CN117625848A - Composition for detecting respiratory pathogens based on high throughput sequencing - Google Patents
Composition for detecting respiratory pathogens based on high throughput sequencing Download PDFInfo
- Publication number
- CN117625848A CN117625848A CN202311654861.7A CN202311654861A CN117625848A CN 117625848 A CN117625848 A CN 117625848A CN 202311654861 A CN202311654861 A CN 202311654861A CN 117625848 A CN117625848 A CN 117625848A
- Authority
- CN
- China
- Prior art keywords
- seq
- amplifying
- primer
- groups
- primer groups
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000203 mixture Substances 0.000 title claims abstract description 40
- 230000000241 respiratory effect Effects 0.000 title claims abstract description 24
- 238000012165 high-throughput sequencing Methods 0.000 title claims abstract description 23
- 244000052769 pathogen Species 0.000 title claims abstract description 20
- 241000282414 Homo sapiens Species 0.000 claims abstract description 34
- 238000001514 detection method Methods 0.000 claims abstract description 25
- 238000012163 sequencing technique Methods 0.000 claims abstract description 17
- 241000700605 Viruses Species 0.000 claims abstract description 11
- 241000194017 Streptococcus Species 0.000 claims abstract description 9
- 241000202934 Mycoplasma pneumoniae Species 0.000 claims abstract description 6
- 241001453380 Burkholderia Species 0.000 claims abstract description 5
- 241000186227 Corynebacterium diphtheriae Species 0.000 claims abstract description 5
- 241001669084 Coxsackievirus A6 Species 0.000 claims abstract description 5
- 241000713196 Influenza B virus Species 0.000 claims abstract description 5
- 241000186781 Listeria Species 0.000 claims abstract description 5
- 241000186367 Mycobacterium avium Species 0.000 claims abstract description 5
- 241000187479 Mycobacterium tuberculosis Species 0.000 claims abstract description 5
- 241000204031 Mycoplasma Species 0.000 claims abstract description 5
- 241000589517 Pseudomonas aeruginosa Species 0.000 claims abstract description 5
- 241000710799 Rubella virus Species 0.000 claims abstract description 5
- 241000191940 Staphylococcus Species 0.000 claims abstract description 5
- 241001148135 Veillonella parvula Species 0.000 claims abstract description 5
- 239000003153 chemical reaction reagent Substances 0.000 claims description 21
- 230000003321 amplification Effects 0.000 claims description 14
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 14
- 108020004707 nucleic acids Proteins 0.000 claims description 12
- 102000039446 nucleic acids Human genes 0.000 claims description 12
- 150000007523 nucleic acids Chemical class 0.000 claims description 12
- 238000010276 construction Methods 0.000 claims description 7
- 241000588626 Acinetobacter baumannii Species 0.000 claims description 4
- 241000228197 Aspergillus flavus Species 0.000 claims description 4
- 241001225321 Aspergillus fumigatus Species 0.000 claims description 4
- 241000228245 Aspergillus niger Species 0.000 claims description 4
- 241000589513 Burkholderia cepacia Species 0.000 claims description 4
- 241000222122 Candida albicans Species 0.000 claims description 4
- 241001647378 Chlamydia psittaci Species 0.000 claims description 4
- 241000158523 Corynebacterium striatum Species 0.000 claims description 4
- 241001337994 Cryptococcus <scale insect> Species 0.000 claims description 4
- 241000588724 Escherichia coli Species 0.000 claims description 4
- 241000606768 Haemophilus influenzae Species 0.000 claims description 4
- 241000606766 Haemophilus parainfluenzae Species 0.000 claims description 4
- 241000046923 Human bocavirus Species 0.000 claims description 4
- 101000730041 Klebsiella aerogenes Arylsulfatase Proteins 0.000 claims description 4
- 241000588749 Klebsiella oxytoca Species 0.000 claims description 4
- 241000588747 Klebsiella pneumoniae Species 0.000 claims description 4
- 241000589242 Legionella pneumophila Species 0.000 claims description 4
- 241000588655 Moraxella catarrhalis Species 0.000 claims description 4
- 241000588650 Neisseria meningitidis Species 0.000 claims description 4
- 241000606693 Orientia tsutsugamushi Species 0.000 claims description 4
- 241000233870 Pneumocystis Species 0.000 claims description 4
- 241000711902 Pneumovirus Species 0.000 claims description 4
- 241000235527 Rhizopus Species 0.000 claims description 4
- 241000606701 Rickettsia Species 0.000 claims description 4
- 240000004808 Saccharomyces cerevisiae Species 0.000 claims description 4
- 235000014680 Saccharomyces cerevisiae Nutrition 0.000 claims description 4
- 208000037386 Typhoid Diseases 0.000 claims description 4
- 241000607734 Yersinia <bacteria> Species 0.000 claims description 4
- 229940091771 aspergillus fumigatus Drugs 0.000 claims description 4
- 238000003556 assay Methods 0.000 claims description 4
- 229940095731 candida albicans Drugs 0.000 claims description 4
- 229940047650 haemophilus influenzae Drugs 0.000 claims description 4
- 229940115932 legionella pneumophila Drugs 0.000 claims description 4
- 201000000317 pneumocystosis Diseases 0.000 claims description 4
- 238000002360 preparation method Methods 0.000 claims description 4
- 201000008297 typhoid fever Diseases 0.000 claims description 4
- 241001529453 unidentified herpesvirus Species 0.000 claims description 4
- 238000000605 extraction Methods 0.000 claims description 3
- 238000011144 upstream manufacturing Methods 0.000 claims description 2
- 238000004458 analytical method Methods 0.000 abstract description 6
- 241000711920 Human orthopneumovirus Species 0.000 abstract 1
- 241000701076 Macacine alphaherpesvirus 1 Species 0.000 abstract 1
- 241000122116 Parvimonas Species 0.000 abstract 1
- 241001403829 Streptococcus pseudopneumoniae Species 0.000 abstract 1
- 239000000523 sample Substances 0.000 description 11
- 239000000047 product Substances 0.000 description 8
- 239000011324 bead Substances 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 238000006243 chemical reaction Methods 0.000 description 5
- 239000002096 quantum dot Substances 0.000 description 5
- 102000053602 DNA Human genes 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 108091092584 GDNA Proteins 0.000 description 4
