CN111499688B

CN111499688B - Signal peptide and application thereof in production of alpha-amylase

Info

Publication number: CN111499688B
Application number: CN202010290289.0A
Authority: CN
Inventors: 吴敬; 张康; 檀瑞婷; 黄燕
Original assignee: Jiangnan University
Current assignee: Shandong Fukuan Biological Engineering Co ltd
Priority date: 2020-04-14
Filing date: 2020-04-14
Publication date: 2021-05-04
Anticipated expiration: 2040-04-14
Also published as: CN111499688A

Abstract

The invention relates to a signal peptide and application thereof in producing alpha-amylase, belonging to the technical field of genetic engineering and microbial engineering. The invention provides a signal peptide AspB' with an amino acid sequence shown as SEQ ID NO.1, which takes bacillus subtilis as a host, and co-expresses the signal peptide and ultrahigh-temperature alpha-amylase, so that the yield of the ultrahigh-temperature alpha-amylase can be remarkably improved; the recombinant bacillus subtilis B.subtilis WS9/pHY300PLK-AspB '-pfa co-expressing the signal peptide AspB' and the ultrahigh-temperature alpha-amylase is inoculated into a fermentation medium for fermentation for 60 hours, so that the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation broth can reach 119.01U/mL, and on the basis, the fermentation broth containing the thalli is further subjected to high-temperature heat treatment, so that the soluble enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation broth can be effectively improved.

Description

Signal peptide and application thereof in production of alpha-amylase

Technical Field

The invention relates to a signal peptide and application thereof in producing alpha-amylase, belonging to the technical field of genetic engineering and microbial engineering.

Background

Alpha-amylase (alpha-amylase, ec.3.2.1.1) is an important glycoside hydrolase with broad substrate preference and product specificity, which cleaves alpha-1, 4-glucosidic bonds in starch and related alpha-glucan molecules and hydrolyzes starch into soluble dextrins, oligosaccharides and maltose and glucose, while retaining the alpha-isomer conformation of the product. Therefore, alpha-amylase is widely applied to industries such as food, washing, paper making, textile, alcohol, medicine and the like.

Alpha-amylases can be classified into ultra-high temperature, intermediate temperature and low temperature alpha-amylases according to the action temperature. Wherein the ultra-high temperature alpha-amylase is alpha-amylase with the optimum temperature of more than 90 ℃, and has higher optimum temperature (close to 100 ℃), better heat stability, lower optimum pH (5.5) and Ca compared with other alpha-amylases widely used in industry²⁺Independent of the dependence, the excellent enzymological properties enable the ultrahigh temperature alpha-amylase to have higher industrial application value than other alpha-amylases.

However, the expression level of the hyperthermophilic α -amylase in the expression host is not high, for example, Shenzhou et al express the hyperthermophilic α -amylase in various host bacteria by recombinant expression in Escherichia coli only at 11.4U/mL, extracellular enzyme activity only at 1.76U/mL, total enzyme activity in Bacillus subtilis only at 1.4U/mL, extracellular enzyme activity only at 0.6U/mL, total enzyme activity in Saccharomyces cerevisiae only at 0.16U/mL, and total enzyme activity in Pichia pastoris only at 64U/mL (see the specific references: Shenzhou, Pyrococcus furiosus α -amylase gene expression in different hosts, university of south of the Yangtze river, 2003)), this deficiency greatly limits the industrial application of ultra-high temperature alpha-amylase. Therefore, a method for improving the yield of the ultrahigh-temperature alpha-amylase is continuously found.

Disclosure of Invention

[ problem ] to

The invention aims to provide a signal peptide capable of improving the yield of ultrahigh-temperature alpha-amylase.

[ solution ]

In order to solve the problems, the invention provides a signal peptide, and the amino acid sequence of the signal peptide is shown as SEQ ID NO. 1.

The invention also provides a gene, and the gene codes the signal peptide.

In one embodiment of the invention, the nucleotide sequence of the gene is shown in SEQ ID No. 2.

The invention also provides a recombinant plasmid, wherein the recombinant plasmid carries the gene; or, the recombinant plasmid carries the gene and a target gene; or the recombinant plasmid carries the gene, the target gene and the gene for coding molecular chaperone prsA.

In one embodiment of the invention, the gene of interest is a gene encoding an alpha-amylase.

In one embodiment of the invention, the alpha-amylase is a hyperthermal alpha-amylase.

In one embodiment of the invention, the nucleotide sequence of the gene encoding the hyperthermophilic alpha-amylase is shown as SEQ ID No. 3.

In one embodiment of the invention, the nucleotide sequence of the gene encoding molecular chaperone prsA is shown in SEQ ID No. 4.

In one embodiment of the present invention, the vector of the recombinant plasmid is pHY300PLK plasmid.

The invention also provides a host cell, which carries the recombinant plasmid; or the host cell carries the recombinant plasmid, and a gene encoding a molecular chaperone pfefoldin gamma is inserted into the genome of the host cell; or the host cell carries the recombinant plasmid, and a gene for coding a molecular chaperone PPlase is inserted into the genome of the host cell.

In one embodiment of the invention, the nucleotide sequence of the gene encoding the molecular chaperone pfefoldin gamma is shown as SEQ ID No. 5.

In one embodiment of the invention, the nucleotide sequence of the gene encoding the chaperone PPlase is shown in SEQ ID No. 6.

In one embodiment of the invention, the host cell is Bacillus subtilis.

In one embodiment of the invention, the host cell is Bacillus subtilis WS 9.

The invention also provides a method for producing the alpha-amylase, which comprises the steps of inoculating the host cells into a fermentation culture medium for fermentation to obtain fermentation liquor, and then separating the fermentation liquor to obtain the alpha-amylase;

or, the method comprises the steps of inoculating the host cell into a fermentation culture medium for fermentation to obtain fermentation liquor, then carrying out heat treatment on the fermentation liquor to obtain heat-treated fermentation liquor, and finally separating the heat-treated fermentation liquor to obtain the alpha-amylase;

or, the method comprises the steps of inoculating the host cells into a fermentation culture medium for fermentation to obtain fermentation liquor, centrifuging the fermentation liquor to obtain thalli, re-suspending the thalli to obtain a heavy suspension, performing heat treatment on the heavy suspension to obtain a heat-treated heavy suspension, and finally separating the alpha-amylase from the heat-treated heavy suspension.

In one embodiment of the present invention, the temperature of the heat treatment is 80 to 100 ℃ and the time is 10 to 90 min.

In one embodiment of the present invention, the temperature of the heat treatment is 90 ℃ for 15 min.

The invention also provides the application of the signal peptide or the gene or the recombinant plasmid or the host cell or the method in preparing the alpha-amylase.

Has the advantages that:

(1) the invention provides a signal peptide AspB' with an amino acid sequence shown as SEQ ID NO.1, which takes bacillus subtilis as a host, and co-expresses the signal peptide and ultrahigh-temperature alpha-amylase, so that the yield of the ultrahigh-temperature alpha-amylase can be remarkably improved; the recombinant bacillus subtilis B.subtilis WS9/pHY300PLK-AspB '-pfa co-expressing the signal peptide AspB' and the ultrahigh-temperature alpha-amylase is inoculated into a fermentation medium for fermentation for 60 hours, so that the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquid can reach 119.01U/mL, and is improved by 6.49 times compared with the recombinant bacillus subtilis B.subtilis WS9/pHY300PLK-pfa only expressing the ultrahigh-temperature alpha-amylase.

(2) The invention provides a recombinant bacillus subtilis B.subtilis WS9/pHY300PLK-prsA-AspB '-pfa capable of highly yielding ultrahigh-temperature alpha-amylase, wherein the bacillus subtilis co-expresses a gene for coding a signal peptide AspB' with an amino acid sequence shown as SEQ ID No.1, a gene for coding a molecular chaperone prsA with a nucleotide sequence shown as SEQ ID No.4 and the ultrahigh-temperature alpha-amylase; the recombinant bacillus subtilis WS9/pHY300 PLK-prsA-AspB' -pfa is inoculated into a fermentation culture medium for fermentation for 60 hours, so that the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquid can reach 134.15U/mL, and is improved by 7.32 times compared with the recombinant bacillus subtilis WS9/pHY300PLK-pfa only expressing the ultrahigh-temperature alpha-amylase.

(3) The invention provides a recombinant bacillus subtilis B.subtilis WS9din gamma/pHY 300PLK-prsA-AspB '-pfa capable of highly producing ultrahigh-temperature alpha-amylase, wherein the bacillus subtilis co-expresses a gene for coding a signal peptide AspB' with an amino acid sequence shown as SEQ ID NO.1, a gene for coding a molecular chaperone prsA with a nucleotide sequence shown as SEQ ID NO.4, a gene for coding a molecular chaperone pfoldin gamma with a nucleotide sequence shown as SEQ ID NO.5 and the ultrahigh-temperature alpha-amylase; the recombinant bacillus subtilis WS9din gamma/pHY 300 PLK-prsA-AspB' -pfa is inoculated into a fermentation culture medium for fermentation for 60 hours, so that the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquid can be up to 137.30U/mL, and is improved by 7.51 times compared with the recombinant bacillus subtilis WS9/pHY300PLK-pfa only expressing the ultrahigh-temperature alpha-amylase.

(4) The invention provides a recombinant bacillus subtilis B.subtilis WS9PPlase/pHY300PLK-prsA-AspB '-pfa capable of highly producing ultrahigh-temperature alpha-amylase, wherein the bacillus subtilis co-expresses a gene for coding a signal peptide AspB' with an amino acid sequence shown as SEQ ID NO.1, a gene for coding a molecular chaperone prsA with a nucleotide sequence shown as SEQ ID NO.4, a gene for coding a molecular chaperone PPlase with a nucleotide sequence shown as SEQ ID NO.6 and the ultrahigh-temperature alpha-amylase; the recombinant bacillus subtilis WS9din gamma/pHY 300 PLK-prsA-AspB' -pfa is inoculated into a fermentation culture medium for fermentation for 60 hours, so that the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquid can be up to 150.38U/mL, and is improved by 8.20 times compared with the recombinant bacillus subtilis WS9/pHY300PLK-pfa only expressing the ultrahigh-temperature alpha-amylase.

(5) The invention provides a method for producing ultrahigh-temperature alpha-amylase with high yield, which takes recombinant bacillus subtilis WS9din gamma/pHY 300PLK-prsA-AspB '-pfa as a production strain, firstly inoculates the recombinant bacillus subtilis WS9din gamma/pHY 300 PLK-prsA-AspB' -pfa into a fermentation medium for fermentation to obtain a fermentation broth, then carries out heat treatment on the fermentation broth to obtain a heat-treated fermentation broth, and finally separates the heat-treated fermentation broth to obtain the ultrahigh-temperature alpha-amylase; in the heat-treated fermentation supernatant obtained by fermenting for 72 hours by using the method, the enzyme activity of the ultrahigh-temperature alpha-amylase is up to 1682.98U/mL; the enzyme activity of the ultrahigh temperature alpha-amylase in the heat-treated fermentation supernatant obtained by fermenting for 120h by the method is up to 1837.96U/mL.

Drawings

FIG. 1 is an SDS-PAGE pattern of the recombinant plasmid pHY300 PLK-prsA-AspB' -pfa after digestion.

FIG. 2 shows the results of PCR electrophoretic verification of the genome of the subtilis WS9din γ; where M is DL1000DNAmarker,

lanes

1 and 2 are PCR products of B.subtilis WS9din γ colony.

FIG. 3 shows the results of the PCR electrophoretic validation of the subtilis WS9PPlase genome; where M is DL1000DNA Marker,

lanes

1 and 2 are PCR products of B.subtilis WS9PPlase colony.

FIG. 4 shows the enzyme activity of hyperthermal alpha-amylase in fermentation broth obtained after fermentation of recombinant Bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa for different times.

FIG. 5 is a graph showing the effect of temperature on the enzymatic activity of hyperthermal alpha-amylase.

FIG. 6 shows the effect of pH on enzymatic activity of hyperthermal alpha-amylase.

FIG. 7 shows the change of enzyme activity of ultra-high temperature alpha-amylase after being stored for different time under different temperature conditions.

Detailed Description

The invention is further illustrated by the following specific examples.

Bacillus subtilis WS9 mentioned in the following examples is described in the reference Zhang kang, Bacillus subtilis strain modification, promoter optimization and high efficiency preparation research of pullulanase, university in south of the Yangtze river, 2018, and Bacillus subtilis WS5 (which has been deposited in China center for type culture Collection at 29.9.2016 and has been deposited at M2016536, with the deposition address of China Wuhan university) is described in the patent document with the publication number CN 106754466A; pHY300PLK plasmid, pMDTM19-T plasmid, pET24a plasmid, pBE-S plasmid, Escherichia coli (Escherichia coli) JM109, Bacillus subtilis RIK1285, B.subtilis secretor Protein Expression System kit referred to in the following examples were purchased from Takara; agarose gel DNA recovery kits referred to in the examples below were purchased from Tiangen Biochemical technology, Inc.; the primers referred to in the following examples were synthesized by Sulin organisms, Inc. (Bacillus subtilis WS9, Escherichia coli JM109 and Bacillus subtilis RIK1285 are all commercially available or have been deposited without further deposition for the patent procedure).

The detection methods referred to in the following examples are as follows:

the method for detecting the enzyme activity of the ultrahigh-temperature alpha-amylase comprises the following steps: fully and uniformly mixing 1mL of 10g/L soluble starch solution and 0.9mL of 50mM citric acid-sodium citrate buffer solution with the pH value of 5.0 to obtain a reaction system; preheating the reaction system at 100 ℃ for 5min, adding 0.1mL of crude enzyme solution into the reaction system, and oscillating and uniformly mixing to react; after reacting for 10min, adding 3ml of an LDNS color developing solution into the reaction solution obtained by the reaction, oscillating, and placing in ice water to terminate the reaction; after the reaction, the reaction solution to which the color former was added was boiled for 7min, then placed in ice water and rapidly cooled, followed by addition of 10mL of deionized water and measurement of absorbance at 540nm (the same procedure was carried out with the inactivated enzyme solution as a catalyst as a blank).

Definition of hyperthermal alpha-amylase activity: under the above conditions, the amount of enzyme required to catalyze the production of glucose equivalent to 1. mu. mol per minute was defined as one unit of inactivation (1U).

The media involved in the following examples are as follows:

LB solid medium: 10g/L tryptone, 5g/L yeast powder, 10g/L NaCl and 1.5g/L agar powder.

LB liquid medium: 10g/L tryptone, 5g/L yeast extract and 10g/L NaCl.

TB liquid medium: 24g/L yeast powder, 12g/L tryptone, 5g/L glycerin, 12.54g/LK₂HPO₄、2.31g/L KH₂PO₄。

B, chemical transformation related culture medium of the bacillus subtilis:

10X minimum salt solution: 183g/L K₂HPO₄·3H₂O、60g/L KH₂PO₄、20g/L(NH₄)₂SO₄10g/L trisodium citrate, 2g/LMgSO₄·7H₂O。

Tryptophan solution: 10mg/mL, filter sterilized.

GM I solution: 500. mu.L of 10 Xminimum salt solution, 125. mu.L of 200g/L glucose, 20. mu.L of 50g/L hydrolyzed casein solution, 50. mu.L of 10g/L yeast juice, 25. mu.L of 10g/L tryptophan solution, and the volume of the solution is adjusted to 5mL with sterile water.

GM II solution: 2mL of 10 Xminimum salt solution, 0.5mL of 200g/L glucose, 16. mu.L of 50g/L hydrolyzed casein solution, 8. mu.L of 10g/L yeast juice, 50. mu.L of 1M MgCl solution, 10. mu.L of 1M CaCl solution and 20. mu.L of 10g/L tryptophan solution, and the contents are filled up to 20mL with sterile water.

Example 1: preparation of Signal peptide AspB

The method comprises the following specific steps:

synthesizing a gene pfa for coding ultra-high temperature alpha-amylase (the nucleotide sequence is shown as SEQ ID No.3 and is derived from Pyrococcus furiosus); amplifying the gene pfa by PCR by taking P1 and P2 as primers (the primers can be seen in Table 1 specifically) and taking the gene pfa coding the ultrahigh-temperature alpha-amylase as a template; taking P3 and P4 as primers (the primers can be seen in Table 1 specifically), taking pHY300PLK plasmid as a template, and amplifying a linearized fragment of pHY300PLK by PCR; the in-fusion seamless connection of the linearized fragments of the genes pfa and pHY300PLK is carried out to obtain a connection product 1; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product 1 to obtain a transformation product 1; the transformed product 1 was spread on LB solid medium (containing 100. mu.g.mL)^-1Ampicillin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 1; and selecting the transformant 1, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, performing enzyme digestion verification and sequencing verification, and obtaining the successfully converted recombinant plasmid pHY300PLK-pfa after verification.

P5 and P6 are used as primers (the primers can be seen in table 1 specifically), a recombinant plasmid pHY300PLK-pfa is used as a template, and the gene pfa with Nde I and EcoR I enzyme cutting sites connected to two ends is obtained through PCR amplification; carrying out restriction enzyme digestion on genes pfa and pMDTM19-T plasmids with two ends respectively connected with Nde I enzyme digestion sites and EcoR I enzyme digestion sites by restriction enzymes Nde I and EcoR I, and then connecting the genes pfa and the pMDTM19-T plasmids by T4 ligase to obtain a connection product 2; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product 2 to obtain a transformation product 2; the transformed product 2 was spread on LB solid medium (containing 30. mu.g.mL)^-1Kanamycin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 2; and (3) selecting the transformant 2, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, performing enzyme digestion verification and sequencing verification, and obtaining the successfully transformed recombinant plasmid pMDTM19T-pfa after verification is correct.

Extracting recombinant plasmid pMDTM19T-pfa in transformant 2 by a plasmid small-amount extraction kit; the recombinant plasmid pMDTM19T-pfa and pBE-S plasmid are cut by restriction enzymes Nde I and EcoR I and then are connected by T4 ligase to obtain a connection product3; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product 3 to obtain a transformation product 3; the transformed product 3 was spread on LB solid medium (containing 100. mu.g.mL)^-1Ampicillin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 3; and selecting a transformant 3, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, performing enzyme digestion verification and sequencing verification, and obtaining the successfully converted recombinant plasmid pBES-pfa after verification is correct.

P7 and P8 are used as primers (the primers can be seen in Table 1 specifically), recombinant plasmid pBES-pfa is used as a template, and a pBES-pfa linearized fragment without a signal peptide is amplified by PCR; seamlessly connecting gene SP DNA (deoxyribonucleic acid) mixture coding different signal peptides with a pBES-pfa linearized vector fragment without the signal peptide (the gene SP DNA mixture coding different signal peptides is prepared In a signal peptide screening kit B. subtilis calibration Protein Expression System, and 173 strips) by In-Fusion (the molar ratio of the gene fragment to the vector fragment is required to be between 3:1 and 10: 1), and obtaining a connection product 4; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product 4 to obtain a transformation product 4; the transformed product 4 was spread on LB solid medium (containing 100. mu.g.mL)^-1Ampicillin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 4; and selecting a transformant 4, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, performing enzyme digestion verification and sequencing verification, and obtaining the successfully converted recombinant plasmid pBES-sp-pfa carrying different signal peptides by verifying correctness.

Transforming the recombinant plasmid pBES-sp-pfa carrying different signal peptides into Bacillus subtilis RIK1285 to obtain recombinant Bacillus subtilis RIK1285 carrying different signal peptides; recombinant Bacillus subtilis RIK1285 carrying different signal peptides is spread on LB solid medium (containing 30 mug. multidot.mL)^-1Kanamycin) is inversely cultured in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a single colony; taking recombinant Bacillus subtilis RIK1285 carrying recombinant plasmid pBES-pfa as blank control, selecting the recombinant Bacillus subtilis RIK1285 carrying recombinant plasmid pBES-pfaSingle colonies of recombinant Bacillus subtilis RIK1285 with the same signal peptide were inoculated into each well containing 600. mu.L of LB liquid medium (containing 30. mu.g. mL)^-1Kanamycin) in a 96-well plate, culturing for 8-12 h in a constant temperature shaking table at 37 ℃, and then transferring to a TB liquid medium (containing 30 mu g/mL) containing 600 mu L of TB per well^-1Kanamycin) in a 96-well plate, and culturing for 60 hours in a constant-temperature shaking table at 37 ℃ to obtain fermentation liquor; centrifuging the fermentation liquor, taking the supernatant, measuring the absorbance of the supernatant at 540nm according to an ultrahigh-temperature alpha-amylase enzyme activity measuring method, and performing primary screening (the higher the absorbance is, the higher the enzyme activity is), wherein 1152 strains are screened in total; repeating the primary screening operation, and re-screening the strains obtained by primary screening to obtain 288 strains; performing shake flask fermentation verification on 10 strains with better enzyme activity obtained by re-screening, selecting 6 strains with highest enzyme activity for signal peptide sequencing, wherein the results show that the 6 strains carry three signal peptides, and the amino acid sequences of the 6 strains with the enzyme activities arranged from high to low, which carry the signal peptides, are respectively shown as SEQ ID No.1, SEQ ID No.7 and SEQ ID No. 8; wherein, the signal peptide of SEQ ID No.1, which has the amino acid sequence shown in SEQ ID No.1, is different from the first 173 signal peptides, and may be mutated.

Selecting strains corresponding to the 3 signal peptides, respectively taking P9, P10, P11 and P12 as primers (the primers can be seen in Table 1 specifically), respectively taking recombinant bacillus subtilis carrying the signal peptides with amino acid sequences shown as SEQ ID No.1, SEQ ID No.7 and SEQ ID No.8 as a template, and respectively amplifying nucleotide sequences of the signal peptides with amino acid sequences shown as SEQ ID No.1, SEQ ID No.7 and SEQ ID No.8 and gene pfa of coding ultra-high temperature alpha-amylase by colony PCR to obtain target genes 1-3; taking P3 and P13 as primers (the primers can be seen in Table 1 specifically), taking pHY300PLK plasmid as a template, and amplifying a linearized fragment of pHY300PLK by PCR; seamlessly connecting the target genes 1-3 and the linearized fragment of pHY300PLK through in-fusion to obtain a connection product 5-7; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product 5-7 to obtain a transformation product 5-7; the transformation products 5-7 are spread on LB solid medium (containing 100. mu.g.mL)^-1Ampicillin) and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain transformants 5-7; pickInoculating transformants 5-7 into an LB liquid culture medium, performing shake-flask culture at 37 ℃ and 200rpm for 8-12 h, extracting plasmids, performing enzyme digestion verification and sequencing verification, and obtaining recombinant plasmids pHY300 PLK-AspB' -pfa, pHY300PLK-YfhK-pfa and pHY300PLK-aprE-pfa which are successfully converted and respectively carry signal peptides with amino acid sequences shown as SEQ ID No.1, SEQ ID No.7 and SEQ ID No.8 after verification.

The recombinant plasmid pHY300PLK-pfa (containing original signal peptide amyE) and recombinant plasmids pHY300PLK-AspB '-pfa, pHY300PLK-YfhK-pfa and pHY300PLK-aprE-pfa carrying signal peptides with amino acid sequences shown in SEQ ID No.1, SEQ ID No.7 and SEQ ID No.8 respectively are transformed into Bacillus subtilis WS9 to obtain recombinant Bacillus subtilis B.subtilis WS9/pHY300PLK-pfa and recombinant Bacillus subtilis WS9/pHY300 PLK-AspB' -pfa, pHB.subtilis WS 9/Y300 PLK-YfhK-pfa and pHY 24-AspB-pHWS 9/PRB carrying signal peptides with amino acid sequences shown in SEQ ID No.1, SEQ ID No.7 and SEQ ID No.8 respectively.

Recombinant Bacillus subtilis WS9/pHY300PLK-pfa, B.subtilis WS9/pHY300 PLK-AspB' -pfa, B.subtilis WS9/pHY300PLK-YfhK-pfa, and B.subtilis WS9/pHY300PLK-aprE-pfa were applied to LB solid medium (containing 20. mu.g/mL) respectively^-1Tetracycline), culturing for 8-12 h in a constant-temperature incubator at 37 ℃ to obtain a single colony; single colonies were picked and inoculated into LB liquid medium (containing 20. mu.g. mL)^-1Tetracycline), then switching to a constant-temperature shaking table at 37 ℃ for fermentation for 60 hours to obtain a fermentation liquid, and detecting the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquid, wherein the detection result is as follows:

the enzyme activity of the ultrahigh temperature alpha-amylase in the fermentation broth obtained by fermenting the recombinant bacillus subtilis B.subtilis WS9/pHY300PLK-pfa, B.subtilis WS9/pHY300 PLK-AspB' -pfa, B.subtilis WS9/pHY300PLK-YfhK-pfa and B.subtilis WS9/pHY300PLK-aprE-pfa is respectively 18.33U/mL, 119.01U/mL, 60.73U/mL and 3.8U/mL. It can be seen that the signal peptide (nucleotide sequence shown in SEQ ID No. 2) carried by the recombinant Bacillus subtilis WS9/pHY300PLK-AspB '-pfa and having the amino acid sequence shown in SEQ ID No.1 has the best effect of promoting the expression of the hyperthermal alpha-amylase, but the signal peptide sequence is a new signal peptide and only consists of 9 amino acids (MKLAITAKA), and the signal peptide is presumed to be mutated by deleting the middle 13 amino acids from the signal peptide AspB (MKLAKRVSALTPSTTLAITAKA), so that the signal peptide is named AspB'.

TABLE 1 primers and their nucleotide sequences

Note: the restriction sites and protecting bases are underlined.

Example 2: preparation of recombinant Bacillus subtilis

The method comprises the following specific steps:

1. preparation of recombinant Bacillus subtilis WS9/pHY300 PLK-prsA-AspB' -pfa

Amplifying a linearized fragment of pHY300PLK plasmid carrying a gene encoding chaperone PrsA by PCR using P3 and P4 as primers (see Table 2 for specific primers) and pHY300PLK plasmid carrying the gene encoding chaperone PrsA as a template; seamlessly connecting the linearized fragment of pHY300PLK plasmid carrying the gene encoding the molecular chaperone PrsA with the target gene 1 obtained in example 1 by in-fusion to obtain a ligation product; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product to obtain a transformation product 1; the transformed product 1 was spread on LB solid medium (containing 100. mu.g.mL)^-1Ampicillin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 1; selecting a transformant 1, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, and performing enzyme digestion verification (the enzyme digestion verification result is shown in figure 1) and sequencing verification to obtain a successfully-transformed recombinant plasmid pHY300 PLK-prsA-AspB' -pfa after verification is correct; transforming the recombinant plasmid pHY300 PLK-prsA-AspB' -pfa into recombinant Bacillus subtilis WS9 to obtain a transformation product 2; will transform into productsProduct 2 was spread on LB solid medium (20. mu.g/mL)^-1Tetracycline), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 2; and (3) selecting the transformant 2, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, performing enzyme digestion verification, and obtaining the successfully transformed recombinant bacillus subtilis B.subtilis WS9/pHY300 PLK-prsA-AspB' -pfa after verification.

TABLE 2 primers and their nucleotide sequences

Primer and method for producing the same	Nucleotide sequence (5 '-3')
		P3	AAGCTTGGTAATAAAAAAACACCTCC(SEQIDNo.11)
P4	TTCAGCACTCGCAGCCGC(SEQIDNo.12)

2. Preparation of recombinant Bacillus subtilis WS9din gamma/pHY 300 PLK-prsA-AspB' -pfa

Synthesizing a gene (nucleotide sequence is shown as SEQ ID No.5 and is derived from Pyrococcus furiosus) for coding a molecular chaperone pfefoldin gamma; connecting the gene coding the molecular chaperone pfefoldin gamma with the genes coding the xylose promoter Pxyl (SEQ ID No.22) and the terminator (SEQ ID No.23) to obtain a gene expression cassette of the molecular chaperone pfefoldin gamma; the large fragment pBES-din gamma of the gene expression cassette of the molecular chaperone pfefoldin gamma is obtained by in-fusion seamless connection of the gene expression cassette of the molecular chaperone pfefoldin gamma and a pBE-S vector; sequentially connecting an amyE upstream homologous repair arm (887bp, SEQ ID No.24), a large fragment pBES-din gamma of a gene expression cassette of a molecular chaperone pfefoldin gamma and an amyE downstream homologous repair arm (851bp, SEQ ID No.25) through overlapping PCR (polymerase chain reaction) to obtain a gene expression cassette of the molecular chaperone pfefoldin gamma with the upstream and downstream homologous repair arms; a gene expression cassette containing a cas9 gene, sgRNA, a PE194 temperature-sensitive replication origin, a p15A escherichia coli replication origin, a resistance marker gene and the like is replaced to the position of an amyE gene of a gene knockout plasmid pHYcas9damy through in-fusion seamless connection by taking a gene knockout plasmid pHYcas9damy (described in the reference of Zhang kang, transformation of a bacillus subtilis strain, promoter optimization and efficient preparation research of pullulanase, university of south Jiangnan, 2018) as a framework, so as to obtain a gene editing plasmid pHYcas9din gamma.

Transforming the gene editing plasmid pHYcas9din gamma into Bacillus subtilis WS9 to obtain a transformation product; the transformed product was spread on LB solid medium (containing 20. mu.g.mL)^-1Tetracycline), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 1; performing colony PCR (colony PCR conditions: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 1kb/min, and 30 cycles) by using the genome of the transformant 1 as a template, amplifying homologous repair fragments, and performing nucleic acid electrophoresis on a PCR product because the length of the homologous repair fragments of correctly inserted genes is different from that of homologous repair fragments of uninserted genes; and (3) streaking the transformant which is verified by PCR on an LB solid culture medium, culturing for 10h at 51 ℃ to eliminate gene editing plasmids, then performing colony PCR verification on plasmid sterilizing bacteria (the electrophoresis result is shown in figure 2), and performing sequencing verification on a PCR product to obtain the Bacillus subtilis B.subtilis WS9din gamma which is correctly inserted with the gene coding the molecular chaperone pfoldin gamma in the genome of the Bacillus subtilis WS 9.

Transforming the recombinant plasmid pHY300 PLK-prsA-AspB' -pfa obtained in the example 1 into recombinant Bacillus subtilis WS9din gamma to obtain a transformation product; the transformed product was spread on LB solid medium (containing 20. mu.g.mL)^-1Tetracycline), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 2; selecting transformant 2, inoculating it into LB liquid mediumCarrying out shake flask culture at 37 ℃ and 200rpm for 8-12 h, extracting plasmids, carrying out enzyme digestion verification, and obtaining the successfully transformed recombinant bacillus subtilis WS9din gamma/pHY 300 PLK-prsA-AspB' -pfa after verification.

3. Preparation of recombinant Bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa

Synthesizing a gene (the nucleotide sequence is shown as SEQ ID No.6 and is derived from Pyrococcus furiosus) for coding a molecular chaperone PPlase; connecting genes of a xylose promoter Pxyl (SEQ ID No.22) and a terminator (SEQ ID No.23) which are coded by the genes of the molecular chaperone PPlase to obtain a gene expression cassette of the molecular chaperone PPlase; the gene expression box of the molecular chaperone PPase and a pBE-S carrier are connected in an in-fusion seamless manner to obtain a large fragment pBES-PPase of the gene expression box of the molecular chaperone PPase; sequentially connecting an amyE upstream homologous repair arm (887bp, SEQ ID No.24), a large fragment pBES-PPlase of a gene expression cassette of the molecular chaperone PPlase and an amyE downstream homologous repair arm (851bp, SEQ ID No.25) through overlapping PCR to obtain a gene expression cassette of the molecular chaperone PPlase with an upstream homologous repair arm and a downstream homologous repair arm; a gene expression cassette of molecular chaperone PPlase with upstream and downstream homologous repair arms is replaced to the amyE gene of a gene knockout plasmid pHYcas9damy through in-fusion seamless connection by taking a gene knockout plasmid pHYcas9damy (described in the reference of Zhang kang, transformation of a bacillus subtilis strain, optimization of a promoter and efficient preparation research of pullulanase, university of south Jiangnan, 2018, and the like which contain a cas9 gene, sgRNA, PE194 temperature sensitive replication origin, p15A escherichia coli replication origin, a resistance marker gene and the like) as a framework to obtain a gene editing plasmid pHYcas9 PPlase.

Transforming the gene editing plasmid pHYcas9PPlase into Bacillus subtilis WS9 to obtain a transformation product; the transformed product was spread on LB solid medium (containing 20. mu.g.mL)^-1Tetracycline), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 1; colony PCR (colony PCR conditions: pre-denaturation at 94 ℃ for 4 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 5s, extension at 72 ℃ for 1kb/min, 30 cycles) was carried out using the genome of transformant 1 as a template to amplify homologous repair fragments due to the identity of the correctly inserted geneThe length of the source repair segment is different from the length of the homologous repair segment without the inserted gene, and the PCR product is subjected to nucleic acid electrophoresis; and (3) streaking the transformant which is verified by PCR on an LB solid culture medium, culturing for 10h at 51 ℃ to eliminate gene editing plasmids, then performing colony PCR verification on plasmid sterilization bacteria (the electrophoresis result is shown in figure 3), and performing sequencing verification on a PCR product to obtain the Bacillus subtilis B.subtilis WS9 PPase which is correctly inserted with the gene coding the molecular chaperone PPase in the genome of the Bacillus subtilis WS 9.

The recombinant plasmid pHY300 PLK-prsA-AspB' -pfa obtained in the example 1 is transformed into recombinant Bacillus subtilis WS9PPlase to obtain a transformed product; the transformed product was spread on LB solid medium (containing 20. mu.g.mL)^-1Tetracycline), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant 2; and selecting the transformant 2, inoculating the transformant into an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 200rpm, extracting plasmids, performing enzyme digestion verification, and obtaining the successfully transformed recombinant bacillus subtilis B.subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa after verification.

Example 3: preparation of ultra-high temperature alpha-amylase

The method comprises the following specific steps:

the recombinant Bacillus subtilis B.subtilis WS9/pHY300PLK-pfa, B.subtilis WS9/pHY300PLK-AspB ' -pfa, B.subtilis WS9/pHY300PLK-prsA-AspB ' -pfa, B.subtilis WS9din gamma/pHY 300PLK-prsA-AspB ' -pfa, B.subtilis WS9 PPase/pHY 300PLK-prsA-AspB ' -pfa obtained in example 1 and example 2 were dipped from a glycerin tube and applied to a solid medium (containing 20. mu.g.mL of the bacterial solution of the recombinant Bacillus subtilis WS9/pHY300PLK-prsA-AspB ' -pfa)^-1Tetracycline) streaking, and culturing at 37 ℃ for 8-12 h to obtain a single colony; selecting single colonies, respectively inoculating the single colonies into 10mL LB liquid culture medium, and culturing at 37 ℃ and 200rpm for 10h to obtain seed liquid; the seed solution was inoculated into 50mL of TB liquid medium (containing 20. mu.g.mL) at an inoculum size of 5% (v/v)^-1Tetracycline), culturing at 37 ℃ and 200rpm for 60 hours to obtain fermentation liquor; detecting the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquor, wherein the detection result is as follows:

recombinant bacillus subtilis WS9/pHY300PLK-pfa, B.subtilis WS9/pHY300PLK-AspB '-pfa, B.subtilis WS9/pHY300 PLK-prsA-AspB' -pfa, B.subtilis WS9din gamma/pHY 300PLK-prsA-AspB '-pfa, and B.subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa have enzyme activities of 18.33U/mL, 119.01U/mL, 134.15U/mL, 137.30U/mL and 150.38U/mL respectively in fermentation broth obtained by ultrahigh temperature fermentation. Therefore, the yield of the ultrahigh-temperature alpha-amylase produced by fermenting the recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa is the highest.

Example 4: influence of heat treatment on yield of ultrahigh-temperature alpha-amylase produced by fermentation of recombinant bacillus subtilis WS9PPlase/pHY300PLK-prsA-sp-pfa

The method is characterized in that fermentation liquor obtained by fermenting the recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa obtained in example 3 is taken as crude enzyme liquid, and the influence of heat treatment on the yield of the ultrahigh-temperature alpha-amylase produced by fermenting the recombinant bacillus subtilis WS9PPlase/pHY300PLK-prsA-sp-pfa is examined, and the method specifically comprises the following steps:

single colonies of the recombinant Bacillus subtilis B.subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa obtained in example 3 were picked and inoculated onto LB liquid medium (containing 20. mu.g. mL)^-1Tetracycline), culturing for 10h at 37 ℃ to obtain a seed solution; the seed solution was inoculated into 50mL of a liquid medium (containing 20. mu.g.mL) containing 50mL of a seed solution at an inoculation amount of 5% (v/v)^-1Tetracycline), culturing at 37 ℃ and 200rpm for 120h to obtain fermentation liquor; in the fermentation process, the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation liquor is detected at intervals, and the detection result is shown in figure 4.

As can be seen from FIG. 4, as the shake flask fermentation time is prolonged, the higher the enzyme activity of the hyperthermal alpha-amylase in the fermentation broth obtained by fermenting the recombinant Bacillus subtilis B.subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa, the property may be that part of the protein in the Bacillus subtilis is not sufficiently correctly folded, and the part of the protein is slowly folded and secreted out of the cell during the shake flask fermentation at 37 ℃ (usually the optimum fermentation time of the Bacillus subtilis host as an expression host for other heterologous proteins is 48-60 h). Through the same experiment, the recombinant bacillus subtilis WS9/pHY300PLK-prsA-AspB ' -pfa, B.subtilis WS9din gamma/pHY 300PLK-prsA-AspB ' -pfa and the recombinant bacillus subtilis WS9 PPase/pHY 300PLK-prsA-AspB ' -pfa have similar fermentation phenomena, namely, the enzyme activity of the ultrahigh temperature alpha-amylase in the fermentation liquor is gradually increased along with the extension of the shake flask fermentation time (less than or equal to 300 h).

And when fermenting for 72 hours, taking part of recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa to ferment to obtain fermentation liquor (containing thalli) and carrying out heat treatment for 10min to 1.5 hours at the temperature of 80-100 ℃, centrifuging to obtain supernatant, and detecting the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation supernatant before and after the heat treatment.

According to the detection result, the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation supernatant can be obviously improved by heat treatment, wherein the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation supernatant is improved most obviously when the heat treatment condition is 90 ℃ and 15min, and is improved to 1682.98U/mL from 402.58U/mL before heat treatment.

And when the fermentation is carried out for 120h, taking part of the recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa, carrying out heat treatment on fermentation liquor (containing thalli) obtained by fermentation at 80-100 ℃ for 10 min-1.5 h, centrifuging, taking supernatant, and detecting the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation supernatant before and after the heat treatment.

According to the detection result, the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation supernatant can be obviously improved by heat treatment, wherein the enzyme activity of the ultrahigh-temperature alpha-amylase in the fermentation supernatant is improved most obviously when the heat treatment condition is 90 ℃ and 15min, and is improved to 1837.96U/mL from 676.83U/mL before heat treatment.

When fermenting for 120h, taking 1mL of fermentation liquor (containing thalli) obtained by fermenting recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa, and centrifuging to obtain thalli; adding 1mL of deionized water into the thalli to suspend the thalli to obtain an aqueous suspension; and (3) carrying out heat treatment on the aqueous suspension at 90 ℃ for 15min, centrifuging to obtain a supernatant, and detecting the enzyme activity of the ultrahigh-temperature alpha-amylase in the supernatant of the aqueous suspension before and after the heat treatment.

According to the detection result, the enzyme activity of the ultrahigh-temperature alpha-amylase in the water suspension supernatant can be obviously improved through heat treatment, so that the enzyme activity of the ultrahigh-temperature alpha-amylase in the water suspension supernatant is improved to 1507.42U/mL from 0U/mL before heat treatment.

In conclusion, the heat treatment can effectively promote the extracellular soluble expression of the ultrahigh-temperature alpha-amylase in the recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa.

Example 5: enzymatic Properties of ultra high temperature alpha-Amylases

Taking the fermentation broth obtained by fermenting the recombinant bacillus subtilis WS9PPlase/pHY300PLK-prsA-AspB '-pfa obtained in example 3 as a crude enzyme solution, and examining the enzymatic properties of the ultrahigh-temperature alpha-amylase obtained by fermenting the recombinant bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa, the specific steps are as follows:

1. optimum temperature of ultra-high temperature alpha-amylase

Respectively measuring the enzyme activity of the alpha-amylase at the ultra-high temperature in the crude enzyme solution under the conditions of 40 ℃, 50 ℃, 60 ℃, 70 ℃, 80 ℃, 90 ℃ and 100 ℃, setting the highest enzyme activity as 100%, and comparing the other enzyme activities with the highest enzyme activity to calculate the relative enzyme activity so as to investigate the optimal action temperature of the enzyme (the detection result is shown in figure 5);

as shown in FIG. 5, the optimum temperature of the hyperthermal alpha-amylase obtained by fermentation of recombinant Bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa was 100 ℃.

2. Optimum pH of ultra-high temperature alpha-amylase

Preparing citric acid-sodium citrate buffer solutions with pH values of 4.5, 5.0, 5.5, 6.0, 6.5 and 7.0 respectively to replace buffer solutions in the method for measuring the enzyme activity of the ultrahigh-temperature alpha-amylase, measuring the enzyme activity of the ultrahigh-temperature alpha-amylase in the crude enzyme solution at 100 ℃, and calculating the relative enzyme activity by taking the highest enzyme activity as 100% and comparing the other enzyme activities with the highest enzyme activity to investigate the optimum action pH of the enzyme (the detection result is shown in figure 6);

as shown in FIG. 6, the optimum pH of the hyperthermal alpha-amylase obtained by fermentation of recombinant Bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa was 5.0.

3. Temperature stability of ultra high temperature alpha-amylase

And (3) preserving the temperature of the crude enzyme solution at 90 ℃, 100 ℃ and 110 ℃ for 0h, 1h, 2h, 3h and 4h, taking out the crude enzyme solution, rapidly cooling, measuring the enzyme activity of the ultra-high temperature alpha-amylase in the crude enzyme solution under the conditions that the pH is 5.0 and the temperature is 100 ℃, and calculating the residual enzyme activity by comparing the enzyme activity after heat preservation with the initial enzyme activity of 100 percent to examine the temperature stability (the detection result is shown in figure 7).

As can be seen from FIG. 7, the temperature stability of the ultra-high temperature alpha-amylase obtained by fermenting recombinant Bacillus subtilis WS9PPlase/pHY300 PLK-prsA-AspB' -pfa is good, 76.30% of relative enzyme activity is still remained after heat preservation is carried out for 4 hours at 90 ℃, and 67.98% of relative enzyme activity is still remained after heat preservation is carried out for 4 hours at 100 ℃.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of south of the Yangtze river

<120> a signal peptide and its use in producing alpha-amylase

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 9

<212> PRT

<213> Artificial sequence

<400> 1

Met Lys Leu Ala Ile Thr Ala Lys Ala

1 5

<210> 2

<211> 27

<212> DNA

<213> Artificial sequence

<400> 2

atgaaactgg caatcacagc gaaagcg 27

<210> 3

<211> 1308

<212> DNA

<213> Artificial sequence

<400> 3

gccaaatact tagaactcga agagggcggt gttataatgc aagcattcta ttgggatgtt 60

ccaggaggcg gaatctggtg ggaccacatc agaagcaaga ttcctgaatg gtacgaggcc 120

ggcataagcg ccatctggct gccacctcct tctaaaggaa tgagtggagg atatagtatg 180

gggtacgacc catacgacta ctttgacctg ggtgaatatt atcagaaagg cacagtagag 240

acacgctttg gatcaaagga ggaattagtt cggttgattc aaacagctca tgcttatggg 300

attaaggtta tcgccgatgt ggttatcaac catagagctg gaggcgatct tgaatggaac 360

ccattcgttg gtgattatac atggacagat ttttctaagg ttgcttctgg aaagtatact 420

gcgaactact tggacttcca cccaaatgag cttcactgtt gtgacgaggg tacctttggt 480

gggttcccgg atatatgtca ccacaaggag tgggatcaat actggctttg gaaatcaaac 540

gaatcttacg cggcatattt acggagcata gggttcgacg ggtggcgttt cgactacgtg 600

aagggatacg gtgcttgggt ggttcgcgac tggctgaact ggtggggagg ttgggcagtc 660

ggagagtatt gggacacgaa cgttgacgct ttgctttcct gggcttacga gagcggtgca 720

aaggtctttg actttccact ttattataag atggacgagg cttttgataa caataatatt 780

cctgcattag tatacgcgtt acaaaacggt cagacggttg taagcagaga tccattcaag 840

gcagttacat ttgtcgccaa ccatgatacg gacatcattt ggaacaagta ccctgcctac 900

gcatttatct taacttacga gggtcaacca gtaattttct atagagattt tgaagaatgg 960

ttgaacaagg ataaacttat taacctcatc tggatacacg accacctggc tggtgggtcc 1020

acgacaatag tctactacga caacgatgag ttaatctttg ttcggaacgg agattcccgc 1080

cgcccaggtt taatcactta cataaatctg tcccctaact gggtggggcg ttgggtgtat 1140

gtcccgaaat ttgcaggtgc ctgtatacat gagtatactg gcaatcttgg aggctgggta 1200

gataaacgtg ttgacagtag tggatgggtt tacttggagg ctccgccgca tgatcctgcc 1260

aacgggtact atggatattc cgtgtggtca tattgcgggg tagggtaa 1308

<210> 4

<211> 879

<212> DNA

<213> Artificial sequence

<400> 4

atgaagaaaa tcgcaatagc agctatcact gctacaagca tcctcgctct cagtgcttgc 60

agcagcggcg acaaagaagt tatcgcaaaa acagacgcag gcgatgtcac aaaaggcgag 120

ctttacacaa acatgaagaa aacagctggc gcaagcgtac tgacacagct agtgcaagaa 180

aaagtattgg acaagaagta taaagtttcg gataaagaaa ttgacaacaa gctgaaagaa 240

tacaaaacgc agcttggcga tcaatatact gccctcgaaa agcaatatgg caaagattac 300

ctgaaagaac aagtaaaata tgaattgctg acacaaaaag cggctaaaga taacatcaaa 360

gtaacagacg ccgatatcaa agagtactgg gaaggcttaa aaggcaaaat ccgtgcaagc 420

cacatccttg ttgctgataa aaagacagct gaagaagtag agaaaaagct gaaaaaaggc 480

gagaagtttg aagaccttgc gaaagaatac tcaacagaca gctctgcttc aaaaggcggg 540

gatcttggct ggttcgcaaa agaaggccaa atggacgaaa cattcagcaa agctgcattc 600

aaattaaaaa caggtgaagt cagtgatcct gtcaaaacgc aatacggcta ccatatcatt 660

aaaaagacag aagaacgcgg caaatatgat gatatgaaaa aagaactgaa atctgaagtg 720

cttgaacaaa aattaaatga caacgcagct gttcaggaag ctgttcaaaa agtcatgaag 780

aaggctgaca tcgaagtaaa agataaagat ctgaaagaca catttaatac atcttcaaca 840

agcaacagca cttcttcatc ttcaagcaat tctaaataa 879

<210> 5

<211> 441

<212> DNA

<213> Artificial sequence

<400> 5

atggtcaatg aagttattga catcaatgaa gcagttcgtg cgtatatcgc gcaaatcgaa 60

ggattacggg cggaaattgg ccgccttgat gcgacgattg caacgttacg ccaatcatta 120

gcgacactta aatcacttaa aacattagga gaaggcaaaa cggtgttagt cccggtgggc 180

tctattgcac aagtcgaaat gaaagtggaa aaaatggata aagtggttgt gagcgtcggc 240

caaaatatct cagcggaact ggaatatgaa gaagcactta aatatatcga agatgaaatt 300

aaaaaactgc tgacgtttag acttgtcctg gaacaagcga ttgcagaact gtatgcgaaa 360

atcgaggacc tgatcgcgga agcacaacaa acgtctgaag aagaaaaagc agaagaagaa 420

gaaaatgaag aaaaagcgga a 441

<210> 6

<211> 774

<212> DNA

<213> Artificial sequence

<400> 6

atgaaagtcg aaaaaggaga tgtcattcgt ctgcattata cgggcaaagt caaagaaaca 60

ggcgaaatct ttgatacgac ctacgaagat gttgcgaaag aagcacgtat ctataatcct 120

aatggcatct atggacctgt ccctattgca gtgggagcag gacatgtgtt accgggactg 180

gataaacgcc ttatcggcct ggaagtcaaa aaaaaatatg tgatcgaagt gccgccggaa 240

gaaggctttg gcttgcgtga tcctggcaaa attaaaatta ttcctctggg caaatttcgc 300

aaatcaggca ttattccgta tccgggctta gaaattgaag tcgaaacgga aaatggccgt 360

aaaatgcggg gtcgtgtgct gacggtctca ggaggccgcg tgagagtgga ttttaatcat 420

ccgttagcag gcaaaacgtt ggtgtatgaa gtggaagttg tcgaaaaaat cgaagatccg 480

attgaaaaaa tcaaagcgct gattgaactg cggttaccga tgatcgataa agataaagtc 540

atcatcgaaa ttagcgaaaa agatgtcaaa cttaatttta aagatgtgga tattgatcct 600

aaaacactta ttcttggcga aattctgtta gaatcagatc ttaaatttat cggctatgaa 660

aaagtggaat ttgaaccgac gattgaagaa ctgcttaaac ctaaatcagc ggaagaacaa 720

gaatcaccta atgaagaaca acaagaagaa tctgaatcta aagcggaaga atct 774

<210> 7

<211> 29

<212> PRT

<213> Artificial sequence

<400> 7

Met Lys Lys Lys Gln Val Met Leu Ala Leu Thr Ala Ala Ala Gly Leu

1 5 10 15

Gly Leu Thr Ala Leu His Ser Ala Pro Ala Ala Lys Ala

20 25

<210> 8

<211> 29

<212> PRT

<213> Artificial sequence

<400> 8

Val Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu

1 5 10 15

Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala

20 25

<210> 9

<211> 43

<212> DNA

<213> Artificial sequence

<400> 9

gctgcgagtg ctgaaatggc caaatactta gaactcgaag agg 43

<210> 10

<211> 36

<212> DNA

<213> Artificial sequence

<400> 10

tttattacca agcttttacc ctaccccgca atatga 36

<210> 11

<211> 26

<212> DNA

<213> Artificial sequence

<400> 11

aagcttggta ataaaaaaac acctcc 26

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence

<400> 12

ttcagcactc gcagccgc 18

<210> 13

<211> 43

<212> DNA

<213> Artificial sequence

<400> 13

ccactggaat tccatatggc caaatactta gaactcgaag agg 43

<210> 14

<211> 36

<212> DNA

<213> Artificial sequence

<400> 14

gttgaccgga attcttaccc taccccgcaa tatgac 36

<210> 15

<211> 18

<212> DNA

<213> Artificial sequence

<400> 15

gcggccggtg cacatatg 18

<210> 16

<211> 19

<212> DNA

<213> Artificial sequence

<400> 16

acgcgtccct ctccttttg 19

<210> 17

<211> 41

<212> DNA

<213> Artificial sequence

<400> 17

tcaaataagg agtgtcaaga atgaaactgg caatcacagc g 41

<210> 18

<211> 46

<212> DNA

<213> Artificial sequence

<400> 18

tcaaataagg agtgtcaaga atgaaaaaga aacaagtaat gctcgc 46

<210> 19

<211> 44

<212> DNA

<213> Artificial sequence

<400> 19

tcaaataagg agtgtcaaga gtgagaagca aaaaattgtg gatc 44

<210> 20

<211> 42

<212> DNA

<213> Artificial sequence

<400> 20

gtttttttat taccaagctt ttaccctacc ccgcaatatg ac 42

<210> 21

<211> 27

<212> DNA

<213> Artificial sequence

<400> 21

tcttgacact ccttatttga ttttttg 27

<210> 22

<211> 1433

<212> DNA

<213> Artificial sequence

<400> 22

atcaacgtga tataggtttg ctaacctttg cgttcactta actaacttat aggggtaaca 60

cttaaaaaag aatcaataac gatagaaacc gctcctaaag caggtgcatt ttttcctaac 120

gaagaaggca atagttcaca tttattgtct aaatgagaat ggactctaga agaaacttcg 180

tttttaatcg tatttaaaac aatgggatga gattcaatta tatgatttct caagataaca 240

gcttctatat caaatgtatt aaggatattg gttaatccaa ttccgatata aaagccaaag 300

ttttgaagtg catttaacat ttctacatca tttttatttg cgcgttccac aatctctttt 360

cgagaaatat tcttttcttc tttagagagc gaagccagta acgctttttc agaagcatat 420

aattcccaac agcctcgatt tccacagctg catttgggtc cattaaaatc tatcgtcata 480

tgacccattt ccccagaaaa accctgaaca cctttataca attcgttgtt aataacaagt 540

ccagttccaa ttccgatatt aatactgatg taaacgatgt tttcatagtt ttttgtcata 600

ccaaatactt tttcaccgta tgctcctgca ttagcttcat tttcaacaaa aaccggaaca 660

ttaaactcac tctcaattaa aaactgcaaa tctttgatat tccaatttaa gttaggcatg 720

aaaataattt gctgatgacg atctacaagg cctggaacac aaattcctat tccgactaga 780

ccataagggg actcaggcat atgggttaca aaaccatgaa taagtgcaaa taaaatctct 840

tttacttcac tagcggaaga actagacaag tcagaagtct tctcgagaat aatatttcct 900

tctaagtcgg ttagaattcc gttaagatag tcgactccta tatcaatacc aatcgagtag 960

cctgcattct tattaaaaac aagcattaca ggtcttctgc cgcctctaga ttgccctgcc 1020

ccaatttcaa aaataaaatc tttttcaagc agtgtattta cttgagagga gacagtagac 1080

ttgtttaatc ctgtaatctc agagagagtt gccctggaga caggggagtt cttcaaaatt 1140

tcatctaata ttaatttttg attcattttt tttactaaag cttgatctgc aatttgaata 1200

ataaccactc ctttgtttat ccaccgaact aagttggtgt tttttgaagc ttgaattaga 1260

tatttaaaag tatcatatct aatattataa ctaaattttc taaaaaaaac attgacataa 1320

acatttattt tgtatatgat gagataaagt tagtttattg gataaacaaa ctaactcaat 1380

taagatagtt gatggataaa cttgttcact taaatcaagg aggtgaatgt aca 1433

<210> 23

<211> 212

<212> DNA

<213> Artificial sequence

<400> 23

gagctcggta ccctcgaggg atccgaattc aagcttgtcg acctgcagtc tagacatcac 60

catcatcacc actaatgcgg tagtttatca cagttaaatt gctaacgcag tcaggcaccg 120

tgtatgaaat ctaacaatgc gctcatcgtc atcctcggca ccgtcaccct ggatgctgta 180

ggcataggct tggttatgcc ggtactgccg gg 212

<210> 24

<211> 887

<212> DNA

<213> Artificial sequence

<400> 24

ctgcgtaata gactttcagg cgtgaatggg aaaaataaga gagtaaaaga aaaagaacaa 60

aaaatctggt cggagattgg gatgatagcg ggagcatttg cgctgcttga tgtgatcatc 120

cgcggcatta tgtttgaatt tccgtttaaa gaatgggctg caagccttgt gtttttgttc 180

atcattatct tatattactg catcagggct gcggcatccg gaatgctcat gccgagaata 240

gacaccaaag aagaactgca aaaacgggtg aagcagcagc gaatagaatc aattgcggtc 300

gcctttgcgg tagtggtgct tacgatgtac gacaggggga ttccccatac attcttcgct 360

tggctgaaaa tgattcttct ttttatcgtc tgcggcggcg ttctgtttct gcttcggtat 420

gtgattgtga agctggctta cagaagagcg gtaaaagaag aaataaaaaa gaaatcatct 480

tttttgtttg gaaagcgagg gaagcgttca cagtttcggg cagctttttt tataggaaca 540

ttgatttgta ttcactctgc caagttgttt tgatagagtg attgtgataa ttttaaatgt 600

aagcgttaac aaaattctcc agtcttcaca tcggtttgaa aggaggaagc ggaagaatga 660

agtaagaggg atttttgact ccgaagtaag tcttcaaaaa atcaaataag gagtgtcaag 720

aatgtttgca aaacgattca aaacctcttt actgccgtta ttcgctggat ttttattgct 780

gtttcatttg gttctggcag gaccggcggc tgcgagtgct gaaacggcga acaaatcgaa 840

tgagcttaca gcaccgtcga tcaaaagcgg aaccattctt catgcat 887

<210> 25

<211> 851

<212> DNA

<213> Artificial sequence

<400> 25

ggtcgttcaa tacgttaaaa cacaatatga aggatattca tgatgcagga tatacagcca 60

ttcagacatc tccgattaac caagtaaagg aagggaatca aggagataaa agcatgtcga 120

actggtactg gctgtatcag ccgacatcgt atcaaattgg caaccgttac ttaggtactg 180

aacaagaatt taaagaaatg tgtgcagccg ctgaagaata tggcataaag gtcattgttg 240

acgcggtcat caatcatacc accagtgatt atgccgcgat ttccaatgag gttaagagta 300

ttccaaactg gacacatgga aacacacaaa ttaaaaactg gtctgatcga tgggatgtca 360

cgcagaattc attgctcggg ctgtatgact ggaatacaca aaatacacaa gtacagtcct 420

atctgaaacg gttcttagac agggcattga atgacggggc agacggtttt cgatttgatg 480

ccgccaaaca tatagagctt ccagatgatg gcagttacgg cagtcaattt tggccgaata 540

tcacaaatac atctgcagag ttccaatacg gagaaatcct gcaggatagt gcctccagag 600

atgctgcata tgcgaattat atggatgtga cagcgtctaa ctatgggcat tccataaggt 660

ccgctttaaa gaatcgtaat ctgggcgtgt cgaatatctc ccactatgca tctgatgtgt 720

ctgcggacaa gctagtgaca tgggtagagt cgcatgatac gtatgccaat gatgatgaag 780

agtcgacatg gatgagcgat gatgatatcc gtttaggctg ggcggtgata gcttctcgtt 840

caggcagtac g 851

Claims

1. A signal peptide, characterized in that the amino acid sequence of the signal peptide is shown in SEQ ID NO. 1.

2. A gene encoding the signal peptide of claim 1.

3. A recombinant plasmid carrying the gene of claim 2; alternatively, the recombinant plasmid carries the gene of claim 2 and a gene of interest; alternatively, the recombinant plasmid carries the gene of claim 2, a gene of interest, and a gene encoding chaperone prsA.

4. A recombinant plasmid according to claim 3 wherein the gene of interest is a gene encoding an alpha-amylase.

5. The recombinant plasmid of claim 4 wherein said α -amylase is a hyperthermophilic α -amylase.

6. The recombinant plasmid of claim 5, wherein the nucleotide sequence of the gene encoding hyperthermophilic α -amylase is represented by SEQ ID No. 3.

7. A recombinant plasmid according to any one of claims 4 to 6 wherein the nucleotide sequence of the gene encoding chaperone prsA is shown in SEQ ID No. 4.

8. A host cell carrying the recombinant plasmid of any one of claims 4 to 7; alternatively, the host cell carries the recombinant plasmid of any one of claims 4 to 7, and the gene encoding the molecular chaperone pfefoldin γ is inserted into the genome of the host cell; alternatively, the host cell carries the recombinant plasmid according to any one of claims 4 to 7, and the gene encoding the chaperone PPlase is inserted into the genome of the host cell.

9. A method for producing alpha-amylase, which comprises inoculating the host cell of claim 8 into a fermentation medium for fermentation to obtain a fermentation broth, and separating the alpha-amylase from the fermentation broth;

or, the method is that the host cell of claim 8 is inoculated to a fermentation culture medium for fermentation to obtain a fermentation liquid, then the fermentation liquid is subjected to heat treatment to obtain a heat-treated fermentation liquid, and finally the alpha-amylase is separated from the heat-treated fermentation liquid;

or, the method is to inoculate the host cell of claim 8 to a fermentation medium for fermentation to obtain a fermentation liquid, then centrifuge the fermentation liquid to obtain a thallus, then resuspend the thallus to obtain a resuspension liquid, then thermally treat the resuspension liquid to obtain a thermally treated resuspension liquid, and finally separate the alpha-amylase from the thermally treated resuspension liquid.

10. Use of a signal peptide according to claim 1 or a gene according to claim 2 or a recombinant plasmid according to any one of claims 4 to 7 or a host cell according to claim 8 or a method according to claim 9 for the production of an alpha-amylase.