 5min. The PCR products were recovered by 1% agarose electrophoresis. The carrier skeleton pBH-amyZ1 fragment is prepared, and the amino acid sequence of the amyZ1 protein is shown as SEQ ID NO. 4.
(2) Acquisition of related sequences from an induction system
The related sequence was obtained by NCBI (National Center of Biotechnology Information), the Gene ID of LuxR was ADP02958.1, the Gene ID of LuxI was AKE33865.1, promoter P R61 Promoter P luxR-luxI Terminator T luxR And terminator T luxI The gene sequences of (2) are shown in Table 3. The T is obtained by synthesizing by the division of biological engineering (Shanghai) and carrying on pUC57 commercial vector, using the vector pUC57 added with self-induced gene sequence as template and using the primers P3/P4, P5/P6, P7/P8, P9/P10, P11/P12 and P13/P14 luxR 、LuxR、P luxR-luxI 、LuxI、T luxI 、P R61 The gene sequences and primer sequences are shown in Table 4:
table 3: gene sequence
Table 4: primer sequences
Primer(s) Sequence (5 '-3')
P3 gattcatctatgggggtaccCCCGGCAGTACCGGCATA
P4 atcaccatcatcaccattaaGAGCTCGGTACCCTCGAGGGA
P5 ccctcgagggtaccgagctcTTAATGGTGATGATGGTGATGGC
P6 gtaaggataaagagatgggtATGAAAGATATTAATGCTGATGATACATATAG
P7 tcagcattaatatctttcatACCCATCTCTTTATCCTTACCTATTGT
P8 tttttaatcatgatagtcatACCAACCTCCCTTGCGTTTAA
P9 taaacgcaagggaggttggtATGACTATCATGATTAAAAAATCTGATTTT
P10 tcgttttatttgatgcctggTTAATGATGATGATGATGGTGATTCA
P11 accatcatcatcatcattaaCCAGGCATCAAATAAAACGAAAG
P12 acctgtacgatcctacaggtTCTAGTAGAGAGCGTTCACCGACA
P13 ggtgaacgctctctactagaACCTGTAGGATCGTACAGGTTTACG
P14 ctcttacctataatctgcagACTACATTTATTATACAACAAACCATTTTCTT
Note that: lower case letters are homology arm sequences.
The PCR amplification procedure was as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 98 ℃,10s, annealing at 57 ℃,10s, extension at 72 ℃,20s,30 cycles; 72℃for 5min. The PCR product was recovered by 1% agarose electrophoresis.
Promoter P was then fused by PCR luxR-luxI LuxR gene fragment, luxI gene fragment, terminator T luxR And terminator T luxI The gene fragments are connected to form a LuxI-LuxR expression frame (shown in SEQ ID NO. 7), and the expression frame comprises LuxR, luxI and a promoter P luxR-luxI Terminator T luxR And T luxI . Specific fusion PCR was as follows: the ligation system was divided into two steps, the first step was to use fragments as templates, no primers were added, a 50. Mu.L system, annealing temperature was the average of all primers, and extension time was the time of the longest fragment, 15 cycles. I.e. pre-denatured at 94℃for 5min; denaturation at 98 ℃,10s, annealing at 57 ℃,10s, extension at 72 ℃,1min 30s,15 cycles; 72℃for 5min. The PCR product was recovered by 1% agarose electrophoresis. In the second step, the primer is the primer P3/P14 at the head and the tail, and the template is a system of 10 mu L and 50 mu L in the first step. The PCR procedure was as follows: pre-denaturation at 94 ℃ for 3min; denaturation at 98 ℃,10s, annealing at 57 ℃,15s, extension at 72 ℃,1min 30s,30 cycles. The PCR product was recovered by 1% agarose electrophoresis to prepare an auto-induced LuxI-LuxR expression cassette.
With respect to promoter P luxR-luxI Sequence analysis:
ACCCATCTCTTTATCCTTACCTATTGTTTGTCGCAAGTTTTGCGTGTTATATATCATTAAAACGGTAATAGATTGACATTTGATTCTAATAAATTGGATTTTTGTCACACTATTATATCGCTTGAAATACAATTGTTTAACATAAGTACCTGTAGGATCGTACAGGTttacgCAAGAAAATGGTTTGttataGTCGATTAAACGCAAGGGAGGTTGGTAC CTGTAGGATCGTACAGGTis a LuxR binding site; ttacg is the PluxI-35 region and ttata is the PluxI-10 region.
(3) Construction of self-inducible expression vectors
The vector skeleton pBH-amyZ1 fragment obtained in the step 1 and P are combined by using a POE-PCR method R61 The gene sequences and the self-induced LuxI-LuxR expression frames are connected, and POE-PCR reaction is shown in Table 5:
table 5: POE-PCR reaction system
The POE-PCR reaction procedure was as follows: pre-denaturation at 94 ℃ for 5min; denaturation at 95 ℃,10s, annealing at 60 ℃,10s, extension at 72 ℃,15min,30 cycles; 72℃for 10min.
Double enzyme digestion verification is carried out on POE-PCR reaction products by adopting Sac I and Sma I, and a specific double enzyme digestion reaction system is shown in Table 6.
Table 6: double enzyme digestion reaction system
Enzyme cutting component Dosage of
Plasmids or fragments 2μg
QuickCut TM Sac I 2.5μL
QuickCut TM Sma I 2.5μL
10×QuickCut Buffer 5μL
ddH 2 O Supplement 50 mu L
The reaction conditions were 37℃for 1h. Then, the nucleic acid electrophoresis detection is performed. The enzyme cutting band is correct, namely the self-induction expression vector pBH-T luxR -luxR-P luxR-luxI -luxI-T luxI -P R61 amyZ1, hereinafter referred to as pBHLIR-amyZ1 (FIG. 1).
Example 2: obtaining recombinant bacteria containing self-induction expression vector pBHLIR-amyZ1 and shake flask fermentation
The method comprises the following specific steps:
(1) Construction of recombinant bacterium containing self-inducible expression vector pBHLIR-amyZ1
The self-induction vector pBHLIR-amyZ1 constructed in example 1 is transformed into competent cells of bacillus subtilis WB600 (purchased from China general microbiological culture collection center (CGMCC), address: china Beijing Kogyo area, preservation number: CGMCC NO: 1.821); recombinant bacillus subtilis is transformed, single colony with correct colony PCR verification is subjected to test tube culture, plasmid is extracted and sequenced the next day, and the recombinant bacillus subtilis containing the self-induction expression vector pBHLIR-amyZ1 is obtained after correct sequence analysis: subtilis WB600/pBHLIR-amyZ1.
(2) Shake flask fermentation of recombinant bacteria containing self-induced expression vector pBHLIR-amyZ1
The obtained Bacillus subtilis WB600/pBHLIR-amyZ1 containing the self-inducible expression vector pBHLIR-amyZ1 was subjected to shake flask culture, the obtained recombinant Bacillus subtilis was inoculated into a seed medium, and cultured at 37℃and 200rpm for 12 hours to obtain a seed solution, and the seed solution was inoculated into a shake flask fermentation medium at an inoculum size of 2% (v/v) and cultured at 30℃and 200rpm for 48 hours to obtain a fermentation broth (FIG. 2).
Fermenting the obtained bacillus subtilis recombinant bacteria fermentation liquor at 4 DEG CCentrifuging at 8000rpm for 20min, and obtaining supernatant after centrifugation as crude enzyme liquid obtained by fermentation. The crude enzyme solution obtained is subjected to raw starch alpha-amylase enzyme activity detection, and then at OD 540 And (3) reading, and taking the reading into a formula to obtain the specific enzyme activity value. By measurement, the enzyme activity of the raw starch alpha-amylase amyZ1 in the recombinant bacterium B.subtilis WB600/pBHLIR-amyZ1 containing the self-induction expression vector pBHLIR-amyZ1 was 115U/mL.
Example 3: induction module P in bacillus subtilis self-induction expression system luxI Substitution of the-10 region of the promoter
(1) Promoter P against the pBHLIR-amyZ1 vector constructed in example 1 luxR-luxI Middle P luxI The promoter-10 region is replaced, 8 strong promoters P of a constitutive or inducible promoter commonly used in bacillus subtilis expression systems are selected ylB 、P Hpall 、P 43 、P spoVG 、P veg 、P srfA 、P sigW And P hag The sequences of the-10 region and the-35 region are shown in Table 7.
Table 7: -10 region and-35 region sequences
Promoters Sequence of the-10 region (5 '-3') -35 region sequence (5 '-3')
P ylB TACAAT TTGGAT
P Hpall TATACT TTTATG
P 43 TAAAAT GTGAAA
P spoVG GAAT AGGATTT
P veg TACAAT TTGACA
P srfA TAAACT GTGATA
P sigW AGTA TGAAAC
P hag TCCGATAT TTAA
P of pBHLIR-amyZ1 expression vector luxI The-10 region of the promoter is replaced by the-10 region of 8 strong promoters of the constitutive or inducible promoters respectively, the self-inducible expression vector pBHLIR-amyZ1 is used as a template, and the primer pair P15/P16 is used for amplifying the vector fragment pBH-T luxR -luxR-P luxR-luxI-10 -luxI-T luxI -P R61 amyZ1, amplification of the self-inducible fragment P using the primer pair P17/P18, P17/P19, P17/P20, P17/P21, P17/P22, P17/P23, P17/P24 and P17/P25, respectively ylB 10、P Hpall 10、P 43 10、P spoVG 10、P veg 10、P srfA 10、P sigW 10 and P hag The 10 primers are shown in Table 8.
Table 8: primer sequences
Primer(s) Sequence (5 '-3')
P15 CATCATCACCATTAAGAGCTCGGTACCCTCGAGGGATC
P16 AAACGCAAGGGAGGTTGGTATGACTATCATGATTAAAAAATC
P17 TTAATGGTGATGATGGTGATGGCTTTTAAAGTAAGGGC
P18 CCAACCTCCCTTGCGTTTAATCGACATTGTACAAACCAT
P19 CCAACCTCCCTTGCGTTTAATCGACAGTATACAAACCATT
P20 CCAACCTCCCTTGCGTTTAATCGACATTTTACAAACCATT
P21 CCAACCTCCCTTGCGTTTAATCGACATTCCAAACCATT
P22 CCAACCTCCCTTGCGTTTAATCGACATTGTACAAACCATT
P23 CCAACCTCCCTTGCGTTTAATCGACAGTTTACAAACCATT
P24 CCAACCTCCCTTGCGTTTAATCGACTACTCAAACCATT
P25 CCAACCTCCCTTGCGTTTAATCGACATATCGGACAAACCATT
Then self-induced fragment P ylB 10、P Hpall 10、P 43 10、P spoVG 10、P veg 10、P srfA 10、P sigW 10 and P hag 10 and vector fragment pBH-T luxR -luxR-P luxR-luxI-10 -luxI-T luxI -P R61 the-amyZ 1 was subjected to POE-PCR ligation, the specific reaction system is shown in Table 5, and then the POE-PCR product was subjected to cleavage verification, the reaction system is shown in Table 6, and incubated at 37℃for 1h. Converting POE-PCR product with correct enzyme digestion verification result into bacillus subtilis WB600, performing test tube culture on single colony with correct colony PCR verification, extracting plasmid the next day for sequencing, and obtaining the induction module P with correct sequence analysis luxI Recombinant bacterium following replacement of the-10 region of the promoter: subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-veg10 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-ylB10 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-srfA10 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-spoVG10 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-Hpall10 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-4310 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-sigW10 -luxI-T luxI -P R61 -amyZ1、B.subtilis WB600/pBH-T luxR -luxR-P luxR-luxI-hag10 -luxI-T luxI -P R61 -amyZ1。
For convenience of description, they are abbreviated as B.subtilis WB600/pBHLIR-P, respectively luxR-veg10 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-ylB10 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-srfA10 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-spoVG10 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-Hpall10 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-4310 -luxI-amyZ1，B.subtilis WB600/pBHLIR-P luxR-sigW10 luxI-amyZ1 and B.subilis WB600/pBHLIR-P luxR-hag10 The subsequent nomenclature is the same as for luxI-amyZ1.
(2) Induction module P luxI Shake flask fermentation of recombinant bacillus subtilis with replaced promoter-10 region
Inoculating the bacillus subtilis recombinant bacteria obtained in the step (1) into a seed culture medium, culturing at 37 ℃ and 200rpm for 12 hours to obtain a seed solution, inoculating the seed solution into a shake flask fermentation culture medium according to an inoculum size of 2% (v/v), and culturing at 30 ℃ and 200rpm for 48 hours to obtain a fermentation broth.
And (3) centrifuging the fermentation liquor of the bacillus subtilis recombinant bacteria at the temperature of 4 ℃ and at the speed of 8000rpm for 20min, wherein the supernatant after centrifugation is crude enzyme liquor obtained by fermentation. The crude enzyme solutions obtained were subjected to measurement of the activity of raw starch alpha-amylase (FIG. 3), and the results are shown in Table 9:
table 9: self-induced P luxI Recombinant bacterium shake flask fermentation enzyme activity with-10 region replaced
The results show that P of the module is to be induced luxI Substitution of the promoter-10 region with P srfA 、P spoVG 、P 43 、P veg Has obviously improved enzyme activity, B.subtilis WB600/pBHLIR-P luxR-4310 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-veg10 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-spoVG10 The increase in luxI-amyZ1 is 1.23 to 1.26 times that of the control B.subtilis WB600/pBHLIR-amyZ1.
Example 4: induction module P of bacillus subtilis self-induction expression system luxI Substitution of the-35 region of the promoter
(1) P against the pBHLIR-amyZ1 vector constructed in example 1 luxI Substitution of the-35 region of the promoter
Similarly, 8 strong promoters P of constitutive or inducible promoters commonly used in bacillus subtilis expression systems are selected ylB 、P Hpall 、P 43 、P spoVG 、P veg 、P srfA 、P sigW And P hag The sequences of the-10 region and the-35 region are shown in Table 7.
P of pBHLIR-amyZ1 expression vector luxI The-35 region of the promoter is replaced by the-35 region of 8 strong promoters of the constitutive or inducible promoters respectively, the self-inducible expression vector pBHLIR-amyZ1 is used as a template, and the primer pair P26/P27 is used for amplifying the vector fragment pBH-T luxR -luxR-P luxR-luxI-35 -luxI-T luxI -P R61 amyZ1, amplification of the self-inducible fragment P using the primer pair P28/P29, P28/P30, P28/P31, P28/P32, P28/P33, P28/P34, P28/P35 and P28/P36, respectively ylB35 、P Hpall35 、P 4335 、P spoVG35 、P veg35 、P srfA35 、P sigW35 And P hag35 The primers are shown in Table 10.