- 238000013467 fragmentation Methods 0.000 description 4
- 238000006062 fragmentation reaction Methods 0.000 description 4
- 208000015181 infectious disease Diseases 0.000 description 4
- 238000000746 purification Methods 0.000 description 4
- 239000006228 supernatant Substances 0.000 description 4
- 238000012070 whole genome sequencing analysis Methods 0.000 description 4
- 238000012408 PCR amplification Methods 0.000 description 3
- HEMHJVSKTPXQMS-UHFFFAOYSA-M Sodium hydroxide Chemical compound [OH-].[Na+] HEMHJVSKTPXQMS-UHFFFAOYSA-M 0.000 description 3
- 230000001580 bacterial effect Effects 0.000 description 3
- 239000012634 fragment Substances 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- 206010057190 Respiratory tract infections Diseases 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 239000013256 coordination polymer Substances 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 238000007403 mPCR Methods 0.000 description 2
- 244000000010 microbial pathogen Species 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 208000020029 respiratory tract infectious disease Diseases 0.000 description 2
- 241000894006 Bacteria Species 0.000 description 1
- 108090000994 Catalytic RNA Proteins 0.000 description 1
- 102000053642 Catalytic RNA Human genes 0.000 description 1
- 241001647372 Chlamydia pneumoniae Species 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 241000218691 Cupressaceae Species 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 206010036790 Productive cough Diseases 0.000 description 1
- 239000007984 Tris EDTA buffer Substances 0.000 description 1
- 238000003149 assay kit Methods 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 238000005251 capillar electrophoresis Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 238000007405 data analysis Methods 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000029087 digestion Effects 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012530 fluid Substances 0.000 description 1
- 230000002458 infectious effect Effects 0.000 description 1
- 239000004615 ingredient Substances 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 210000000867 larynx Anatomy 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 238000006386 neutralization reaction Methods 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 230000005180 public health Effects 0.000 description 1
- 230000002685 pulmonary effect Effects 0.000 description 1
- 108091092562 ribozyme Proteins 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 238000001179 sorption measurement Methods 0.000 description 1
- 210000003802 sputum Anatomy 0.000 description 1
- 208000024794 sputum Diseases 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of biological detection. The invention provides a composition for detecting respiratory pathogens based on high-throughput sequencing, which comprises at least 4 targets in 46 respiratory pathogens, such as human respiratory virus type 1, human respiratory virus type 3, human rubella virus type 4, influenza B virus, human orthopneumovirus, coxsackie virus A6, human herpes B virus type 5, human staphylococcus, listeria, corynebacterium diphtheriae, mycobacterium avium, mycobacterium tuberculosis, mycoplasma homalomenae, mycoplasma pneumoniae, streptococcus pseudopneumoniae, streptococcus light, burkholderia melitensis, pseudomonas aeruginosa, veillonella parvula, micromonas and the like. The composition can amplify and enrich a plurality of targets in one tube simultaneously, so that the data volume required by subsequent sequencing is obviously reduced, the analysis work is simplified, and the whole detection is more accurate and efficient.
Description
Technical Field
The invention belongs to the field of biological detection. In particular, to compositions for high throughput sequencing detection, and more particularly, to compositions for high throughput sequencing detection of respiratory pathogens.
Background
Respiratory tract infectious diseases are common clinical disease types, including nasal, pharyngeal/laryngeal, tracheal/bronchial and pulmonary infections below the larynx. Respiratory tract infection is a common multiple infectious disease, and various pathogens such as virus, mycoplasma pneumoniae, chlamydia pneumoniae, bacteria and the like can cause respiratory tract infection, and are easy to recognize and difficult to break, which is a main diagnosis and treatment difficulty of respiratory tract infectious diseases. Clinical manifestations after infection with different pathogens are similar, but infectious pathogens are difficult to specify and difficult to treat specifically.
High throughput sequencing technology is the method currently used in clinical microbiology laboratories to determine pathogens, and its clinical use mainly includes 3 types: whole Genome Sequencing (WGS), metagenomic second generation sequencing (mNGS) and targeted gene sequencing (tNGS).
To date, the most common use of WGS is to identify, genotype and/or predict the susceptibility of microbial pathogens, which has an important role in hospital and public health epidemiological studies. mNGS is a method that can detect all nucleic acids directly from a patient sample, which does not selectively amplify a specific target, because all nucleic acids in a sample are amplified and sequenced in parallel, allowing unbiased detection of all microbiomes
Unlike whole genome sequencing, targeted gene sequencing techniques can directly perform targeted enrichment on the genome of interest in a sample to be tested, and separate and re-sequence the target genome from complex background nucleic acids. The method is more economical and efficient, and has higher sensitivity and is more convenient for subsequent data analysis. For example, in clinical sample sequencing data, the background data of human genome may be up to 99%, only 1% of the data is the target sequence, so that a large amount of data is required to ensure the accuracy of the data, if the target sequence is enriched and then sequenced separately, the required data amount can be significantly reduced, and the related work can be greatly simplified in subsequent analysis correspondingly.
Thus, there is a need in the art for a composition that enriches for targets such that the amount of data required for subsequent sequencing is significantly reduced, and that simplifies analysis and allows for accurate and efficient detection of a variety of targets.
Disclosure of Invention
In view of this, in a first aspect, the present invention provides a composition for detecting respiratory pathogens based on high throughput sequencing, comprising at least 4 targets in the primer set as follows:
primer groups for amplifying human respiratory virus type 1 shown in SEQ ID NO. 1-4;
a primer group for amplifying human respiratory virus type 3 as shown in SEQ ID NO. 5-10;
a primer group for amplifying human rubella virus type 4 as shown in SEQ ID NO. 11-14;
primer groups for amplifying influenza B viruses shown as SEQ ID NO. 15-18;
primer groups for amplifying human pneumovirus shown as SEQ ID NO. 19-22;
primer group for amplifying Coxsackie virus A6 as shown in SEQ ID NO. 23-30;
a primer set for amplifying human type B herpesvirus type 5 as shown in SEQ ID NO. 31-34;
primer groups for amplifying human staphylococcus as shown in SEQ ID NO. 35-38;
primer groups for amplifying listeria as shown in SEQ ID NO. 39-40;
primer groups for amplifying the corynebacterium diphtheriae as shown in SEQ ID NO. 41-48;
primer groups for amplifying mycobacterium avium shown as SEQ ID NO. 49-52;
primer groups for amplifying the mycobacterium tuberculosis as shown in SEQ ID NO. 53-56;
primer groups for amplifying human mycoplasma as shown in SEQ ID NO. 57-64;
primer group for amplifying mycoplasma pneumoniae as shown in SEQ ID No. 65-66;
primer groups for amplifying the pseudostreptococcus pneumoniae shown in SEQ ID NO. 67-74;
primer groups for amplifying light streptococcus as shown in SEQ ID NO. 75-78;
primer group for amplifying burkholderia melitensis shown in SEQ ID No. 79-86;
primer groups for amplifying pseudomonas aeruginosa as shown in SEQ ID NO. 87-94;
primer group for amplifying veillonella parvula as shown in SEQ ID NO. 95-102;
primer groups for amplifying the microomonas as shown in SEQ ID NO. 103-110;
primer groups for amplifying yersinia pneumocystis as shown in SEQ ID NO. 111-114;
primer groups for amplifying the catwalk as shown in SEQ ID NO. 115-118;
primer groups for amplifying the corynebacterium striatum as shown in SEQ ID NO. 119-122;
primer group for amplifying Legionella pneumophila as shown in SEQ ID NO. 123-130;
primer groups for amplifying Acinetobacter baumannii shown in SEQ ID No. 131-136;
primer group for amplifying Moraxella catarrhalis as shown in SEQ ID NO. 137-142;
primer groups for amplifying neisseria meningitidis as shown in SEQ ID nos. 143 to 150;
primer groups for amplifying saccharomyces cerevisiae as shown in SEQ ID NO. 151-156;
primer groups for amplifying aspergillus flavus as shown in SEQ ID No. 157-164;
primer groups for amplifying aspergillus niger shown as SEQ ID NO. 165-172;
primer group for amplifying novel cryptococcus as shown in SEQ ID NO. 173-178;
primer groups for amplifying candida albicans as shown in SEQ ID NO. 179-184;
primer group for amplifying Klebsiella aerogenes as shown in SEQ ID No. 185-192;
primer group for amplifying klebsiella oxytoca as shown in SEQ ID No. 193-198;
primer groups for amplifying klebsiella pneumoniae shown as SEQ ID No. 199-204;
primer groups for amplifying rhizopus microsporidianus shown as SEQ ID NO. 205-212;
primer groups for amplifying haemophilus influenzae shown as SEQ ID No. 213-220;
primer groups for amplifying haemophilus parainfluenza as shown in SEQ ID No. 221-226;
primer groups for amplifying aspergillus fumigatus as shown in SEQ ID No. 227-234;
primer groups for amplifying constellation streptococcus as shown in SEQ ID No. 235-238;
primer sets for amplifying Orientia tsutsugamushi as shown in SEQ ID NOS.239 to 246;
primer groups for amplifying the typhoid rickettsia shown in SEQ ID NO. 247-254;
primer group for amplifying Chlamydia psittaci as shown in SEQ ID NO. 255-258;
primer groups for amplifying the novel Burkholderia cepacia shown in SEQ ID NO. 259-266; primer group for amplifying escherichia coli as shown in SEQ ID NO. 267-270; or a primer group for amplifying human bocavirus as shown in SEQ ID No. 271-274.
Further, the present invention provides a composition based on high throughput sequencing detection comprising at least 8 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput sequencing detection comprising at least 10 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput sequencing detection comprising at least 20 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput sequencing detection comprising at least 30 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput sequencing detection comprising at least 35 targets in the primer set as indicated above.
Further, the present invention provides a composition based on high throughput sequencing detection comprising at least 40, 41, 42, 43, 44, 45, 46 targets in the primer set as indicated above.
The composition can amplify and enrich a plurality of targets in one tube simultaneously, so that the data volume required by subsequent sequencing is obviously reduced, the analysis work is simplified, and the whole detection is more accurate and efficient.
It is to be noted that if 46 targets can be PCR amplified simultaneously within a tube, then any combination of the 46 targets (e.g., any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22..30, 31, 32..40, 41, 42, 43, 44, 45, 46) can be PCR amplified within a tube, which is unquestionable.
Still further, the present invention provides a composition based on high throughput sequencing assays, comprising:
primer groups for amplifying human respiratory virus type 1 shown in SEQ ID NO. 1-4;
a primer group for amplifying human respiratory virus type 3 as shown in SEQ ID NO. 5-10;
a primer group for amplifying human rubella virus type 4 as shown in SEQ ID NO. 11-14;
primer groups for amplifying influenza B viruses shown as SEQ ID NO. 15-18;
primer groups for amplifying human pneumovirus shown as SEQ ID NO. 19-22;
primer group for amplifying Coxsackie virus A6 as shown in SEQ ID NO. 23-30;
a primer set for amplifying human type B herpesvirus type 5 as shown in SEQ ID NO. 31-34; primer groups for amplifying human staphylococcus as shown in SEQ ID NO. 35-38;
primer groups for amplifying listeria as shown in SEQ ID NO. 39-40;
primer groups for amplifying the corynebacterium diphtheriae as shown in SEQ ID NO. 41-48;
primer groups for amplifying mycobacterium avium shown as SEQ ID NO. 49-52;
primer groups for amplifying the mycobacterium tuberculosis as shown in SEQ ID NO. 53-56;
primer groups for amplifying human mycoplasma as shown in SEQ ID NO. 57-64;
primer group for amplifying mycoplasma pneumoniae as shown in SEQ ID No. 65-66;
primer groups for amplifying the pseudostreptococcus pneumoniae shown in SEQ ID NO. 67-74;
primer groups for amplifying light streptococcus as shown in SEQ ID NO. 75-78;
primer group for amplifying burkholderia melitensis shown in SEQ ID No. 79-86; primer groups for amplifying pseudomonas aeruginosa as shown in SEQ ID NO. 87-94;
primer group for amplifying veillonella parvula as shown in SEQ ID NO. 95-102;
primer groups for amplifying the microomonas as shown in SEQ ID NO. 103-110;
primer groups for amplifying yersinia pneumocystis as shown in SEQ ID NO. 111-114;
primer groups for amplifying the catwalk as shown in SEQ ID NO. 115-118;
primer groups for amplifying the corynebacterium striatum as shown in SEQ ID NO. 119-122;
primer group for amplifying Legionella pneumophila as shown in SEQ ID NO. 123-130;
primer groups for amplifying Acinetobacter baumannii shown in SEQ ID No. 131-136;
primer group for amplifying Moraxella catarrhalis as shown in SEQ ID NO. 137-142;
primer groups for amplifying neisseria meningitidis as shown in SEQ ID nos. 143 to 150;
primer groups for amplifying saccharomyces cerevisiae as shown in SEQ ID NO. 151-156;
primer groups for amplifying aspergillus flavus as shown in SEQ ID No. 157-164;
primer groups for amplifying aspergillus niger shown as SEQ ID NO. 165-172;
primer group for amplifying novel cryptococcus as shown in SEQ ID NO. 173-178;
primer groups for amplifying candida albicans as shown in SEQ ID NO. 179-184;
primer group for amplifying Klebsiella aerogenes as shown in SEQ ID No. 185-192;
primer group for amplifying klebsiella oxytoca as shown in SEQ ID No. 193-198;
primer groups for amplifying klebsiella pneumoniae shown as SEQ ID No. 199-204;
primer groups for amplifying rhizopus microsporidianus shown as SEQ ID NO. 205-212;
primer groups for amplifying haemophilus influenzae shown as SEQ ID No. 213-220;
primer groups for amplifying haemophilus parainfluenza as shown in SEQ ID No. 221-226;
primer groups for amplifying aspergillus fumigatus as shown in SEQ ID No. 227-234;
primer groups for amplifying constellation streptococcus as shown in SEQ ID No. 235-238;
primer sets for amplifying Orientia tsutsugamushi as shown in SEQ ID NOS.239 to 246;
primer groups for amplifying the typhoid rickettsia shown in SEQ ID NO. 247-254;
primer group for amplifying Chlamydia psittaci as shown in SEQ ID NO. 255-258;
primer groups for amplifying the novel Burkholderia cepacia shown in SEQ ID NO. 259-266;
primer group for amplifying escherichia coli as shown in SEQ ID NO. 267-270; and
primer groups for amplifying human bocavirus shown as SEQ ID NO. 271-274.
The composition of the invention can simultaneously amplify and enrich 46 targets in one tube, so that the data volume required by subsequent sequencing is obviously reduced, the analysis work is simplified, and the whole detection is more accurate and efficient.
Further, the primer sets each have a linker sequence to facilitate sequencing.
Still further, the upstream primer adapter sequence is ACACGACGCTCTTCCGATCT (SEQ ID NO. 275) and the downstream primer adapter sequence is CTTGGCACCCGAGAATTCCA (SEQ ID NO. 276).
In some specific embodiments, the ingredients of the composition are present in the same package.
Further, the components of the composition of the present invention are present in a mixed form.
In a second aspect, the present invention provides the use of a composition as described above for the preparation of a kit for high throughput sequencing detection of respiratory pathogens.
In a third aspect, the invention provides a kit for high throughput sequencing detection of respiratory pathogens comprising the composition described above.
Further, the kit further comprises at least one of the following: nucleic acid extraction reagent, nucleic acid amplification reagent, library construction reagent.
Further, the nucleic acid extraction reagent may be a reagent for extracting DNA from a sample such as alveolar lavage fluid or sputum.
Further, the nucleic acid amplification reagents include DNA polymerase, dNTPs, buffer, and Mg 2+ 。
Further, the library construction reagent includes a fragmentation reagent, a terminal repair reagent, a linker ligation reagent, and a library amplification reagent.
In a fourth aspect, the present invention provides a use for preparing a composition for high throughput sequencing detection of respiratory pathogens, wherein the detection comprises:
1) Extracting or releasing nucleic acid of a sample to be tested;
2) Amplifying using a composition as described above to obtain an amplified product;
3) Processing the amplified products and establishing a library; and
5) Sequencing and analyzing the result.
Further, the conditions of the amplification are:
drawings
FIG. 1 is a flow chart of library construction;
FIG. 2 is a schematic diagram of library construction;
FIG. 3 is a graph of library fragment size results.
Detailed Description
The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention. Example 1, primers used in the present invention the primer set used in the present invention is shown in Table 1.
TABLE 1
Example 2 method of high throughput sequencing-based detection of different targets
A specific library construction scheme is shown in FIG. 1. The principle is shown in figure 2, in brief, a specific primer is designed based on a target area of pathogenic microorganism, a general sequence is added to the 5' end of all the specific primers, the nucleic acid to be detected is used as a template for first round of amplification, and the obtained amplification product is added with a label primer for second round of amplification to complete library establishment.
The synthesized multiplex amplification primers (100. Mu.M) with the adaptor sequences were mixed in the same volume.
Sample preparation
gDNA in clinical samples, standard bacterial solutions and national reference bacterial solutions is extracted by using a TIANamp Genomic DNA Kit blood/cell/tissue genome DNA extraction kit, and multiple PCR amplification is performed by using the gDNA as a template. All clinical samples were from the san wilt laboratory, and both standard and national reference bacterial solutions were purchased outsourced.
First round multiplex amplification
Multiplex PCR was performed using the extracted gDNA (40 ng) as a template, using Paragon Genomics mPCR amplification reagents and a mixed primer set, the amplification system was shown in Table 2, and the reaction system was shown in Table 3.
TABLE 2
TABLE 3 Table 3
First round PCR amplification and purification
10ul of non-ribozyme water and 29ul Agencourt AMPure XP magnetic beads are added into each PCR product
Shaking, mixing, standing for 3min, centrifuging, standing on a magnetic rack for 5min, and removing supernatant after magnetic bead adsorption.
200uL of 70% ethanol is added, the centrifuge tube is rotated on a magnetic rack for two weeks, and the supernatant is sucked after the magnetic beads are adsorbed.
And 200uL of 70% ethanol is added, the centrifuge tube is rotated on a magnetic rack for two weeks, and the supernatant is sucked after the magnetic beads are adsorbed.
Removing the supernatant, uncovering the centrifuge tube, standing, airing for 3-5min, adding 10uL TE buffer after airing, shaking, uniformly mixing, standing for 3min, centrifuging after standing, placing the centrifuge tube on a magnetic frame, and transferring the centrifuge tube into a new centrifuge tube after the magnetic beads are adsorbed.
Library fragmentation
10ul of purified PCR product was taken and Paragon Genomics was usedThe reagent kit for constructing the NGS Pane library is prepared by the following system, and the reaction reagent is fragmented at 37 ℃ for 10 min. 29ul Agencourt AMPure XP beads were then added for purification.
TABLE 4 Table 4
| Reagent name | Volume (mul) |
| PCR products | 13 |
| CP Reagent Buffer | 2 |
| CP Digestion Reagent | 2 |
| Non-ribozyme water | 3 |
Library amplification
The product after fragmentation and purification is used as a template, a library amplification reaction system is configured according to the table 5, the i5/i7index used is required to be synthesized by itself, a PCR reaction is carried out according to a program, after the reaction is completed, 40ul Agencourt AMPure XP magnetic beads are added for purification, and then the library construction is completed.
TABLE 5
| Reagent name | Volume (mul) |
| Fragmentation products | 10 |
| 5x 2nd PCR mix | 8 |
| i5/i7 index | 4 |
| Non-ribozyme water | 18 |
PCR amplification was performed using a cypress constant tech GE series PCR apparatus GE482-A with the following cycle parameters set:
library quality inspection upper machine
By usingdsDNA HS Assay Kit library concentrations were determined. The specific operation is as follows:
preparation of a standard: qubit dsDNA HS Master Mix was dispensed into 2 centrifuge tubes of standard at 190. Mu.L, 10. Mu.L of standard Qubit dsDNA HS Standard #1 and Qubit dsDNA HS Standard #2 were added, respectively, and vortexed for further use, taking care that no air bubbles were present.
1 mu L of a sample to be measured is taken, qubit dsDNA HS Master Mix mu L of the sample is uniformly mixed by vortex, and no bubbles are generated.
The prepared standard and sample were left to react at room temperature for 3min, and library concentration was determined using a Qubit 3.0 fluorometer.
The size of the library fragments is detected by using a LabChip GX capillary electrophoresis apparatus, and the fragment sizes are concentrated at 200-300bp, as shown in FIG. 3.
Sequencing on machine
And (5) placing the library neutralization solution and the hybridization solution in an ice box for pre-cooling for standby.
As a denatured liquid, 0.2M NaOH was prepared.
Library stock was diluted to 4nM with pre-chilled library dilutions, and then library denaturation was performed as described in Table 6 below to prepare a 20pM library.
TABLE 6
The sample was gently vortexed and mixed, and after rapid centrifugation, placed on ice for further use.
A clean 2mL centrifuge tube equipped in the kit is used as a container for loading the library.
The machine is started according to 2.5pM (the machine quality can be adjusted automatically according to the actual sequencing data), 187.5 mu L of 20pM library and 1312.5 mu L of hybridization solution are taken and mixed uniformly, vibrated, mixed uniformly and centrifuged, and placed on ice for standby.
High throughput sequencing was run on a Santhreeq 1000 platform and the library was placed in the library well site of the sequencing kit in the on-machine mode of SE75 +8. The machine was started up at 2M/sample.
Analysis of results
Sequencing results show that the primer set can specifically amplify target sequences and realize pathogen detection under 2M data volume. The data volume required by the experimental method is far smaller than the data volume (20M) required by metagenomic sequencing, so that the accurate and reliable result is ensured, the method is more economical and efficient, and the workload is greatly reduced.
Example 3 detection results of test samples of the inventive composition
gDNA pooled samples of 46 respiratory pathogens were tested as in example 2 using the compositions shown in Table 1. The detection results are shown in Table 9 below. Comparing the off-line data reads with pathogen reference genome by mem algorithm of BWA software, and taking the optimally compared reads with score more than 30 as the reads detected by the method. From the results, it can be seen that the composition of the present invention is capable of amplifying and enriching all targets within a tube, is detected in subsequent sequencing assays, and requires a greatly reduced amount of data.
TABLE 9
/>
/>
/>
/>
Claims (10)
1. A composition for detecting respiratory pathogens based on high throughput sequencing comprising at least 4 targets in the primer set as follows:
primer groups for amplifying human respiratory virus type 1 shown in SEQ ID NO. 1-4;
a primer group for amplifying human respiratory virus type 3 as shown in SEQ ID NO. 5-10;
a primer group for amplifying human rubella virus type 4 as shown in SEQ ID NO. 11-14;
primer groups for amplifying influenza B viruses shown as SEQ ID NO. 15-18;
primer groups for amplifying human pneumovirus shown as SEQ ID NO. 19-22;
primer group for amplifying Coxsackie virus A6 as shown in SEQ ID NO. 23-30;
a primer set for amplifying human type B herpesvirus type 5 as shown in SEQ ID NO. 31-34;
primer groups for amplifying human staphylococcus as shown in SEQ ID NO. 35-38;
primer groups for amplifying listeria as shown in SEQ ID NO. 39-40;
primer groups for amplifying the corynebacterium diphtheriae as shown in SEQ ID NO. 41-48;
primer groups for amplifying mycobacterium avium shown as SEQ ID NO. 49-52;
primer groups for amplifying the mycobacterium tuberculosis as shown in SEQ ID NO. 53-56;
primer groups for amplifying human mycoplasma as shown in SEQ ID NO. 57-64;
primer group for amplifying mycoplasma pneumoniae as shown in SEQ ID No. 65-66;
primer groups for amplifying the pseudostreptococcus pneumoniae shown in SEQ ID NO. 67-74;
primer groups for amplifying light streptococcus as shown in SEQ ID NO. 75-78;
primer group for amplifying burkholderia melitensis shown in SEQ ID No. 79-86;
primer groups for amplifying pseudomonas aeruginosa as shown in SEQ ID NO. 87-94;
primer group for amplifying veillonella parvula as shown in SEQ ID NO. 95-102;
primer groups for amplifying the microomonas as shown in SEQ ID NO. 103-110;
primer groups for amplifying yersinia pneumocystis as shown in SEQ ID NO. 111-114;
primer groups for amplifying the catwalk as shown in SEQ ID NO. 115-118;
primer groups for amplifying the corynebacterium striatum as shown in SEQ ID NO. 119-122;
primer group for amplifying Legionella pneumophila as shown in SEQ ID NO. 123-130;
primer groups for amplifying Acinetobacter baumannii shown in SEQ ID No. 131-136;
primer group for amplifying Moraxella catarrhalis as shown in SEQ ID NO. 137-142;
primer groups for amplifying neisseria meningitidis as shown in SEQ ID nos. 143 to 150;
primer groups for amplifying saccharomyces cerevisiae as shown in SEQ ID NO. 151-156;
primer groups for amplifying aspergillus flavus as shown in SEQ ID No. 157-164;
primer groups for amplifying aspergillus niger shown as SEQ ID NO. 165-172;
primer group for amplifying novel cryptococcus as shown in SEQ ID NO. 173-178;
primer groups for amplifying candida albicans as shown in SEQ ID NO. 179-184;
primer group for amplifying Klebsiella aerogenes as shown in SEQ ID No. 185-192;
primer group for amplifying klebsiella oxytoca as shown in SEQ ID No. 193-198;
primer groups for amplifying klebsiella pneumoniae shown as SEQ ID No. 199-204;
primer groups for amplifying rhizopus microsporidianus shown as SEQ ID NO. 205-212;
primer groups for amplifying haemophilus influenzae shown as SEQ ID No. 213-220;
primer groups for amplifying haemophilus parainfluenza as shown in SEQ ID No. 221-226;
primer groups for amplifying aspergillus fumigatus as shown in SEQ ID No. 227-234;
primer groups for amplifying constellation streptococcus as shown in SEQ ID No. 235-238;
primer sets for amplifying Orientia tsutsugamushi as shown in SEQ ID NOS.239 to 246;
primer groups for amplifying the typhoid rickettsia shown in SEQ ID NO. 247-254;
primer group for amplifying Chlamydia psittaci as shown in SEQ ID NO. 255-258;
primer groups for amplifying the novel Burkholderia cepacia shown in SEQ ID NO. 259-266;
primer group for amplifying escherichia coli as shown in SEQ ID NO. 267-270; or (b)
Primer groups for amplifying human bocavirus shown as SEQ ID NO. 271-274.
2. The composition of claim 1, comprising at least 10 targets in the primer set as set forth above.
3. A composition according to claim 2, comprising:
primer groups for amplifying human respiratory virus type 1 shown in SEQ ID NO. 1-4;
a primer group for amplifying human respiratory virus type 3 as shown in SEQ ID NO. 5-10;
a primer group for amplifying human rubella virus type 4 as shown in SEQ ID NO. 11-14;
primer groups for amplifying influenza B viruses shown as SEQ ID NO. 15-18;
primer groups for amplifying human pneumovirus shown as SEQ ID NO. 19-22;
primer group for amplifying Coxsackie virus A6 as shown in SEQ ID NO. 23-30;
a primer set for amplifying human type B herpesvirus type 5 as shown in SEQ ID NO. 31-34;
primer groups for amplifying human staphylococcus as shown in SEQ ID NO. 35-38;
primer groups for amplifying listeria as shown in SEQ ID NO. 39-40;
primer groups for amplifying the corynebacterium diphtheriae as shown in SEQ ID NO. 41-48;
primer groups for amplifying mycobacterium avium shown as SEQ ID NO. 49-52;
primer groups for amplifying the mycobacterium tuberculosis as shown in SEQ ID NO. 53-56;
primer groups for amplifying human mycoplasma as shown in SEQ ID NO. 57-64;
primer group for amplifying mycoplasma pneumoniae as shown in SEQ ID No. 65-66;
primer groups for amplifying the pseudostreptococcus pneumoniae shown in SEQ ID NO. 67-74;
primer groups for amplifying light streptococcus as shown in SEQ ID NO. 75-78;
primer group for amplifying burkholderia melitensis shown in SEQ ID No. 79-86;
primer groups for amplifying pseudomonas aeruginosa as shown in SEQ ID NO. 87-94;
primer group for amplifying veillonella parvula as shown in SEQ ID NO. 95-102;
primer groups for amplifying the microomonas as shown in SEQ ID NO. 103-110;
primer groups for amplifying yersinia pneumocystis as shown in SEQ ID NO. 111-114;
primer groups for amplifying the catwalk as shown in SEQ ID NO. 115-118;
primer groups for amplifying the corynebacterium striatum as shown in SEQ ID NO. 119-122;
primer group for amplifying Legionella pneumophila as shown in SEQ ID NO. 123-130;
primer groups for amplifying Acinetobacter baumannii shown in SEQ ID No. 131-136;
primer group for amplifying Moraxella catarrhalis as shown in SEQ ID NO. 137-142;
primer groups for amplifying neisseria meningitidis as shown in SEQ ID nos. 143 to 150;
primer groups for amplifying saccharomyces cerevisiae as shown in SEQ ID NO. 151-156;
primer groups for amplifying aspergillus flavus as shown in SEQ ID No. 157-164;
primer groups for amplifying aspergillus niger shown as SEQ ID NO. 165-172;
primer group for amplifying novel cryptococcus as shown in SEQ ID NO. 173-178;
primer groups for amplifying candida albicans as shown in SEQ ID NO. 179-184;
primer group for amplifying Klebsiella aerogenes as shown in SEQ ID No. 185-192;
primer group for amplifying klebsiella oxytoca as shown in SEQ ID No. 193-198;
primer groups for amplifying klebsiella pneumoniae shown as SEQ ID No. 199-204;
primer groups for amplifying rhizopus microsporidianus shown as SEQ ID NO. 205-212;
primer groups for amplifying haemophilus influenzae shown as SEQ ID No. 213-220;
primer groups for amplifying haemophilus parainfluenza as shown in SEQ ID No. 221-226;
primer groups for amplifying aspergillus fumigatus as shown in SEQ ID No. 227-234;
primer groups for amplifying constellation streptococcus as shown in SEQ ID No. 235-238;
primer sets for amplifying Orientia tsutsugamushi as shown in SEQ ID NOS.239 to 246;
primer groups for amplifying the typhoid rickettsia shown in SEQ ID NO. 247-254;
primer group for amplifying Chlamydia psittaci as shown in SEQ ID NO. 255-258;
primer groups for amplifying the novel Burkholderia cepacia shown in SEQ ID NO. 259-266;
primer group for amplifying escherichia coli as shown in SEQ ID NO. 267-270; and
primer groups for amplifying human bocavirus shown as SEQ ID NO. 271-274.
4. A composition according to any one of claims 1 to 3, wherein the primer sets each bear a linker sequence.
5. The composition of claim 4, wherein the sequence of the upstream primer adapter sequence of SEQ ID NO. 275: ACACGACGCTCTTCCGATCT, the sequence shown in the downstream primer adapter sequence SEQ ID NO. 276: CTTGGCACCCGAGAATTCCA.
6. The composition of claim 5, wherein the components of the composition are present in a mixed form.
7. Use of a composition according to any one of claims 1 to 6 for the preparation of a kit for high throughput sequencing detection of respiratory pathogens.
8. A kit for high throughput sequencing detection of respiratory pathogens comprising the composition of any one of claims 1 to 6.
9. The kit of claim 8, further comprising at least one of: nucleic acid extraction reagent, nucleic acid amplification reagent, library construction reagent.
10. Use of a composition for preparing a high throughput sequencing assay for respiratory pathogens, wherein the assay comprises:
1) Extracting or releasing nucleic acid of a sample to be tested;
2) Amplifying using the composition of any one of claims 1 to 6 to obtain an amplified product;
3) Processing the amplified products and establishing a library; and
5) Sequencing and analyzing the result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311654861.7A CN117625848A (en) | 2023-12-04 | 2023-12-04 | Composition for detecting respiratory pathogens based on high throughput sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311654861.7A CN117625848A (en) | 2023-12-04 | 2023-12-04 | Composition for detecting respiratory pathogens based on high throughput sequencing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117625848A true CN117625848A (en) | 2024-03-01 |
Family
ID=90025149
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311654861.7A Pending CN117625848A (en) | 2023-12-04 | 2023-12-04 | Composition for detecting respiratory pathogens based on high throughput sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117625848A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117867180A (en) * | 2024-03-12 | 2024-04-12 | 北京雅康博生物科技有限公司 | Primer combination, kit and application for detecting respiratory tract pathogens |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112852937A (en) * | 2021-03-10 | 2021-05-28 | 美格医学检验所(广州)有限公司 | Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof |
| CN116287357A (en) * | 2023-05-16 | 2023-06-23 | 北京百奥益康医药科技有限公司 | Respiratory tract pathogenic bacteria detection kit based on targeted amplicon sequencing |
-
2023
- 2023-12-04 CN CN202311654861.7A patent/CN117625848A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112852937A (en) * | 2021-03-10 | 2021-05-28 | 美格医学检验所(广州)有限公司 | Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof |
| CN116287357A (en) * | 2023-05-16 | 2023-06-23 | 北京百奥益康医药科技有限公司 | Respiratory tract pathogenic bacteria detection kit based on targeted amplicon sequencing |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117867180A (en) * | 2024-03-12 | 2024-04-12 | 北京雅康博生物科技有限公司 | Primer combination, kit and application for detecting respiratory tract pathogens |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111254228B (en) | Kit for detecting novel coronavirus and influenza virus | |
| WO2020118978A1 (en) | Method for constructing metagenomic sample library on basis of nanopore sequencing platform, identification method and kit | |
| CN111286530B (en) | Primer group and kit for detecting 27 respiratory pathogens based on nucleic acid mass spectrometry and application of primer group and kit | |
| CN112852937B (en) | Respiratory tract pathogenic microorganism detection primer combination, kit and application thereof | |
| CN117625848A (en) | Composition for detecting respiratory pathogens based on high throughput sequencing | |
| CN112195275A (en) | Primer group, kit and method for LAMP combined detection of influenza A virus, influenza B virus and novel coronavirus | |
| CN112359145A (en) | Multiple primers and kit for rapidly detecting influenza A, influenza B and novel coronavirus | |
| CN111575348A (en) | Metagenome library, and library construction method and application thereof | |
| CN111304285B (en) | Urinary metagenome sample library building and detecting method based on nanopore sequencing platform | |
| CN111808995A (en) | Respiratory tract pathogen nucleic acid detection kit | |
| CN116287357A (en) | Respiratory tract pathogenic bacteria detection kit based on targeted amplicon sequencing | |
| CN113265452A (en) | Bioinformatics pathogen detection method based on Nanopore metagenome RNA-seq | |
| CN117089653A (en) | Compositions for RNA virus detection based on high throughput amplicon sequencing | |
| CN111304286B (en) | Urinary metagenome sample library building and detecting method based on nanopore sequencing | |
| CN112410465A (en) | Novel coronavirus SARS-CoV-2ORF1ab and N gene constant temperature amplification primer group and kit | |
| CN111549118A (en) | Primer group, probe and kit for detecting polymorphism of three-high drug gene by hands-free direct amplification and method thereof | |
| CN114836580B (en) | Multiplex qPCR detection primer combination for respiratory tract infectious disease pathogens | |
| CN115896356A (en) | Reagent for detecting nucleic acid of novel coronavirus, influenza A virus and influenza B virus and application of reagent | |
| CN115725784A (en) | Kit and method for detecting pathogens related to respiratory tract infection | |
| CN113337637B (en) | Primer group and kit for molecular detection of SARS-CoV-2 coronavirus | |
| CN114107454A (en) | Respiratory tract infection pathogen detection method based on macrogene/macrotranscriptome sequencing | |
| CN113549709A (en) | Primer pair, probe and kit for detecting SARS-CoV-2 by utilizing nested RPA technology and application thereof | |
| CN114990261B (en) | Multiplex qPCR detection reagent for detecting respiratory tract infectious disease pathogens | |
| CN117144031A (en) | Composition for gram-negative bacterial detection based on high throughput amplicon sequencing | |
| CN117660663A (en) | Method for detecting whole exons by oral swab |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |