CN117660272A - Method, strain and application for improving N-acetylglucosamine conversion rate and yield - Google Patents

Abstract

The invention belongs to the technical field of microorganisms, and discloses a bacterial strain for improving the conversion rate and yield of N-acetylglucosamine (GlcNAc), wherein the construction method of the bacterial strain comprises the following steps: (1) heterologously expressing a gene GNA1 encoding a GlcNAc-6P synthase; (2) knockout; (3) Heterologous expression of phosphoketolase encoding gene fxpk and inhibition of phosphofructokinase encoding gene pfkA by molecular switch. The invention utilizes CRISPR-Cas9 gene editing technology to obtain bacillus subtilis genetic engineering strain for producing N-acetylglucosamine. The molecular switch is constructed to control the expression of phosphofructokinase gene pfkA, the shake flask fermentation yield reaches 10.367g/L, and the conversion rate of glucose to GlcNAc is improved from 7.12% to 24.43%.

Description

Method, strain and application for improving N-acetylglucosamine conversion rate and yield

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a method, a strain and application for improving the conversion rate and the yield of N-acetylglucosamine.

Background

N-acetylglucosamine (GlcNAc) is an important functional monosaccharide. GlcNAc is widely used in the fields of food health care, cosmetics industry, biological medicine, etc. Research shows that GlcNAc can be used for relieving inflammatory joint diseases clinically, promoting the healing of cartilage injury, improving the digestion and absorption functions of intestinal tracts, promoting growth and regulating the growth and development of fetal hearts. GlcNAc has wide medical application prospect, and is widely focused by researchers at home and abroad, thereby becoming a research hotspot.

Currently, the main processes for producing GlcNAc are chemical, enzymatic and microbial fermentation. Among them, the chemical method has great limitations due to its severe reaction conditions, serious environmental pollution, and limited production raw materials. The enzyme is limited by high production cost and long production period, and is difficult to realize industrialized mass production. Compared with the former two methods, the microbial fermentation method for producing GlcNAc has the advantages of short fermentation period, low production cost, small environmental pollution and the like, and is widely paid attention to researchers. Therefore, microbial fermentation is currently the mainstream of industrial production of GlcNAc.

The invention discloses an engineering bacterium of escherichia coli for synthesizing N-acetylglucosamine and a fermentation production method thereof, wherein the invention improves the supply of a product precursor in chassis cells of escherichia coli by blocking the shunt of a glycolysis path and a pentose phosphate path to fructose-6-phosphate which is a precursor for synthesizing the N-acetylglucosamine, expresses key enzyme of the N-acetylglucosamine synthesis path in the chassis cells by utilizing free high-copy plasmids, and improves the yield of the N-acetylglucosamine by utilizing a mixed carbon source culture medium for fermentation. However, E.coli secretes endotoxin during fermentation, resulting in production of GlcNAc which does not meet food-grade requirements. In contrast, bacillus subtilis is a food-safe strain, and is a powerful and efficient production platform for N-acetylglucosamine.

Patent publication CN104195094A discloses a bacillus subtilis for producing N-acetylglucosamine, and a construction method and application thereof. Through gene operation in bacillus subtilis, a metabolic pathway from glucose to N-acetylglucosamine is constructed, the speed-limiting enzyme gene expression in the N-acetylglucosamine synthesis pathway is enhanced, and meanwhile, the genes causing the consumption and reflux of the N-acetylglucosamine are knocked out, so that the N-acetylglucosamine with higher concentration is accumulated, and the method has higher industrial utilization value. However, the recombinant strain of Bacillus subtilis has not been studied for the conversion rate of N-acetylglucosamine.

By contrast, the present patent application is substantially different from the above patent publications.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides a method, a strain and application for improving the conversion rate and the yield of N-acetylglucosamine.

The technical scheme adopted for solving the technical problems is as follows:

a strain for improving the conversion rate and yield of N-acetylglucosamine, the construction method of the vector comprises the following steps:

(1) Heterologous expression of GlcNAc-6P synthase encoding Gene GNA1

At amyE site, P is inserted _C2up The GlcNAc-6P synthetase coding gene GNA1 controlled by a promoter;

(2) Knock-out

Using CRISPR-Cas9 technology, performing traceless knockout on GlcNAc specific transporter genes nagP, glcNAc-6P deacetylase genes nagA and GlcN-6P deaminase genes nagBB; the gene sequence of the coding gene nagP is SEQ ID NO.4, the gene sequence of nagA is SEQ ID NO.5, and the gene sequence of nagBB is SEQ ID NO.6;

(3) Introduction of

1) Heterologous expression phosphoketolase coding gene fxpk

At the murQ site, P is inserted _C2up The phosphoketolase coding gene fxpk controlled by the promoter;

2) Inhibition of phosphofructokinase encoding gene pfkA by molecular switch

Insertion of xylO sequence into pfkA Gene locus and introduction of P _grac The gene sequence of the XyleR protein controlled by the promoter is SEQ ID NO.9, the gene sequence of the xylO locus is SEQ ID NO.10, and the gene sequence of the xylR fragment is SEQ ID NO.11.

Further, in the step (1), GNA1 is derived from Saccharomyces cerevisiae, and the gene sequence of the GNA1 fragment is SEQ ID NO.1, P _C2up The gene sequence of the promoter is SEQ ID NO.2, and the gene sequence of amyE is SEQ ID NO.3.

Further, the murQ gene sequence in the step (3) is SEQ ID NO.7, the fxpk is derived from bifidobacterium adolescentis, and the fxpk fragment gene sequence is SEQ ID NO.8, P _C2up The gene sequence of the promoter is SEQ ID NO.2.

The N-acetylglucosamine synthesis strain is obtained by transferring a vector pHT01-xylR into the vector and weakening a phosphofructokinase gene pfkA.

Use of a strain as described above for the fermentative preparation of N-acetylglucosamine.

A method for preparing N-acetylglucosamine by fermentation using the strain as described above, comprising the steps of:

shaking and fermenting: taking out the fermentation strain from the refrigerator at the temperature of minus 80 ℃, streaking on an LB solid plate, and culturing for 12 hours in an incubator at the temperature of 37 ℃; the single colony is picked up and inoculated into 4mL LB liquid medium, the temperature is 37 ℃, the rotating speed is 200rpm, and the culture is carried out for 12 hours; inoculating the bacterial liquid with 1-3% inoculation amount into 20mL LB liquid culture medium, culturing for 12h at 37 ℃ and rotating speed of 150-300 rpm; inoculating the seed solution into 75mL fermentation medium with inoculum size of 2-8%, fermenting at 37deg.C and rotation speed of 150-300rpm for 24-48 hr to obtain GlcNAc.

Further, the LB solid medium is: 10.0g/L tryptone, 5.0g/L yeast extract, 10.0g/L LNaCl, 15% agar powder.

Further, the fermentation medium is: 50-70g/L glucose, 2-4g/LKH ₂ PO ₄ 10-12g/L yeast extract, 5-8g/L pancreatic protein, 5-8g/L (NH) ₄ ) ₂ SO ₄ 、10-13g/LK ₂ HPO ₄ ·3H ₂ O and 8-10mL/L trace metal solution;

wherein, trace metal solution components include: 3-6 g/LFASO ₄ ·7H ₂ O、0.1-0.3g/L CuCl ₂ ·H ₂ O、3-6g/L CaCl ₂ 、1-3g/LMnSO ₄ ·5H ₂ O、0.1-0.3g/LAlCl ₃ ·6H ₂ O、0.3-0.5g/L CoCl ₂ ·6H ₂ O、0.03-0.05g/L H ₃ BO ₄ 、0.1-0.4g/LNa ₂ MoO ₄ ·2H ₂ O、0.1-0.4g/L ZnSO ₄ ·7H ₂ O。

The invention has the advantages and positive effects that:

1. the invention utilizes CRISPR-Cas9 gene editing technology to obtain bacillus subtilis genetic engineering strain for producing N-acetylglucosamine (GlcNAc). The molecular switch is constructed to control the expression of phosphofructokinase gene pfkA, and the shake flask fermentation yield reaches 10.367g/L.

2. According to the invention, glcNAc is produced by modifying food safety level strain bacillus subtilis, and the metabolic loss of carbon flux is reduced by carrying out genetic engineering modification, so that the conversion rate of glucose to GlcNAc is improved from 7.12% to 24.43%.

Drawings

FIG. 1 is a diagram of strain 168-GNA1 constructed in the present invention; wherein, the left image is a resistance screening plate verification image (LB+kana plate on the left and LB plate on the right), the right image is a colony PCR verification image, and M is 5000bp DNAMarker,N as negative control H ₂ O, P is a starting strain B.subtilis 168,1-3, and the transformants are verified to be No.1, no.2 and No.3 in sequence;

FIG. 2 shows the present inventionConstructed strain 168-GNA1 (nagP) map; wherein, the left image is a resistance screening plate verification image (LB+kana plate on the left and LB plate on the right), the right image is a colony PCR verification image, and M is 5000bp DNAMarker,N as negative control H ₂ O, P is a starting strain B.subtilis 168,1-3, and the transformants are verified to be No.1, no.2 and No.3 in sequence;

FIG. 3 shows 168-GNA1 (ΔnagP ΔnagA ΔnagBB murQ:: fxpkP) constructed in the present invention _pfkA xylO pHT 01-xylR) graph; wherein M is 5000bp DNAMarker,N as negative control H ₂ O, P is positive control pHT01-xylR, and 1-5 are transformant verification No.1, no.2, no.3, no.4 and No.5 in sequence;

FIG. 4 is a diagram of the shake flask fermentative synthesis of GlcNAc constructed in the present invention; wherein 168-GNA1 is a control strain, 168-GNA1 (ΔnagP ΔnagA ΔnagBB murQ:: fxpkP) _pfkA xylO pHT 01-xylR) is an engineered strain.

Detailed Description

The invention will now be further illustrated by reference to the following examples, which are intended to be illustrative, not limiting, and are not intended to limit the scope of the invention.

The various experimental operations involved in the specific embodiments are conventional in the art, and are not specifically noted herein, and may be implemented by those skilled in the art with reference to various general specifications, technical literature or related specifications, manuals, etc. before the filing date of the present invention.

A strain for improving the conversion rate and yield of N-acetylglucosamine, the construction method of the vector comprises the following steps:

(1) Heterologous expression of GlcNAc-6P synthase encoding Gene GNA1

At amyE site, P is inserted _C2up The GlcNAc-6P synthetase coding gene GNA1 controlled by a promoter;

(2) Knock-out

Using CRISPR-Cas9 technology, performing traceless knockout on GlcNAc specific transporter genes nagP, glcNAc-6P deacetylase genes nagA and GlcN-6P deaminase genes nagBB; the gene sequence of the coding gene nagP is SEQ ID NO.4, the gene sequence of nagA is SEQ ID NO.5, and the gene sequence of nagBB is SEQ ID NO.6;

(3) Introduction of

1) Heterologous expression phosphoketolase coding gene fxpk

At the murQ site, P is inserted _C2up The phosphoketolase coding gene fxpk controlled by the promoter;

2) Inhibition of phosphofructokinase encoding gene pfkA by molecular switch

Insertion of xylO sequence into pfkA Gene locus and introduction of P _grac The gene sequence of the XyleR protein controlled by the promoter is SEQ ID NO.9, the gene sequence of the xylO locus is SEQ ID NO.10, and the gene sequence of the xylR fragment is SEQ ID NO.11.

Preferably, in the step (1), the GNA1 is derived from Saccharomyces cerevisiae, and the gene sequence of the GNA1 fragment is SEQ ID NO.1, P _C2up The gene sequence of the promoter is SEQ ID NO.2, and the gene sequence of amyE is SEQ ID NO.3.

Preferably, the murQ gene sequence in the step (3) is SEQ ID NO.7, the fxpk is derived from bifidobacterium adolescentis, and the fxpk fragment gene sequence is SEQ ID NO.8, P _C2up The gene sequence of the promoter is SEQ ID NO.2.

The N-acetylglucosamine synthesis strain is obtained by transferring a vector pHT01-xylR into the vector and weakening a phosphofructokinase gene pfkA.

Use of a strain as described above for the fermentative preparation of N-acetylglucosamine.

A method for preparing N-acetylglucosamine by fermentation using the strain as described above, comprising the steps of:

shaking and fermenting: taking out the fermentation strain from the refrigerator at the temperature of minus 80 ℃, streaking on an LB solid plate, and culturing for 12 hours in an incubator at the temperature of 37 ℃; the single colony is picked up and inoculated into 4mL LB liquid medium, the temperature is 37 ℃, the rotating speed is 200rpm, and the culture is carried out for 12 hours; inoculating the bacterial liquid with 1-3% inoculation amount into 20mL LB liquid culture medium, culturing for 12h at 37 ℃ and rotating speed of 150-300 rpm; inoculating the seed solution into 75mL fermentation medium with inoculum size of 2-8%, fermenting at 37deg.C and rotation speed of 150-300rpm for 24-48 hr to obtain GlcNAc.

Preferably, the LB solid medium is: 10.0g/L tryptone, 5.0g/L yeast extract, 10.0g/L LNaCl, 15% agar powder.

Preferably, the fermentation medium is: 50-70g/L glucose, 2-4g/LKH ₂ PO ₄ 10-12g/L yeast extract, 5-8g/L pancreatic protein, 5-8g/L (NH) ₄ ) ₂ SO ₄ 、10-13g/LK ₂ HPO ₄ ·3H ₂ O and 8-10mL/L trace metal solution;

wherein, trace metal solution components include: 3-6g/L FeSO ₄ ·7H ₂ O、0.1-0.3g/L CuCl ₂ ·H ₂ O、3-6g/L CaCl ₂ 、1-3g/L MnSO ₄ ·5H ₂ O、0.1-0.3g/LAlCl ₃ ·6H ₂ O、0.3-0.5g/L CoCl ₂ ·6H ₂ O、0.03-0.05g/L H ₃ BO ₄ 、0.1-0.4g/LNa ₂ MoO ₄ ·2H ₂ O、0.1-0.4g/L ZnSO ₄ ·7H ₂ O。

Specifically, the preparation and detection of the correlation are as follows:

example 1: construction of GlcNAc-producing Strain

(1) Heterologous expression of GlcNAc-6P synthase Gene GNA1

The vector is prepared by inserting 480bp gene fragment of GNA1 gene into vector amyE (pJOE 8999-N20-UP-DN with nucleotide sequence of SEQ ID NO. 3) to construct vector amyE:: P _C2up -GNA1。

The N20 fragment is obtained by renaturation of primers amyE (N20-F) and amyE (N20-R) at 95 ℃, the UP fragment is obtained by amplification of primers amyE (UP-F) and amyE (UP-R) by PCR technology, the DN fragment is obtained by amplification of primers amyE (DN-F) and amyE (DN-R) by PCR technology, and the UP-DN fragment is obtained by amplification of primers amyE (UP-F) and amyE (DN-R) by overlap PCR technology.

The GNA1-F, GNA1-R is derived from Saccharomyces cerevisiae (Saccharomyces cerevisiae S288C), and the GNA1 fragment is amplified by PCR technology with the primer GNA1-F, GNA 1-R. The P is _C2up Promoter with primer P _C2up -F、P _C2up R amplification by PCR techniqueAnd (5) obtaining the product. The P is _C2up GNA1 as primer GNA1-F, P _C2up R is amplified by means of overlap PCR techniques.

amyE:P constructed by the method _C2up The GNA1 vector will construct a successful amyE:: P _C2up GNA1 plasmid was transferred to bacillus subtilis strain BS 168. It was plated on LB plates containing 5. Mu.g/mL kanamycin and 0.2% mannose on mannose-inducible promoter P _man Inducing cas9 gene under the control of (A), and culturing at 30 deg.C in incubator until single colony is grown. Then, the grown colonies were spotted on LB plates without kana with toothpicks and cultured at 42 ℃; the following day, colonies were streaked onto LB plates and more single colonies were obtained at 42 ℃. Finally, colonies were spotted on LB plates containing kana and not containing kana with toothpicks, and transformants which did not grow on LB plates and on resistant plates were selected. PCR verification was performed using primers amyE-JCF and amyE-JCR, and the result is shown in FIG. 1, and the construction of GNA1 heterologous expression strain was successful in 168-GNA1.

(2) Traceless knockout nagP, nagA, nagBB gene

Taking the nagP gene knockout as an example, the N20 fragment is obtained by carrying out renaturation on the primers nagP (N20-F) and nagP (N20-R), the UP fragment is obtained by carrying out PCR amplification on the primers nagP (UP-F) and nagP (UP-R), the DN fragment is obtained by carrying out PCR amplification on the primers nagP (DN-F) and nagP (DN-R), and the UP-DN fragment is obtained by carrying out PCR amplification on the primers nagP (UP-F) and nagP (DN-R).

The nagP knockout vector constructed as described above was transformed into strain 168-GNA1 by plasmid construction of a successful nagP knockout. It was plated on LB plates containing 5. Mu.g/mL kanamycin and 0.2% mannose on mannose-inducible promoter P _man Inducing cas9 gene under the control of (A), and culturing at 30 deg.C in incubator until single colony is grown. Then, the grown colonies were spotted on LB plates without kana with toothpicks and cultured at 42 ℃; the following day, colonies were streaked onto LB plates and more single colonies were obtained at 42 ℃. Finally, the colony is spotted on an LB plate containing kana and an LB plate not containing kana by using a toothpick, and transformants which do not grow on the LB plate and the resistance plate are screened. PCR verification was performed using primers nagP-JCF and nagP-JCR, and the result is shown in FIG. 2, and the nagP knockout strain was constructed to be 168-GNA1 (nagP).

Construction of other knockout strains the nagA and nagBB strains were constructed successfully as the nagP knockout strain, and designated 168-GNA1 (ΔnagP ΔnagA ΔnagBB).

Example 2: construction of GlcNAc-producing Strain for improving utilization rate of carbon source

(1) Heterologous expression phosphoketolase coding gene fxpk

The vector is constructed by inserting 2475bp gene fragment of fxpk gene into vector murQ (pJOE 8999-N20-UP-DN) _C2up -fxpk。

The N20 fragment is obtained by renaturation of the primers murQ (N20-F) and murQ (N20-R) at 95 ℃, the UP fragment is obtained by amplification of the primers murQ (UP-F) and murQ (UP-R) by a PCR technology, the DN fragment is obtained by amplification of the primers murQ (DN-F) and murQ (DN-R) by a PCR technology, and the UP-DN fragment is obtained by amplification of the primers murQ (UP-F) and murQ (DN-R) by an overlap PCR technology.

The fxpk-F, fxpk-R is derived from bifidobacterium adolescentis, and the fxpk fragment is amplified by a PCR technology through a primer fxpk-F, fxpk-R. The P is _C2up Promoter with primer P _C2up -F、P _C2up R is amplified by PCR techniques. The P is _C2up Fxpk as primer fxpk-F, P _C2up R is amplified by means of overlap PCR techniques.

MurQ:P constructed by the method _C2up The fxpk vector will construct a successful murQ:: P _C2up The fxpk-plasmid was transferred to strain 168-GNA1 (ΔnagP ΔnagA ΔnagBB). It was plated on LB plates containing 5. Mu.g/mL kanamycin and 0.2% mannose on mannose-inducible promoter P _man Inducing cas9 gene under the control of (A), and culturing at 30 deg.C in incubator until single colony is grown. Then, the grown colonies were spotted on LB plates without kana with toothpicks and cultured at 42 ℃; the following day, colonies were streaked onto LB plates and more single colonies were obtained at 42 ℃. Finally, colonies were spotted on LB plates containing kana and not containing kana with toothpicks, and transformants which did not grow on LB plates and on resistant plates were selected.PCR verification was performed using the primers murQ-JCF and murQ-JCR, and the fxpk heterologous expression strain was constructed successfully as 168-GNA1 (ΔnagP ΔnagA ΔnagBB murQ:: fxpk).

(2) Inhibition of phosphofructokinase encoding gene pfkA by molecular switch

The vector is prepared by inserting 25bp gene of xylO locus into initial vector pJOE8999 to construct vector P _pfkA xylO; the vector is constructed by inserting 1167bp fragment genes of xylR genes into an initial vector pHT 01.

The N20 fragment is obtained by renaturation of primers pfkA (N20-F) and pfkA (N20-R) at 95 ℃, the UP fragment is obtained by amplification of primers pfkA (UP-F) and pfkA (UP-R) through a PCR technology, the DN fragment is obtained by amplification of primers pfkA (DN-F) and pfkA (DN-R) through a PCR technology, and the UP-DN fragment is obtained by amplification of primers pfkA (UP-F) and pfkA (DN-R) through an overlap PCR technology.

The xylR fragment is amplified by a PCR technology through a primer xylR-F, xylR-R.

P constructed by the method _pfkA xylO vector, will construct successful P _pfkA Xylo plasmid was transferred to strain 168-GNA1 (ΔnagP ΔnagA ΔnagBB murQ:: fxpk). It was plated on LB plates containing 5. Mu.g/mL kanamycin and 0.2% mannose on mannose-inducible promoter P _man Inducing cas9 gene under the control of (A), and culturing at 30 deg.C in incubator until single colony is grown. Then, the grown colonies were spotted on LB plates without kana with toothpicks and cultured at 42 ℃; the following day, colonies were streaked onto LB plates and more single colonies were obtained at 42 ℃. Finally, colonies were spotted on LB plates containing kana and not containing kana with toothpicks, and transformants which did not grow on LB plates and on resistant plates were selected. PCR verification was performed using primers xylO-F and pfkA-JCR, and the strain was constructed successfully as 168-GNA1 (ΔnagP ΔnagA ΔnagBB murQ:: fxpkP _pfkA ::xylO)。

The successfully constructed pHT01-xylR plasmid was transferred to strain 168-GNA1 (ΔnagPΔnagAΔnagBB murQ:: fxpk P) _pfkA In xylO), PCR was performed using primers pHT01-F and pHT01-R, and the results were shown in FIG. 3, and the strain was constructed to be 168-GNA1 (ΔnagP ΔnagA ΔnagBB) murQ::fxpkP _pfkA ::xylO pHT01-xylR)。

Example 3: chemical conversion method of bacillus subtilis

(1) The single colony of bacillus subtilis on the plate is picked up and inoculated into a test tube filled with 4mL of LB liquid medium, and cultured overnight at 37 ℃ by a shaking table at 200 rpm.

(2) Transferring 100 μl of the bacterial liquid into a test tube containing 2-4mL of SpI culture medium, shaking at 37deg.C, 200rpm, culturing for 2-3 hr, and measuring OD ₆₀₀ 1.1-1.3.

(3) In a test tube containing 2-4mL of SpII medium, 100-300. Mu.L of the above solution was transferred, and incubated at 37℃in a shaker at 200rpm for 1.5h.

(4) 10-30. Mu.L of 10 mM EGTA was added and incubated for 1.5h at 37℃with shaking table at 100 rpm.

(5) The plasmid was added and incubated at 30℃with shaking at 100rpm for 1h.

(6) The rotation speed was adjusted to 220rpm and the culture was continued for 1.5 hours.

(7) Using a sterile 2mL centrifuge tube, centrifugation was performed at 5000rpm for 5min, the supernatant was discarded, and 100. Mu.L of the suspended cells remained, which were spread on a plate of the corresponding resistance, and cultured in an incubator at 30℃until single colonies were grown.

The Sp culture medium comprises the following components: weighing 17-20g/L K ₂ HPO ₄ 、5-8g/LKH ₂ PO ₄ 、1-3g/L(NH ₄ ) ₂ SO ₄ 、0.1-0.3g/L MgSO ₄ ·7H ₂ O, 1-2g/L sodium citrate. Sterilizing at 121deg.C for 20min. Separately sterilizing 0.3-0.6g/10mL casein hydrolysate, 1-3g/10mL yeast extract, 3-6g/10mL glucose, 1-3g/10mL MgCl ₂ ·6H ₂ O、0.1-0.3g/10mL CaCl ₂ For subsequent experiments.

The SpI culture medium comprises the following components: sp medium was aspirated under ultra clean bench sterile conditions for 2.4mL, and 400. Mu.L casein hydrolysate, 400. Mu.L yeast extract, and 1mL glucose were added.

The SpII culture medium comprises the following components: sucking out SpI culture medium 1mL under aseptic condition, adding 500 μLMgCl ₂ ·6H ₂ O、500μL CaCl ₂ . After preparation, the SpI medium and the SpII medium were placed in a four-degree refrigerator for use.

Example 4: shaking flask fermentation experiment

(1) Seed culture: taking out the fermentation strain from the refrigerator at the temperature of minus 80 ℃, scribing on an LB solid plate, and culturing for 12 hours at the temperature of 37 ℃ and the rotating speed of 200 rpm; the single colony is picked up and inoculated into a test tube filled with 4mL of LB liquid medium, and the culture is carried out for 12 hours at 37 ℃ and 200 rpm; inoculating the bacterial liquid with 1-3% inoculation amount into a 100mL conical flask filled with 20mL LB liquid medium, and culturing for 12h at 37 ℃ and the rotating speed of 150-300 rpm.

(2) Fermentation culture: inoculating the seed culture solution into 500mL conical flask containing 75mL fermentation medium at 37 deg.C and rotation speed of 150-300rpm for 24-48 hr.

(3) Method for detecting GlcNAc:

(1) sample treatment: the fermentation broth was centrifuged at 12000rpm for 10min and the supernatant was placed in a new 2mL EP tube. And (3) properly diluting with ultrapure water, and filtering with a filter with a pore diameter of 22 mu m to obtain a liquid phase vial, thus obtaining the liquid to be measured.

(2) Detection conditions: an AminexHPX-87H (Bio-Rad laboratories) column (organic acid column) and a differential refractive detector; mobile phase: 5mM H ₂ SO ₄ The method comprises the steps of carrying out a first treatment on the surface of the Flow rate: 0.5mL/min; column temperature: 40 ℃; detector temperature: 35 ℃; sample injection amount: 10. Mu.L; detection time: 22min.

In conclusion, the bacillus subtilis genetically engineered strain for producing GlcNAc is successfully obtained by CRISPR-Cas9 gene editing technology. The molecular switch is constructed to inhibit the expression of phosphofructokinase gene pfkA to obtain strain 168-GNA1 (delta nagP delta nagA delta nagBB murQ:: fxpk P) _pfkA Xylo pHT 01-xylR) was subjected to shake flask fermentation, and the control strain 168-GNA1 had a GlcNAc yield of 4.127g/L, as shown in FIG. 4, and the modified strain 168-GNA1 (ΔnagP ΔnagA ΔnagBB murQ:: fxpkP) _pfkA GlcNAc yield of xylO pHT 01-xylR) reaches 10.367g/L.

According to the invention, through gene manipulation in bacillus subtilis, the degradation path of N-acetylglucosamine is blocked by knocking out PTS specific transport protein genes nagP, acetylglucosamine-6-phosphate deacetylase genes nagA and glucosamine-6-phosphate deaminase genes nagBB; furthermore, through heterologously expressing phosphoketolase coding gene fxpk and utilizing a molecular switch to inhibit phosphofructokinase coding gene pfkA, the utilization rate of a carbon source is improved, the metabolic loss of carbon flux is reduced, and the conversion rate of glucose to GlcNAc is improved from 7.12% to 24.43%. Provides a certain utilization value for the industrialized production of N-acetylglucosamine.

Table 1 shows the primers involved in plasmid and strain construction:

primer sequences used in Table 1

The sequences used in the present invention are as follows:

SEQ ID NO.1: the nucleotide sequence of GNA1 is 480bp

ATGTCACTGCCGGATGGCTTTTATATTAGAAGAATGGAAGAAGGCGATCTGGAACAAGTTACAGAAACACTGAAAGTTCTGACAACAGTTGGCACAATTACACCGGAATCATTTTCAAAACTGATCAAGTACTGGAACGAGGCGACGGTGTGGAATGATAATGAAGATAAGAAAATCATGCAGTATAACCCGATGGTGATCGTGGATAAAAGAACAGAAACGGTTGCAGCAACAGGCAATATTATTATTGAACGCAAGATCATCCACGAGCTGGGCCTGTGCGGCCATATTGAAGATATTGCAGTTAATTCAAAGTACCAAGGCCAGGGCCTGGGCAAACTGCTGATTGATCAACTGGTTACAATTGGCTTTGATTACGGCTGCTATAAAATTATCCTGGACTGCGATGAAAAGAACGTGAAATTTTATGAGAAGTGCGGCTTCAGCAATGCAGGCGTTGAAATGCAAATTAGAAAATGA

SEQ ID NO.2：P _C2up 108bp of the nucleotide sequence of (A)

TGAGAATTCCTAACAACTAAATCACGACTATATACCTATACTATTTATTATCATCAATTTGTCGAAAAGGGTAGACAAACTATCGTTTAACATGTTATACTATAATAG

SEQ ID NO.3: nucleotide sequence of amyE 1980bp

Gene ID：938356，

Locus tag：BSU_03040

SEQ ID NO.4: nucleotide sequence 1359bp of nagP

Gene ID：938807，

Locus tag：BSU_07700

SEQ ID NO.5: nucleotide sequence 1191bp of nagA

Gene ID：936621，

Locus tag：BSU_35010

SEQ ID NO.6: the nucleotide sequence of nagBB is 750bp

Gene ID：938425，

Locus tag：BSU_02360

SEQ ID NO.7: nucleotide sequence 915bp of murQ

Gene ID：938882，

Locus tag：BSU_01700

SEQ ID NO.8: 2475bp of nucleotide sequence of fxpk

ATGGCATCACCGGTTACAGGCACACCGTGGAAAAAACTGAATGCACCGGTTTCAGAAG

AAGCGATTGAAGGCGTTGATAAATACTGGCGCGCAGCAAATTATCTGTCAATTGGCCAAA

TTTACCTGCGCAGCAATCCGCTGATGAAAGAGCCGTTTACAAGAGAAGATGTTAAGCAC

AGACTGGTGGGCCATTGGGGCACAACACCGGGATTAAATTTTCTGATTGGCCATATTAAC

CGCCTGATCGCGGATCATCAACAGAATACGGTTATCATTATGGGCCCGGGCCATGGCGGC

CCTGCAGGAACAGCACAATCATATCTTGATGGCACATATACGGAATACTTCCCGAATATTA

CAAAGGACGAAGCGGGCCTGCAAAAATTTTTTAGACAATTTAGCTACCCGGGCGGCATT

CCGTCACATTATGCACCGGAAACACCGGGCTCAATTCATGAAGGCGGCGAACTGGGCTA

TGCACTGTCACATGCATATGGCGCAGTTATGAATAATCCGTCACTGTTTGTTCCGGCAATT

GTTGGCGATGGCGAAGCAGAAACAGGCCCGTTAGCAACAGGCTGGCAATCAAATAAAC

TGATTAATCCGAGAACGGACGGCATTGTTCTGCCGATTCTGCATCTGAATGGCTATAAAA

TTGCGAACCCGACAATCCTGTCACGCATTTCAGATGAAGAACTGCATGAATTTTTCCACG

GCATGGGCTATGAACCGTATGAATTTGTTGCAGGCTTTGACAATGAGGATCACCTGTCAA

TTTATCGCCGCTTTGCGGAACTGTTTGAAACGGTGTTCGATGAGATCTGCGATATCAAAG

CGGCAGCACAAACAGATGATATGACGCGCCCGTTTTATCCGATGATTATTTTCCGCACGC

CGAAAGGCTGGACATGCCCGAAATTTATTGATGGCAAAAAAACGGAGGGCAGCTGGAG

ATCACATCAGGTTCCGCTGGCATCAGCAAGAGATACAGAAGCACATTTTGAAGTGCTGA

AAAACTGGCTGGAGTCATATAAACCGGAAGAACTGTTTGATGAGAACGGCGCAGTTAA

ACCGGAAGTTACAGCATTTATGCCGACAGGCGAACTGAGAATTGGCGAAAATCCGAATG

CAAATGGCGGCAGAATTAGAGAAGAACTGAAACTGCCGAAACTGGAAGATTATGAAGT

TAAGGAAGTGGCGGAATACGGCCATGGCTGGGGCCAACTGGAAGCAACAAGAAGACTG

GGCGTTTATACAAGAGATATTATCAAAAACAACCCGGACAGCTTCCGCATCTTTGGCCCG

GATGAAACAGCATCAAATAGACTGCAAGCAGCATATGATGTTACGAATAAGCAGTGGGA

TGCAGGCTATCTGTCAGCACAAGTTGATGAACATATGGCGGTTACAGGCCAAGTTACAG

AACAACTGTCAGAACATCAAATGGAAGGCTTTCTGGAAGGCTATCTGCTGACAGGCAG

ACATGGCATTTGGTCATCATATGAATCATTCGTGCATGTGATCGACAGCATGCTGAATCAG

CATGCGAAATGGCTGGAAGCAACAGTTAGAGAAATTCCGTGGAGAAAACCGATTTCATC

AATGAATCTGCTGGTGTCATCACACGTGTGGAGACAAGATCATAATGGCTTTAGCCACCA

AGATCCGGGCGTTACATCAGTTCTGCTGAATAAATGCTTTAACAACGACCACGTGATCGG

CATTTATTTTCCGGTTGACTCAAATATGCTGCTGGCAGTTGCAGAAAAATGCTATAAATCA

ACGAACAAGATCAACGCGATTATCGCGGGCAAACAGCCGGCAGCAACATGGCTGACAC

TGGATGAAGCAAGAGCAGAACTGGAAAAAGGCGCAGCAGAATGGAAATGGGCATCAA

ATGTTAAAAGCAACGACGAGGCGCAGATCGTGCTGGCAGCAACAGGAGATGTTCCGAC

ACAAGAAATTATGGCAGCAGCAGATAAACTGGATGCAATGGGCATTAAATTTAAGGTGG

TTAACGTTGTGGACCTGGTGAAGCTGCAAAGCGCAAAAGAAAATAATGAGGCGCTGTC

AGATGAAGAGTTTGCAGAACTGTTTACAGAGGACAAACCGGTTCTGTTTGCATATCATA

GCTACGCGAGAGATGTTAGAGGCCTGATTTATGATAGACCGAATCATGATAATTTCAACG

TGCACGGCTATGAGGAACAGGGCTCAACAACAACACCGTATGATATGGTTAGAGTGAAC

AACATCGACAGATACGAACTGCAAGCGGAAGCACTGAGAATGATTGATGCAGATAAATA

CGCGGATAAGATCAACGAACTGGAGGCATTTCGCCAAGAAGCATTTCAGTTTGCAGTTG

ACAATGGCTATGATCACCCGGATTATACAGATTGGGTTTATTCAGGCGTTAACACGAATA

AGCAGGGCGCAATTTCAGCGACAGCAGCAACAGCAGGCGATAATGAASEQ ID NO.9: nucleotide sequence 960bp of pfkA

Gene ID：937376，

Locus tag：BSU_29190

SEQ ID NO.10: 25bp of xylO nucleotide sequence

TTAGTTTATTGGATAAACAAACTAA

SEQ ID NO.11: nucleotide sequence 1167bp of xylR

GTGGTTATTATTCAAATTGCAGATCAAGCTTTAGTAAAAAAAATGAATCAAAAATTAATAT

TAGATGAAATTTTGAAGAACTCCCCTGTCTCCAGGGCAACTCTCTCTGAGATTACAGGAT

TAAACAAGTCTACTGTCTCCTCTCAAGTAAATACACTGCTTGAAAAAGATTTTATTTTTG

AAATTGGGGCAGGGCAATCTAGAGGCGGCAGAAGACCTGTAATGCTTGTTTTTAATAAG

AATGCAGGCTACTCGATTGGTATTGATATAGGAGTCGACTATCTTAACGGAATTCTAACCG

ACTTAGAAGGAAATATTATTCTCGAGAAGACTTCTGACTTGTCTAGTTCTTCCGCTAGTG

AAGTAAAAGAGATTTTATTTGCACTTATTCATGGTTTTGTAACCCATATGCCTGAGTCCCC

TTATGGTCTAGTCGGAATAGGAATTTGTGTTCCAGGCCTTGTAGATCGTCATCAGCAAATT

ATTTTCATGCCTAACTTAAATTGGAATATCAAAGATTTGCAGTTTTTAATTGAGAGTGAGT

TTAATGTTCCGGTTTTTGTTGAAAATGAAGCTAATGCAGGAGCATACGGTGAAAAAGTAT

TTGGTATGACAAAAAACTATGAAAACATCGTTTACATCAGTATTAATATCGGAATTGGAA

CTGGACTTGTTATTAACAACGAATTGTATAAAGGTGTTCAGGGTTTTTCTGGGGAAATGG

GTCATATGACGATAGATTTTAATGGACCCAAATGCAGCTGTGGAAATCGAGGCTGTTGGG

AATTATATGCTTCTGAAAAAGCGTTACTGGCTTCGCTCTCTAAAGAAGAAAAGAATATTT

CTCGAAAAGAGATTGTGGAACGCGCAAATAAAAATGATGTAGAAATGTTAAATGCACTT

CAAAACTTTGGCTTTTATATCGGAATTGGATTAACCAATATCCTTAATACATTTGATATAGA

AGCTGTTATCTTGAGAAATCATATAATTGAATCTCATCCCATTGTTTTAAATACGATTAAAA

ACGAAGTTTCTTCTAGAGTCCATTCTCATTTAGACAATAAATGTGAACTATTGCCTTCTTC

GTTAGGAAAAAATGCACCTGCTTTAGGAGCGGTTTCTATCGTTATTGATTCTTTTTTAAGT

GTTACCCCTATAAGTTAG

Although embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the disclosure of the embodiments.

Claims (8)

1. A strain for improving the conversion rate and the yield of N-acetylglucosamine, which is characterized in that: the construction method of the strain comprises the following steps:

(1) Heterologous expression of GlcNAc-6P synthase encoding Gene GNA1

At amyE site, P is inserted _C2up The GlcNAc-6P synthetase coding gene GNA1 controlled by a promoter;

(2) Knock-out

Using CRISPR-Cas9 technology, performing traceless knockout on GlcNAc specific transporter genes nagP, glcNAc-6P deacetylase genes nagA and GlcN-6P deaminase genes nagBB; the gene sequence of the coding gene nagP is SEQ ID NO.4, the gene sequence of nagA is SEQ ID NO.5, and the gene sequence of nagBB is SEQ ID NO.6;

(3) Introduction of

1) Heterologous expression phosphoketolase coding gene fxpk

At the murQ site, P is inserted _C2up The phosphoketolase coding gene fxpk controlled by the promoter;

2) Inhibition of phosphofructokinase encoding gene pfkA by molecular switch

Insertion of xylO sequence into pfkA Gene locus and introduction of P _grac The gene sequence of the XyleR protein controlled by the promoter is SEQ ID NO.9, the gene sequence of the xylO locus is SEQ ID NO.10, and the gene sequence of the xylR fragment is SEQ ID NO.11.

2. A strain according to claim 1, characterized in that: in the step (1), GNA1 is derived from Saccharomyces cerevisiae, and the gene sequence of GNA1 fragment is SEQ ID NO.1, P _C2up The gene sequence of the promoter is SEQ ID NO.2, and the gene sequence of amyE is SEQ ID NO.3.

3. A strain according to claim 1, characterized in that: the murQ gene sequence in the step (3) is SEQ ID NO.7, the fxpk is derived from bifidobacterium adolescentis, and the fxpk fragment gene sequence is SEQ ID NO.8, P _C2up The gene sequence of the promoter is SEQ ID NO.2.

4. An N-acetylglucosamine synthesizing strain using the strain as set forth in any one of claims 1 to 3, characterized in that: the synthetic strain is obtained by transferring a vector pHT01-xylR into the vector and weakening a phosphofructokinase gene pfkA.

5. The use of the strain according to claim 4 for the fermentative preparation of N-acetylglucosamine.

6. A method for producing N-acetylglucosamine by fermentation using the strain according to claim 4, wherein: the method comprises the following steps:

shaking and fermenting: taking out the fermentation strain from the refrigerator at the temperature of minus 80 ℃, streaking on an LB solid plate, and culturing for 12 hours in an incubator at the temperature of 37 ℃; the single colony is picked up and inoculated into 4mL LB liquid medium, the temperature is 37 ℃, the rotating speed is 200rpm, and the culture is carried out for 12 hours; inoculating the bacterial liquid with 1-3% inoculation amount into 20mL LB liquid culture medium, culturing for 12h at 37 ℃ and rotating speed of 150-300 rpm; inoculating the seed solution into 75mL fermentation medium with inoculum size of 2-8%, fermenting at 37deg.C and rotation speed of 150-300rpm for 24-48 hr to obtain GlcNAc.

7. The method according to claim 6, wherein: the LB solid medium is: 10.0g/L tryptone, 5.0g/L yeast extract, 10.0g/L LNaCl, 15% agar powder.

8. The method according to claim 6 or 7, characterized in that: the fermentation medium is as follows: 50-70g/L glucose, 2-4g/L KH ₂ PO ₄ 10-12g/L yeast extract, 5-8g/L pancreatic protein, 5-8g/L (NH) ₄ ) ₂ SO ₄ 、10-13g/LK ₂ HPO ₄ ·3H ₂ O and 8-10mL/L trace metal solution;

wherein, trace metal solution components include: 3-6 g/LFASO ₄ ·7H ₂ O、0.1-0.3g/L CuCl ₂ ·H ₂ O、3-6g/L CaCl ₂ 、1-3g/LMnSO ₄ ·5H ₂ O、0.1-0.3g/LAlCl ₃ ·6H ₂ O、0.3-0.5g/L CoCl ₂ ·6H ₂ O、0.03-0.05g/L H ₃ BO ₄ 、0.1-0.4g/LNa ₂ MoO ₄ ·2H ₂ O、0.1-0.4g/L ZnSO ₄ ·7H ₂ O。