Table 10: primer sequences
Primer(s) Sequence (5 '-3')
P26 CATCATCACCATTAAGAGCTCGGTACCCTCGAGGGATC
P27 GTTTGTTATAGTCGATTAAACGCAAGGGAGGTTGGTATGACTAT
P28 TTAATGGTGATGATGGTGATGGCTTTTAAAGTAAGGGC
P29 TTAATCGACTATAACAAACCATTTTCTTGATCCAAACCTGTACG
P30 TTAATCGACTATAACAAACCATTTTCTTGCATAAAACCTGTACG
P31 TTAATCGACTATAACAAACCATTTTCTTGTTTCACACCTGTACG
P32 TTAATCGACTATAACAAACCATTTTCTTGAAATCCTACCTGTACG
P33 TTAATCGACTATAACAAACCATTTTCTTGTGTCAAACCTGTACG
P34 TTAATCGACTATAACAAACCATTTTCTTGTATCACACCTGTACG
P35 TTAATCGACTATAACAAACCATTTTCTTGGTTTCAACCTGTACG
P36 TTAATCGACTATAACAAACCATTTTCTTGTTAAACCTGTACG
Then self-induced fragment P ylB35 、P Hpall35 、P 4335 、P spoVG35 、P veg35 、P srfA35 、P sigW35 And P hag35 With vector fragment pBH-T luxR -luxR-P luxR-luxI-35 -luxI-T luxI -P R61 the-amyZ 1 was subjected to POE-PCR ligation, the specific reaction system is shown in Table 5, and then the POE-PCR product was subjected to cleavage verification, the reaction system is shown in Table 6, and incubated at 37℃for 1h.
Converting POE-PCR product with correct enzyme digestion verification result into bacillus subtilis WB600, performing test tube culture on single colony with correct colony PCR verification, extracting plasmid the next day for sequencing, and obtaining the induction module P with correct sequence analysis luxI The recombinant bacterium after the substitution of the-35 region of the promoter is named as: subtilis WB600/pBHLIR-P luxR-veg35 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-ylB35 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-srfA35 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-spoVG35 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-Hpall35 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-4335 -luxI-amyZ1，B.subtilis WB600/pBHLIR-P luxR-sigW35 luxI-amyZ1 and B.subilis WB600/pBHLIR-P luxR-hag35 -luxI-amyZ1. The naming is the same as the three examples.
(2) Induction module P luxI Shake flask fermentation of recombinant bacillus subtilis with replaced promoter-35 region
Inoculating the bacillus subtilis recombinant bacteria obtained in the step (1) into a seed culture medium, culturing at 37 ℃ and 200rpm for 12 hours to obtain a seed solution, inoculating the seed solution into a shake flask fermentation culture medium according to an inoculum size of 2% (v/v), and culturing at 30 ℃ and 200rpm for 48 hours to obtain a fermentation broth.
And (3) centrifuging the fermentation liquor of the bacillus subtilis recombinant bacteria at the temperature of 4 ℃ and at the speed of 8000rpm for 20min, wherein the supernatant after centrifugation is crude enzyme liquor obtained by fermentation. The crude enzyme solutions obtained were subjected to measurement of the activity of raw starch α -amylase (fig. 4), and the results are shown in table 11:
table 11: self-induced P luxI Shake flask fermentation enzyme activity of recombinant bacteria
Strain Enzyme activity (U/mL)
B.subtilis WB600/pBHLIR-P luxR-veg35 -luxI-amyZ1 120.3
B.subtilis WB600/pBHLIR-P luxR-ylB35 -luxI-amyZ1 142.4
B.subtilis WB600/pBHLIR-P luxR-srfA35 -luxI-amyZ1 116.5
B.subtilis WB600/pBHLIR-P luxR-spoVG35 -luxI-amyZ1 145.0
B.subtilis WB600/pBHLIR-P luxR-Hpall35 -luxI-amyZ1 117.0
B.subtilis WB600/pBHLIR-P luxR-4335 -luxI-amyZ1 104.6
B.subtilis WB600/pBHLIR-P luxR-sigW35 -luxI-amyZ1 86.7
B.subtilis WB600/pBHLIR-P luxR-hag35 -luxI-amyZ1 96.5
B.subtilis WB600/pBHLIR-amyZ1 115.6
The results show that the module P is to be induced luxI Substitution of the-35 region of the promoter with P spoVG And P ylB Has an effect of improving the enzyme activity in the region-35 of (B) recombinant bacterium B.subtilis WB600/pBHLIR-P luxR-spoVG35 luxI-amyZ1 and B.subilis WB600/pBHLIR-P luxR-ylB35 The enzyme activity of the raw starch alpha-amylase amyZ1 in the luxI-amyZ1 is increased to 1.23 and 1.25 times that of the control bacterium B.subtilis WB600/pBHLIR-amyZ1.
Example 5: construction of superimposed promoter of induction module in bacillus subtilis self-induction expression system and shake flask fermentation
(1) Construction of inducible module-stacked promoters in self-inducible expression systems
The autoinduction vector pBHLIR-P with increased enzymatic Activity in examples 3 and 4 luxR-Hpall10 -luxI-amyZ1、pBHLIR-P luxR-veg10 -luxI-amyZ1、pBHLIR-P luxR-spoVG10 -luxI-amyZ1、pBHLIR-P luxR-srfA10 -luxI-amyZ1、pBHLIR-P luxR-4310 -luxI-amyZ1、pBHLIR-P luxR-spoVG35 -luxI-amyZ1 and pBHLIR-P luxR-ylB35 -luxI-amyZ1 for the superimposed combination replacement of promoter-10 and-35 regions, the specific steps are as follows:
firstly, using self-induction vector pBHLIR-amyZ1 as template, using primer pair P37/P38, P37/P39 and P37/P40 respectively,The overlapping promoter fragments P are amplified by P37/P41, P37/P42, P37/P43, P357/P44 and P37/P45 spoVG35spoVG10 、P spoVG10ylB35 、P veg10spoVG35 、P veg10ylB35 、P srfA10spoVG35 、P srfA10ylB35 、P spoVG354310 、P ylB354310 . Then, the vector fragment pBH-T was amplified using pBHLIR-amyZ1 as a template and the primer pair P46/P47 luxR -luxR-P luxR-luxI10-35 -luxI-T luxI -P R61 amyZ1. Specific primers are shown in Table 12:
table 12: primer sequences
Primer(s) Sequence (5 '-3')
P37 TTAATGGTGATGATGGTGATGGCTTTTAAAGTAAGGGC
P38 CTCCCTTGCGTTTAATCGACATTCCAAACCATTTTCTTGAAATCCTACCTGTAC
P39 CTCCCTTGCGTTTAATCGACATTCCAAACCATTTTCTTGATCCAAACCTGTAC
P40 CTCCCTTGCGTTTAATCGACATTGTACAAACCATTTTCTTGAAATCCTACCTGTAC
P41 CTCCCTTGCGTTTAATCGACATTGTACAAACCATTTTCTTGATCCAAACCTGTAC
P42 CTCCCTTGCGTTTAATCGACAGTTTACAAACCATTTTCTTGAAATCCTACCTGTAC
P43 CTCCCTTGCGTTTAATCGACAGTTTACAAACCATTTTCTTGATCCAAACCTGTAC
P44 CTCCCTTGCGTTTAATCGACATTTTACAAACCATTTTCTTGAAATCCTACCTGTAC
P45 CTCCCTTGCGTTTAATCGACATTTTACAAACCATTTTCTTGATCCAAACCTGTAC
P46 GTCGATTAAACGCAAGGGAGGTTGGTATGACTATCATGATT
P47 CATCATCACCATTAAGAGCTCGGTACCCTCGAGGGATC
Self-induced fragment P spoVG35spoVG10 、P spoVG10ylB35 、P veg10spoVG35 、P veg10ylB35 、P srfA10spoVG35 、P srfA10ylB35 、P spoVG354310 、P ylB354310 (for simplicity of description, fragments were designated as spo1035, spoylB, vegspo, vegylB, srfAspo, srfAylB, 43spo, 43ylB, respectively) and vector fragment pBH-T luxR -luxR-P luxR-1035 -luxI-T luxI -P R61 amyZ1 (for simplicity of expression, fragments were designated pBHLIR-P luxR-1035 -luxI-amyZ 1) POE-PCR ligation. The specific reaction system is shown in Table 5, and then the POE-PCR product is subjected to enzyme digestion verification, the verification reaction system is shown in Table 6, and the reaction system is incubated for 1h at 37 ℃.
Converting POE-PCR product with correct enzyme digestion verification result into bacillus subtilisIn the bacterial WB600, single colony with correct colony PCR verification is subjected to test tube culture, plasmid is extracted and sent to sequence for the next day, and the induction module P is the correct sequence analysis luxI Recombinant bacteria with overlapped and replaced-35 region and-10 region of promoter: subtilis WB600/pBHLIR-P luxR-spo1035 -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-spoylB -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-vegspo -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-vegylB -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-srfAspo -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-srfAylB -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-43spo -luxI-amyZ1、B.subtilis WB600/pBHLIR-P luxR-43ylB -luxI-amyZ1。
(2) Induction module P luxI Shake flask fermentation of bacillus subtilis recombinant bacteria after superposition and replacement of promoter-35 region and-10 region
Inoculating the bacillus subtilis recombinant bacteria obtained in the step (1) into a seed culture medium, culturing at 37 ℃ and 200rpm for 12 hours to obtain a seed solution, inoculating the seed solution into a shake flask fermentation culture medium according to an inoculum size of 2% (v/v), and culturing at 30 ℃ and 200rpm for 48 hours to obtain a fermentation broth.
And (3) centrifuging the fermentation liquor of the bacillus subtilis recombinant bacteria at the temperature of 4 ℃ and at the speed of 8000rpm for 20min, wherein the supernatant after centrifugation is crude enzyme liquor obtained by fermentation. The crude enzyme solutions obtained were subjected to measurement of the activity of raw starch alpha-amylase (FIG. 5), and the results are shown in Table 13:
table 13: induction module P luxI Shaking flask fermentation enzyme activity of overlapped recombinant bacteria
Strain Shaking flask enzyme activity (U/mL)
B.subtilis WB600/pBHLIR-amyZ1 116.75
B.subtilis WB600/pBHLIR-P luxR-spo1035 -luxI-amyZ1 85.85
B.subtilis WB600/pBHLIR-P luxR-spoylB -luxI-amyZ1 115.52
B.subtilis WB600/pBHLIR-P luxR-vegspo -luxI-amyZ1 96.69
B.subtilis WB600/pBHLIR-P luxR-vegylB -luxI-amyZ1 155.00
B.subtilis WB600/pBHLIR-P luxR-srfAspo -luxI-amyZ1 127.13
B.subtilis WB600/pBHLIR-P luxR-srfAylB -luxI-amyZ1 77.60
B.subtilis WB600/pBHLIR-P luxR-43spo -luxI-amyZ1 213.67
B.subtilis WB600/pBHLIR-P luxR-43ylB -luxI-amyZ1 139.52
The results show that P luxI Substitution of region-35 to P spoVG And region-10 is replaced by P 43 The-10 region of the promoter, alpha-amylase AmyZ1The enzyme activity is obviously improved and is 1.83 times of that of the original strain B.subtilis WB600/pBHLIR-amyZ1. And B.subtilis WB600/pBHLIR-P luxR-vegylB The enzyme activity of the luxI-amyZ1 strain is also increased by a factor of 1.6 compared with that of the starting strain B.subtilis WB600/pBHLIR-amyZ1.
Example 6: self-inducible expression vectors pBHLIR-Invdz13 and pBHLIR-P luxR-43spo Construction of-luxI-Invdz 13 and shake flask fermentation
(1) Self-inducible expression vectors pBHLIR-Invdz13 and pBHLIR-P luxR-43spo Construction of-luxI-InvDz 13
Specific embodiments are the same as examples 1 to 5, except that the target protein is adjusted as follows: invDz13 (shown in SEQ ID NO. 5). Preparation of the self-inducible expression vectors pBHLIR-Invdz13 and pBHLIR-P, respectively luxR-43spo The InvDz13 primer sequence involved was P50/P51. Vector pBHLIR-amyZ1 constructed in example 1 and vector pBHLIR-P constructed in example 5 luxR-43spo Amplification of vector backbones pBHLIR and pBHLIR-P with P48/P49 as primer, by using-luxI-amyZ 1 as template luxR-43spo luxI. Primer sequences are shown in Table 14:
table 14: primer sequences
Primer(s) Sequence (5 '-3')
P48 TCTAGAGTCGACGTCCCCGGGGCAGCCCGCCTAATG
P49 CATGGATTCGGCATCCGCGAGACTGACCTTCGG
P50 ATGGCACCGGTTGCCCCGGCTGCCCCTGAACTG
P51 TCACGGCAGCGGGGTAACTTTACCG
The PCR amplification procedure was as follows: pre-denaturation at 98 ℃ for 5min; denaturation at 98 ℃,15s, annealing at 60 ℃,10s, extension at 72 ℃,4min (backbone plasmid)/1 min 30s (sucrase gene), 30 cycles; 72℃for 5min. The PCR product was recovered by 1% agarose electrophoresis.
The backbone plasmids pBHLIR and pBHLIR-P were subjected to POE-PCR luxR-43spo The ligation of the-luxI with the sucrase Invdz13 gene sequence was followed by cleavage verification of the POE-PCR product, the cleavage verification reaction system being as shown in Table 6, and incubation at 37℃for 1h.
Converting the POE-PCR product with correct enzyme digestion verification result into bacillus subtilis WB600, performing test tube culture on a single colony with correct colony PCR verification, extracting plasmid for the next day, and sequencing, wherein the recombinant bacterium with correct sequence analysis is the recombinant bacterium with replaced reporter gene: subtilis WB600/pBHLIR-InvDz13, B.Subtilis WB600pBHLIR-P luxR-43spo -luxI-InvDz13。
(3) Shake flask fermentation of recombinant bacteria containing sucrase InvD13
Inoculating the bacillus subtilis recombinant bacteria obtained in the step (1) into a seed culture medium, culturing at 37 ℃ and 200rpm for 12 hours to obtain a seed solution, inoculating the seed solution into a shake flask fermentation culture medium according to an inoculum size of 2% (v/v), and culturing at 30 ℃ and 200rpm for 48 hours to obtain a fermentation broth.
And (3) centrifuging the fermentation liquor of the bacillus subtilis recombinant bacteria at the temperature of 4 ℃ and at the speed of 8000rpm for 20min, wherein the supernatant after centrifugation is crude enzyme liquor obtained by fermentation. The resulting crude enzyme solutions were each subjected to detection of the sucrase activity, and the results are shown in Table 15:
table 15: shake flask fermentation enzyme activity of recombinant bacteria
Strain Shaking flask enzyme activity (U/mL)
B.subtilis WB600/pBHLIR-InvDz13 0.36
B.subtilis WB600pBHLIR-P luxR-43spo -luxI-InvDz13 0.78
As shown in Table 15, the application of the self-inducible expression vector to the sucrase InvDz13 was effective, and the enzyme activity of InvDz13 was increased to 2-fold that of the original strain.
Example 7: self-induction expression vectors pBHLIR-39 and pBHLIR-P luxR-43spo Construction of luxI-39 and shaking flask fermentation (1) self-inducible expression vectors pBHLIR-39 and pBHLIR-P luxR-43spo Construction of luxI-39
Specific embodiments are the same as examples 1 to 5, except that the target protein is adjusted as follows: levan enzyme 39 (SEQ ID NO. 6). Preparation of the self-inducible expression vectors pBHLIR-39 and pBHLIR-P, respectively luxR-43spo The sequence of the 39 primer involved is P52/P53. Vector pBHLIR-amyZ1 constructed in example 1 and vector pBHLIR-P constructed in example 5 luxR-43spo Amplification of vector backbones pBHLIR and pBHLIR-P with P54/P55 as primer, by using-luxI-amyZ 1 as template luxR-43spo luxI. Primer sequences are shown in Table 16:
table 16: primer sequences
Primer(s) Sequence (5 '-3')
P52 GTCTCGCGGATGCCGAATCCATGAACATCAAAAAGTTTGCCAAACAAG
P53 GTCGACTCTAGATTAGTGATGGTGATGGTGATGTTTGTTAATTGTTAATTGTCC
P54 TCTAGAGTCGACGTCCCCGGGGCAGCCCGCCTAATG
P55 CATGGATTCGGCATCCGCGAGACTGACCTTCGG
The PCR amplification procedure was as follows: pre-denaturation at 98 ℃ for 5min; denaturation at 98 ℃,15s, annealing at 60 ℃,10s, extension at 72 ℃,5min (backbone plasmid)/1 min 30s (levan enzyme gene), 30 cycles; 72℃for 5min. The PCR product was recovered by 1% agarose electrophoresis.
The backbone plasmids pBHLIR and pBHLIR-P were subjected to POE-PCR luxR-43spo the-luxI was ligated with the levanase 39 gene sequence, followed by cleavage verification of the POE-PCR product, the cleavage verification reaction system is shown in Table 6, and incubated for 1h at 37 ℃.
Converting the POE-PCR product with correct enzyme digestion verification result into bacillus subtilis WB600, performing test tube culture on a single colony with correct colony PCR verification, extracting plasmid for the next day, and sequencing, wherein the recombinant bacterium with correct sequence analysis is the recombinant bacterium with replaced reporter gene: b.subtilis WB600/pBHLIR-39, B.subtilis WB600/pBHLIR-P luxR-43spo -luxI-39。
(3) Shake flask fermentation of recombinant bacteria containing levan enzyme 39
Inoculating the bacillus subtilis recombinant bacteria obtained in the step (1) into a seed culture medium, culturing at 37 ℃ and 200rpm for 12 hours to obtain a seed solution, inoculating the seed solution into a shake flask fermentation culture medium according to an inoculum size of 2% (v/v), and culturing at 30 ℃ and 200rpm for 48 hours to obtain a fermentation broth.
And (3) centrifuging the fermentation liquor of the bacillus subtilis recombinant bacteria at the temperature of 4 ℃ and at the speed of 8000rpm for 20min, wherein the supernatant after centrifugation is crude enzyme liquor obtained by fermentation. The resulting crude enzyme solutions were subjected to levan enzyme activity detection, respectively, and the results are shown in Table 17:
table 17: shake flask fermentation enzyme activity of recombinant bacteria
Strain Shaking flask enzyme activity (U/L)
B.subtilis WB600/pBHLIR-39 48.6
B.subtilis WB600/pBHLIR-P luxR-43spo -luxI-39 77.5
As shown in Table 17, the application of the self-inducible expression vector to levan enzyme 39 was effective, and the enzyme activity of 39 was increased 1.6 times that of the original strain.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims (10)

1. An auto-induction expression vector is characterized in that an induction module and a response module are connected to the expression vector; the induction module is a promoter P with a nucleotide sequence shown as SEQ ID NO.8 luxR-luxI The nucleotide sequence of the expression module is the luxR-luxI expression frame of the luxR gene shown as SEQ ID NO.2 and the nucleotide sequence of the luxI gene shown as SEQ ID NO.3, and the response module contains P with the nucleotide sequence shown as SEQ ID NO.1 R61 Promoters and proteins of interest.
2. The expression vector of claim 1, wherein the promoter P is luxR-luxI The base TTATA at positions 187-192 in the middle sequence is replaced by TACAAT, TACAAT, TAAACT, GAAT or TAAAAT.
3. The expression vector of claim 1, wherein the promoter P is luxR-luxI The base TTACG at 167-172 in the middle sequence is replaced by TTGACA, TTGGAT or AGGATTT.
4. The expression vector according to any one of claims 1 to 3, wherein the promoter P is luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TAAACT, and the base TTACG at the 167-172 th position is replaced by AGGATTT;
or by introducing the promoter P luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TACAAT, and the base TTACG at the 167-172 th position is replaced by TTGGAT;
introducing the promoter P luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TAAAAT, and the base TTACG at the 167-172 th position is replaced by AGGATTT;
introducing the promoter P luxR-luxI The base TTATA at the 187-192 th position in the middle sequence is replaced by TAAAAT, and the base TTACG at the 167-172 th position is replaced by TTGGAT;
preferably, the protein of interest includes, but is not limited to, amyZ1 protein, invdz13 protein, levan enzyme 39.
5. A recombinant cell comprising the expression vector of any one of claims 1 to 4.
6. The recombinant cell of claim 5, wherein the recombinant cell is bacterial or fungal as an expression host; preferably, the recombinant cell uses bacillus subtilis as an expression host.
7. A method for increasing the expression level of a target protein, which comprises expressing the target protein using the expression vector according to any one of claims 1 to 4 or the recombinant cell according to claim 5 or 6.
8. A method for producing a target protein, comprising adding the recombinant cell according to claim 5 or 6 to a medium and fermenting to produce the target protein; preferably, the protein of interest includes, but is not limited to, amyZ1 protein, invdz13 protein, levan enzyme 39.
9. The method according to claim 8, wherein the recombinant cells are streaked and activated, and then inoculated into a seed culture medium, and cultured for 8-10 hours at 25-35 ℃ and 180-220 rpm to obtain a seed solution; inoculating the seed solution into a shake flask fermentation medium, and culturing for 45-50 h at 25-35 ℃ and 180-220 rpm to obtain the target protein.
10. The expression vector of any one of claims 1 to 4, or the recombinant cell of claim 5 or 6, or the method of any one of claims 7 to 9, for the preparation of a protein of interest and its use in the fields of food, medicine, textiles.
CN202311662930.9A 2023-11-30 2023-11-30 Construction and application of bacillus subtilis self-induction efficient protein expression system Pending CN117660514A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202311662930.9A CN117660514A (en) 2023-11-30 2023-11-30 Construction and application of bacillus subtilis self-induction efficient protein expression system

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202311662930.9A CN117660514A (en) 2023-11-30 2023-11-30 Construction and application of bacillus subtilis self-induction efficient protein expression system

Publications (1)

Publication Number Publication Date
CN117660514A true CN117660514A (en) 2024-03-08

Family

ID=90078410

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202311662930.9A Pending CN117660514A (en) 2023-11-30 2023-11-30 Construction and application of bacillus subtilis self-induction efficient protein expression system

Country Status (1)

Country Link
CN (1) CN117660514A (en)

Similar Documents

Publication Publication Date Title
CN110055204B (en) Method for improving fermentation enzyme production of bacillus licheniformis by knocking out spo II Q and pcf genes and application
CN110157654B (en) Bacillus natto recombinant strain and construction method and application thereof
CN106755037A (en) A kind of Virginia streptomycete IBL14 type I B sv14 type CAS gene editing systems
CN111926013A (en) Promoter suitable for bacillus licheniformis and application thereof in high-efficiency expression of target product
CN110904174B (en) Application of bacillus licheniformis with deletion of leucine dehydrogenase gene in production of heterologous protein
CN113151270A (en) Promoter for efficiently expressing alkaline protease and application thereof
CN114107146B (en) Construction method and application of resistance-marker-free auxotroph bacillus subtilis
CN114350699B (en) Strain for producing D-psicose 3-epimerase and application thereof
CN111117942B (en) Genetic engineering bacterium for producing lincomycin and construction method and application thereof
CN114703117B (en) Recombinant bacillus subtilis, construction method thereof and recombinant collagenase
CN117660514A (en) Construction and application of bacillus subtilis self-induction efficient protein expression system
CN110878293B (en) Application of bacillus licheniformis with deletion of yceD gene in production of heterologous protein
CN111471636B (en) Genetically engineered bacterium for expressing human epidermal growth factor and application thereof
CN116286575B (en) Method for efficiently expressing raw starch alpha-amylase by using bacillus subtilis
JPH09206077A (en) Plasmid and plasmid vector
CN117660281A (en) Method for efficiently expressing sucrase by using bacillus subtilis
CN111499688B (en) Signal peptide and application thereof in production of alpha-amylase
CN115820694B (en) Novel hyaluronidase coding gene, high-yield engineering bacterium thereof, construction method and application
WO2024114637A1 (en) Engineering bacteria for producing acarbose, and construction method therefor and use thereof
CN115976058B (en) Toxin gene and application thereof in construction of recombinant and/or gene-edited engineering bacteria
CN108865965B (en) Application of bacillus licheniformis DW2-yugT for strengthening yugT expression
CN116064522A (en) Temperature-inducible promoter derived from bacillus amyloliquefaciens and application thereof
CN116064521A (en) PH-induced promoter derived from bacillus amyloliquefaciens and application thereof
CN114891716A (en) Method for improving activity of recombinant escherichia coli cells
CN117247882A (en) High-yield lipopeptide engineering strain modified by constitutive promoter and construction method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination