CN117603964A

CN117603964A - Polygene methylation joint detection reagent and kit

Info

Publication number: CN117603964A
Application number: CN202410042084.9A
Authority: CN
Inventors: 吴孝林; 刘伟芳; 罗茵
Original assignee: Guangzhou Decheng Biotechnology Co ltd
Current assignee: Guangzhou Decheng Biotechnology Co ltd
Priority date: 2024-01-11
Filing date: 2024-01-11
Publication date: 2024-02-27

Abstract

The invention discloses a polygene methylation joint detection reagent and a kit, belongs to the field of biological medicines, and particularly relates to a primer, a probe, a methylation detection reagent, a kit and application thereof. The invention is found by research: colorectal cancer specimens can be well distinguished from fecal specimens by detecting the methylation level of the combined promoter regions of the COL4A1/COL4A2 and APBA2 genes. The invention uses the methylation reagent containing the gene combination to detect colorectal cancer, and has very high detection sensitivity and specificity to intestinal cancer, and can reach more than 90 percent.

Description

Polygene methylation joint detection reagent and kit

Technical Field

The invention discloses a polygene methylation joint detection reagent and a kit, and belongs to the technical field of biological medicines. The primer probe combination provided by the invention comprises a specific primer and a probe aiming at human intestinal cancer, and the detection reagent or the kit can be used for realizing high-specificity, high-sensitivity and high-efficiency detection of human intestinal cancer.

Background

Colorectal cancer, also called colorectal cancer, is a common malignant tumor of the digestive tract, and the incidence rate of colorectal cancer is increased year by year in China. Colorectal cancer is hidden in early onset, has no obvious symptoms, and can cause symptoms such as hematochezia, abdominal pain, diarrhea and the like in late stage. And often late when symptomatic visits occur, which can be a significant affliction and costly treatment expense for the patient. Early discovery, early diagnosis, early treatment are therefore an important measure in reducing colorectal cancer morbidity and mortality.

Screening can find intestinal cancer and precancerous lesions at early stage and remove lesions, thereby preventing intestinal cancer. Fecal gene detection is now becoming more and more important as a new screening method for intestinal cancer. This method was incorporated in 2016 in the us as a guideline for bowel cancer screening. The method has the advantages of convenience, no wound, and high detection rate for intestinal cancer and precancerous lesion adenoma. To be made into a fecal gene detection kit for detecting intestinal cancer, two major obstacles need to be overcome: extraction of fecal DNA and marker selection. On the one hand, the components in the feces are complex, the inhibitors to downstream reactions are numerous, and many bacterial DNAs are required to extract the target genes of human beings from such mixtures, and a highly sensitive gene extraction and purification method is required; on the other hand, many markers are currently associated with intestinal cancer, especially DNA methylation markers, as studies have shown that DNA methylation is an early event in tumor formation. Many methylation markers, however, perform well at the cellular and tissue level and have significantly reduced sensitivity and specificity to intestinal cancer when used in screening media such as stool, blood, and the like.

In addition, the pathogenesis of colorectal cancer is complex, and thus the colorectal cancer is a polygenic genetic disease. The screening of methylation markers which are complementary to each other is required to improve the sensitivity and specificity of detection, and at least 3 genes need to be tested by the current polygenic methylation detection reagent. For example, chinese patent CN109207592a analyzed a model of multiple markers for colorectal cancer, where the sensitivity of joint detection of SEPT9, NDRG4, SDC2 was only 88.6% and the specificity was only 89.1%; in the detection models of various combinations of KRAS, BMP3, NDRG4, SEPT9 and SDC2, the AUC value of the ROC curve is only 0.912 at most, and 5 gene markers need to be detected in a combined mode at the same time to obtain the AUC of 0.912. Chinese patent CN11033114a provides a methylation joint detection reagent for detecting 3 (4) gene markers, and by detecting SDC2, COL4A1/COL4A2 and ITGA4 genes, the sensitivity and specificity of detection of colorectal cancer are both higher than 90%.

Therefore, the selection of the marker combination with extremely high detection sensitivity and specificity to the intestinal cancer in the feces is the key of the intestinal cancer fecal gene detection, and the marker combination is hopeful to be truly used for the clinical detection of the intestinal cancer, and the design of good primers and probes is one of the influencing factors influencing the function of the marker combination.

In view of the above, there is an urgent need for development of a methylation-associated detection reagent that has high sensitivity and specificity for detecting intestinal cancer and that has few detection genes.

Disclosure of Invention

In order to overcome the defects in the prior art, the invention provides a polygene methylation joint detection reagent and a kit. The primer group provided by the invention can cover all subgenera of adenovirus, and solves the problems of less cover type, low detection efficiency, poor specificity and low sensitivity of the kit in the prior art.

In order to achieve the above object, in a first aspect of the present invention, there is provided a primer combination of SEQ ID NO:1 and SEQ ID NO: 2. SEQ ID NO:13 and SEQ ID NO:14, a primer pair combination shown in FIG. 14; or (b)

SEQ ID NO:1 and SEQ ID NO: 2. SEQ ID NO:16 and SEQ ID NO:17, a primer pair combination shown in fig; or (b)

SEQ ID NO:4 and SEQ ID NO: 5. SEQ ID NO:13 and SEQ ID NO:14, a primer pair combination shown in FIG. 14; or (b)

SEQ ID NO:4 and SEQ ID NO: 5. SEQ ID NO:16 and SEQ ID NO: 17.

In a second aspect of the present invention, there is provided a probe of the above primer combination, wherein the probe is a probe combination, and the probe combination is a probe of SEQ ID NO:3 and SEQ ID NO:15, and a combination of sequences shown in seq id no; or (b)

SEQ ID NO:3 and SEQ ID NO:18, and a combination of sequences shown in seq id no; or (b)

SEQ ID NO:6 and SEQ ID NO:15, and a combination of sequences shown in seq id no; or (b)

SEQ ID NO:6 and SEQ ID NO:18, and a combination of sequences shown in seq id no.

In a third aspect of the present invention, there is provided a polygene methylation joint detection reagent, the genes being an APBA2 (also known as MINT 2) promoter region and a COL4A1/COL4A2 gene homology region, comprising primers for methylation detection of each gene;

the primer is SEQ ID NO:1 and SEQ ID NO: 2. SEQ ID NO:13 and SEQ ID NO:14, a primer pair combination shown in FIG. 14; or (b)

SEQ ID NO:4 and SEQ ID NO: 5. SEQ ID NO:16 and SEQ ID NO: 17.

Further, the methylation detection reagent provided by the invention can detect the methylation level of the genome, the intergenic region or the promoter region of each gene in the COL4A1/COL4A2 and APBA2 gene combination and the region near the promoter region.

"COL4A1/COL4A2" in the present invention means "COL4A1 or COL4A2". The human genes COL4A1 and COL4A2 are closely linked at the distal end of the long arm of chromosome 13, which are in a "head-to-head" positional relationship and in opposite transcription directions. The 5' ends of COL4A1 and COL4A2 genes are close, 127bp is separated, and the sequence is a bidirectional promoter region shared by the two genes. Therefore, the sequence designed based on the bidirectional promoter shared by both may be either for COL4A1 or COL4A2. In the present invention, sequence information is labeled with either COL4A1 or COL4A2, and the two are not distinguished.

Further, probes for methylation detection of each gene are also included.

Further, the probe is SEQ ID NO:3 and SEQ ID NO:15, and a combination of sequences shown in seq id no; or (b)

In a fourth aspect of the present invention, there is provided a kit comprising the above primer combination and the above probe, or the above reagent.

Further, the kit comprises: a first container comprising a primer combination for amplification; a second container comprising a probe.

Further, the kit provided by the invention also comprises reagents commonly used in the kit, such as a conversion agent commonly used in qMSP, for converting unmethylated cytosine bases into uracil, while methylated cytosine bases remain unchanged. The converting agent is not particularly limited, and the agents reported in the prior art to effect the conversion of cytosine to uracil may be, for example, one or more of hydrazine salt, bisulfite and bisulfite (e.g., sodium metabisulfite, potassium hydrogen sulfite, cesium hydrogen sulfite, ammonium hydrogen sulfite, etc.). Such as DNA polymerase, dNTPs, mg2+ ions, buffers, etc., which are commonly used in amplifying the COL4A1 gene.

Further, the amplification is PCR amplification.

Further, the PCR reaction system is as follows: DNA polymerase 0.6. Mu.l, 5 Xbuffer 5. Mu.l, 100. Mu.M upstream primer 0.12. Mu.l, 100. Mu.M downstream primer 0.12. Mu.l, 100. Mu.M probe 0.06. Mu.l 10mM dNTPMix 1. Mu.l, DNA template 10. Mu.l, ddH2O 13.1. Mu.l total volume 30. Mu.l.

Further, the PCR reaction was conducted at 95℃for 5min, (95℃for 15sec,58℃for 30sec,72℃for 20 sec) 45 cycles, 40℃for 30sec.

Further, the APBA2 gene probe and the COL4A1/COL4A2 gene probe in the kit select the same fluorescence labeling group (FAM) to detect in the same reaction well. The amplification of the reference gene ACTB is reported simultaneously by another fluorescent group (texas red) in the kit.

Further, in the FAM channel of the kit, no amplification curve or sample with Ct value more than 38 is a negative sample; the sample with S-shaped amplification curve and Ct value less than or equal to 38 is a positive sample.

In a fourth aspect of the invention, there is provided a primer combination as defined above and a probe as defined above, or the use of the above-defined reagents in the preparation of a reagent or kit for methylation detection, or in the preparation of a reagent or kit for detection of colorectal cancer, for detection of a sample to be tested being stool.

Further, the primer combination or the reagent is detected in the same reaction well.

The nucleic acid detection method according to the present invention is used for non-diagnostic purposes.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides a primer probe group which firstly provides and designs the APBA2 gene and the COL4A1/COL4A2 gene with complementary characteristics, and provides more choices and research directions for colorectal cancer detection.

The sensitivity of the methylation reagent and the kit for detecting colorectal cancer is 91.07%, and the specificity is 95.24%; the area under the curve (AUG value) for colorectal cancer detection and non-cancer detection was 0.96.

Drawings

FIG. 1 is an amplification curve of primer probe set 1 for APBA2 gene in the example of the present invention.

FIG. 2 is an amplification curve of primer probe set 2 for APBA2 gene in the example of the present invention.

FIG. 3 is an amplification curve of primer probe set 3 for APBA2 gene in the example of the present invention.

FIG. 4 is an amplification curve of primer probe set 1 for COL4A1/COL4A2 genes in an embodiment of the present invention.

FIG. 5 is an amplification curve of primer probe combination 2 for COL4A1/COL4A2 genes in an embodiment of the present invention.

FIG. 6 is an amplification curve of primer probe set 3 for COL4A1/COL4A2 genes in an embodiment of the present invention.

FIG. 7 is an amplification curve of primer probe set 4 for COL4A1/COL4A2 genes in an embodiment of the present invention.

FIG. 8 is a graph showing statistical analysis of the results of clinical stool sample testing in an embodiment of the present invention.

FIG. 9 is a graph showing comparison of the results of amplification of clinical stool samples alone and in combination with the amplification test in the examples of the present invention.

Detailed Description

In order that the invention may be more readily understood, the invention will be further described with reference to the following examples. It is to be understood that these examples are intended to illustrate the invention and are not to be construed as limiting the scope of the invention, and that the specific experimental methods not mentioned in the following examples are generally carried out in accordance with conventional experimental methods in the art; specific reagents and equipment not mentioned are generally conventional in the art.

Example 1

For the APBA2 gene amplified sequence (without CT transformation, original sequence)

CCGGGGCAAGGTGCGGAGCCTCGCGTTCACCGGCTCTACCTGCGGAGCCTCGCG TTCACTGGCTCTACCTGCGGGACCAGACCCCTGCAGCTCCCCAGCCAGCACGGCCGG GGCACGCCCGGGAATCTGTGTGCTCCCC(SEQ ID NO：22)

As a target gene, primer probe design was performed.

Primer probe design used software lazergene, primer and probe synthesis company was Bai Li Ge Biotechnology (Shanghai) Co., ltd.

The primer sequences related to the methylation detection of the APBA2 gene are as follows:

combination 1:

an upstream primer CGGTTTTATTTGCGGAGTTTCAC (SEQ ID NO: 1),

A downstream primer: AAATTCCCGAACGTACCCAG (SEQ ID NO: 2),

Probe TGGTTTTATTTGCGGGATTAGATTTTTGTAG (SEQ ID NO: 3);

combination 2:

an upstream primer: GGGGTAAGGTGCGGAGTTTCTC (SEQ ID NO: 4)

A downstream primer: AAACACACAAATTCCCGAACG (SEQ ID NO: 5)

And (3) probe: TGGTTTTATTTGCGGGATTAGATTTTTGTAG (SEQ ID NO: 6);

combination 3: upstream primer CGGTTTTATTTGCGGAGTTTCAC (SEQ ID NO: 7)

A downstream primer: AAATTCCCGAACGTACCCAG (SEQ ID NO: 8)

Probe GTTAGTACGGTCGGGGTACGTTCGGG (SEQ ID NO: 9)

The combination 1, 2 and 3 was used to amplify the converted DNA of the stool sample of the intestinal cancer, the converted DNA of the stool sample of the normal person and the template-free control, respectively. The discrimination capability of each combination for different samples was compared. The results are shown in Table 1 and FIGS. 1-3.

The PCR reaction system is as follows: DNA polymerase 0.6. Mu.l, 5 Xbuffer 5. Mu.l, 100. Mu.M upstream primer 0.12. Mu.l, 100. Mu.M downstream primer 0.12. Mu.l, 100. Mu.M probe 0.06. Mu.l 10mM dNTP mix 1. Mu.l, DNA template 10. Mu.l, ddH2O 13.1. Mu.l total volume 30. Mu.l.

The PCR was run at 95℃for 5min, (95℃for 15sec,58℃for 30sec,72℃for 20 sec) 45 cycles, 40℃for 30sec.

TABLE 1

From Table 1 and FIGS. 1 to 3, from the results of the amplification in the three combinations, DNA obtained after transformation of intestinal cancer and normal human faeces samples in combination 3 and the template-free control APBA2 gene were amplified, indicating that there was non-specific amplification between the primer probes, and therefore, it was not suitable as a detection sequence for the marker. The APBA2 gene in the stool samples of the intestinal cancer patients in the combination 1 and the combination 2 is amplified, and the normal person and the template-free control are not amplified, so that the marker is suitable for being used as a detection sequence of the marker. The amount of fluorescence on the vertical axis of the amplification curve for combination 1 is slightly higher than that for combination 2, so in the subsequent examples the kit selects combination 1 as the primer and probe combination for subsequent detection.

Example 2

For COL4A1/COL4A2 gene amplified sequences (not CT transformed, primordial sequence)

TCCCAACCCCTCGCGCCCGCGCGTTCGCGGATCCAGGCCGAGGACCGAAAGGGGCCGCCCGAGCCCCCGGGGCCGGCGCCCAGAGAGCCCAGCAAGGCCGGCCGCCCTGCCGGTGTGCCGCCGGCGGGTGCTTCTGGAAGGGCCAATGCGTTCGGGCAGCAGCCCCTGAAGCCGAGCCCGAGGTGAGAGCGACCCCCGAGCGGCGCCCAGACCCTGGC(SEQ ID NO：23)

As a target gene, primer probe design was performed.

Primer combination related to COL4A1 gene and COL4A2 gene homologous region:

combination 1 upstream primer: CGTTCGAGTTTTCGGGATC (SEQ ID NO: 10)

A downstream primer: TTAACCCTTCCAAAAACACCAG (SEQ ID NO: 11)

And (3) probe: GGTCGGTCGTTTTGTCGGTGTGTCGTCGG (SEQ ID NO: 12)

Combined 2 upstream primer CGTTCGAGTTTTCGGGATC (SEQ ID NO: 13)

A downstream primer: TTAACCCTTCCAAAAACACCAG (SEQ ID NO: 14)

And (3) probe: CCCGCCGACGACACACCGACAAAACGACCGACC (SEQ ID NO: 15)

Combination 3, upstream primer CGTTCGAGTTTTCGGGATC (SEQ ID NO: 16)

A downstream primer: TCGCTCTCACCTCGAACTCG (SEQ ID NO: 17)

And (3) probe: CCCGCCGACGACACACCGACAAAACGACCGACC (SEQ ID NO: 18)

Combined 4 upstream primer GGTCGTTCGAGTTTTCGGGATC (SEQ ID NO: 19)

A downstream primer: TCGCTCTCACCTCGAACTCG (SEQ ID NO: 20)

And (3) probe: CCCGCCGACGACACACCGACAAAACGACCGACC (SEQ ID NO: 21)

The combinations 1, 2, 3 and 4 were used to amplify the converted DNA of the stool sample of the intestinal cancer, the converted DNA of the stool sample of the normal person and the template-free control, respectively. The discrimination capability of each combination for different samples was compared and the results are shown in table 2 and fig. 4-7.

The PCR reaction system is as follows: DNA polymerase 0.6. Mu.l, 5 Xbuffer 5. Mu.l, 100. Mu.M upstream primer 0.12. Mu.l, 100. Mu.M downstream primer 0.12. Mu.l, 100. Mu.M probe 0.06. Mu.l 10mM dNTPMix 1. Mu.l, DNA template 10. Mu.l, ddH2O 13.1. Mu.l total volume 30. Mu.l.

TABLE 2

As shown in fig. 4-7, the COL4A1 gene and the COL4A2 gene homologous region primer probe combinations 2 and 3 are amplified in the intestinal cancer sample, and are not amplified in the normal human and the template-free control sample, so that the requirements of screening and detecting the intestinal cancer are met. Therefore, in the following examples, the kit selects combination 3 with smaller amplification Ct value and higher amplification efficiency as the primer probe combination.

Example 3

A kit for detecting intestinal cancer,

in the kit, PCR amplification primers and a probe APBA2 gene selection combination 1 and COL4A1/COL4A2 gene selection combination 3 are amplified. In the kit, the APBA2 gene probe and the COL4A1/COL4A2 gene probe select the same fluorescence labeling group (FAM) to detect in the same reaction hole. The amplification of the reference gene ACTB is reported simultaneously by another fluorescent group (texas red) in the kit.

1. The kit components are shown in table 3.

TABLE 3 Table 3

2. The detection flow of the kit is as follows:

2.1 pretreatment of samples

Fecal samples containing DNA preservation solutions were vortexed at 2500 rpm.

2.2 centrifugation

The stool samples were centrifuged at 4000rpm for 10 minutes.

2.3 column passing

3.2mL of the centrifuged fecal supernatant was added to the filter column and centrifuged at 4000rpm for 5 minutes.

2.4 column is abandoned

Discarding the inner column of the filter column.

3mL of each thawed negative quality control product and each 3mL of each positive quality control product are respectively added into a new 10mL centrifuge tube.

2.5 cleavage

And respectively adding 2mL of lysate into a sample to be detected, a negative quality control product and a positive quality control product, simultaneously adding 50 mu L of magnetic beads M1, screwing a cover, then rapidly separating at 2000rpm, taking out the centrifuge tube, and placing the centrifuge tube on a multitube mixing instrument for shaking at 1900rpm for 8 seconds for mixing uniformly.

2.6 incubation

The centrifuge tube is placed on a dry thermostat, incubated for 15 minutes at 95 ℃, taken out, and kept stand for 30 minutes at room temperature (20 ℃ to 30 ℃).

2.7 transfer

After the flash at 2000rpm, the centrifuge tube was placed in a10 mL magnet rack for 5 minutes, about 4.2mL of liquid was pipetted off, the remaining liquid was blown off with a pipette to mix the beads, and transferred to a new 2mL centrifuge tube.

After brief centrifugation, the tube was placed in a 2mL magnet rack for 1-3 minutes, and the liquid was pipetted off.

2.8 washing liquid 1 washing

Adding 800 mu L of washing liquid 1, shaking by vortex until no visible magnetic bead mass exists, centrifuging briefly, placing the centrifuge tube in a constant temperature mixer, incubating for 1 minute at 1300rpm at room temperature, placing the centrifuge tube in a magnetic rack for 1-3 minutes after centrifuging briefly, and sucking off liquid. This operation was repeated for washing once. After centrifugation again briefly, the solution was placed on a magnetic rack for 1 minute and the solution was removed.

2.9 conversion

Adding 50 mu L of solution A, washing off magnetic beads on the tube wall by vortex vibration, centrifuging briefly, placing in a constant temperature mixer, incubating for 5 minutes at 1300rpm at room temperature, placing the centrifuge tube in a magnetic rack for 1-3 minutes after centrifuging briefly, and transferring the solution to a new 2mL centrifuge tube.

100 μl of solution B was added, vortexed and centrifuged briefly, and incubated at 65deg.C for 30 min in a constant temperature mixer and centrifuged briefly.

2.10 purification

Adding 400 mu L of the combined solution added with the absolute ethyl alcohol and 50 mu L of the magnetic beads M2, centrifuging briefly, placing in a constant temperature mixing instrument, incubating for 5 minutes at 1300rpm at room temperature, placing in a magnetic rack for 1 minute after centrifuging briefly, and sucking and removing the liquid; after centrifugation again briefly, the solution was placed on a magnetic rack for 1 minute and the solution was removed.

2.11 washing liquid 2 washing (1)

mu.L of wash solution 2 to which absolute ethanol had been added was added, and the beads were gently blown off using a pipette and transferred to a new 2mL centrifuge tube. And (3) briefly centrifuging, putting the mixture into a constant temperature mixer, shaking and mixing at 1300rpm for 1 minute at room temperature, and then briefly centrifuging, putting the mixture into a magnetic rack for 1 minute, and sucking and removing liquid.

2.12 desulfonation groups

400. Mu.L of solution C to which absolute ethanol has been added is added, centrifuged briefly, incubated in a thermostatic mixer for 10 minutes at 1300rpm with shaking at room temperature, centrifuged briefly for 1 minute on a magnetic rack, and the liquid is removed.

2.13 washing liquid 2 washing (2)

400. Mu.L of washing liquid 2 added with absolute ethyl alcohol is added, the mixture is centrifuged briefly, put in a constant temperature mixer, mixed for 1 minute at 1300rpm in an oscillating mode, and put in a magnetic rack for 1 minute after the centrifugation briefly, and liquid is sucked and removed.

2.14 washing liquid 2 washing (3)

400 mu L of washing liquid 2 added with absolute ethyl alcohol is added again, the mixture is centrifuged briefly, and the mixture is placed in a constant temperature mixer for shaking and mixing at 1300rpm for 1 minute, and then centrifuged briefly, placed in a magnetic rack for 1 minute, and the liquid is sucked and removed. Again briefly centrifuged and placed on a magnetic rack for 1 min to aspirate liquid.

2.15 drying

The centrifuge tube was opened and dried at room temperature for 10 minutes.

2.16 elution

Adding 60 mu L of eluent, performing brief centrifugation after vortex oscillation, placing in a constant temperature mixer for incubation at 65 ℃ and 1300rpm for 5 minutes, placing in a magnetic rack for 1 minute by brief centrifugation, transferring the eluted solution into a new marked centrifuge tube, covering a tube cover, and placing at-20+/-5 ℃ for preservation.

3. Preparation of amplification reagent (PCR reaction solution preparation region)

3.1, inserting the PCR reaction liquid A and the PCR reaction liquid B into an ice box or placing the ice box at 2-8 ℃ for natural melting.

The extracted DNA was taken out of the refrigerator, left at room temperature, naturally melted, and centrifuged at 13000rpm for 2 minutes at high speed.

3.2 the various components were added according to the following reaction system.

Configuration of a PCR reaction system: the total volume of the PCR reaction solution A10 mu L, PCR, the reaction solution B10 mu L, and the template 10 mu L was 30 mu L.

3.3 after the sample addition, the mixture was thoroughly mixed and centrifuged for 1 minute, and the PCR tube was placed in a PCR instrument. ( Note that: each PCR detection needs to prepare a template-free control reaction well (NTC), namely a PCR reaction liquid A, PCR reaction liquid B and nuclease-free water, and 10ul of each reaction liquid B and nuclease-free water are added. )

3.4 the reaction conditions for PCR were set according to the following procedure (Table 4)

TABLE 4 Table 4

4. Judging the result:

the Texas Red channel reported an amplified signal for ACTB and the FAM channel reported an amplified signal for the methylated APBA2 gene and the CoL A1/CoL A2 homologous sequence.

4.1 template-free control (NTC) Texas Red/ROX channel and FAM channel have no amplification curve or Ct value not less than 40, which indicates that the experiment has no pollution and can continuously analyze the experimental condition.

4.2 negative quality control Texas Red/ROX channel, S-type amplification curve with Ct value less than or equal to 34, FAM channel without amplification curve or Ct value more than or equal to 40.

The positive quality control Texas Red/ROX channel and FAM channel have S-type amplification curves, and when the Ct value of the Texas Red/ROX channel is less than or equal to 34 and the Ct value of the FAM channel is less than or equal to 35, the system is normal, and the analysis experiment can be continued.

4.3, in the detection sample reaction hole, a Texas Red/ROX channel is provided with an S-shaped amplification curve, and the Ct value is less than or equal to 36, so that the analysis can be continued; if Ct value >36, it indicates that the sample DNA is insufficient or degraded seriously, which is not suitable for experimental analysis. In the FAM channel, samples with no amplification curve or Ct value more than 38 are negative samples; the sample with S-shaped amplification curve and Ct value less than or equal to 38 is a positive sample.

TABLE 5

The detection result is positive, the patient with intestinal cancer is judged, the detection result is negative, the patient with non-cancer is judged, and the invalid sample needs to be resampled and detected.

The kit is used for detecting stool samples of 168 colorectal cancer patients which are clinically collected and need to be subjected to enteroscopy, and the detection performance of the kit for colorectal cancer is compared with samples of 168 non-cancer subjects (normal people, enteritis and polyp). And comparing and analyzing the detection result of the kit with the final clinical detection result, and evaluating the detection performance of the kit by using the final clinical diagnosis as a gold standard. The detection result shows that when the amplified Ct value of the methylated APBA2 and COL4A1/COL4A2 genes is 38 as a positive judgment value, the detection sensitivity of the kit is 91.07%, and the specificity is 95.24%. Statistical analysis was performed using SPSS20 software, and the results are shown in fig. 8, where the test results show that the area under the curve for colorectal cancer detection and non-cancer detection by the kit is 0.96.

And the reagent kit is used for singly detecting the methylation of the APBA2 gene and singly detecting the methylation of the homologous region of COL4A1/COL4A2 of the intestinal cancer sample. Similarly, the positive determination value ct=38 was used to compare the contribution ratio of 2 markers in the positive intestinal cancer sample. As shown in fig. 9, 168 cases of intestinal cancer samples were detected by the kit, and 153 cases were positive when two genes were detected together. The detection of methylation of APBA2 gene alone was 143, and the detection of methylation of COL4A1/COL4A2 homologous region alone was 143. Of these, 133 cases were positive for both markers alone, 10 cases were positive for methylation of the APBA2 gene alone, and 10 cases were positive for methylation of the COL4A1/COL4A2 homologous region alone. The combination amplification of the two markers is helpful for improving the detection sensitivity, and the combination of the two markers selected in the application has the characteristics of good specificity and high sensitivity.

Variations and modifications to the above would be obvious to persons skilled in the art to which the invention pertains from the foregoing description and teachings. Therefore, the invention is not limited to the specific embodiments disclosed and described above, but some modifications and changes of the invention should be also included in the scope of the claims of the invention. In addition, although specific terms are used in the present specification, these terms are for convenience of description only and do not limit the present invention in any way.

Claims

1. A primer combination, characterized in that the primer combination is SEQ ID NO:1 and SEQ ID NO: 2. SEQ ID NO:13 and SEQ ID NO:14, a primer pair combination shown in FIG. 14; or (b)

SEQ ID NO:4 and SEQ ID NO: 5. SEQ ID NO:16 and SEQ ID NO: 17.

2. A probe, characterized in that the probe is a probe combination, and the probe combination is a probe of SEQ ID NO:3 and SEQ ID NO:15, and a combination of sequences shown in seq id no; or (b)

3. A polygene methylation joint detection reagent, which is characterized in that the genes are APBA2 and COL4A1/COL4A2, and comprises a primer for methylation detection of each gene;

SEQ ID NO:4 and SEQ ID NO: 5. SEQ ID NO:16 and SEQ ID NO: 17.

4. The multi-gene methylation joint detection reagent of claim 2, further comprising a probe for methylation detection of each gene.

5. The polygene methylation joint detection reagent of claim 4, wherein the probe is SEQ ID NO:3 and SEQ ID NO:15, and a combination of sequences shown in seq id no; or (b)

6. A kit comprising the primer combination of claim 1 and the probe of claim 2, or the reagent of any one of claims 2-4.

7. The kit of claim 1, wherein the kit comprises: a first container comprising a primer combination for amplification; a second container comprising a probe.

8. The use of a primer combination according to claim 1 and a probe according to claim 2, or a reagent according to any one of claims 2 to 4, for the preparation of a reagent or kit for methylation detection, or for the preparation of a reagent or kit for detection of colorectal cancer, for the detection of a sample to be tested which is stool.

9. The use of claim 8, wherein the primer combination or the reagent is detected in the same reaction well.