CN117603927A - Novel firefly luciferase variant and application thereof in organoid cell viability detection - Google Patents

Abstract

The invention belongs to the field of molecular biology, and particularly discloses a novel firefly luciferase variant and application thereof in organoid cell viability detection. The activity and stability of the novel firefly luciferase mutant disclosed by the invention are obviously improved, and the prepared organoid cell activity detection reagent has stronger chemiluminescence brightness and longer luminescence duration; the invention also provides a novel firefly luciferase variant-based organoid cell viability detection method which is simple to operate, time-saving, labor-saving, high in sensitivity and high in stability, and the organoid cell viability detection method is used for detecting the change of ATP content in organoid cells and reacting to the change of organoid viability. Meanwhile, the organoid cell viability detection reagent provided by the invention can realize rapid organoid viability detection without cell washing, culture medium removal or multi-step pipetting operation.

Description

Novel firefly luciferase variant and application thereof in organoid cell viability detection

Technical Field

The invention belongs to the field of molecular biology, and particularly discloses a novel firefly luciferase variant and application thereof in organoid cell viability detection.

Background

The most direct source of energy in organisms is Adenosine Triphosphate (ATP), which is completely degraded when cells die, and ATP levels reflect the number of living cells. Organoid viability can thus be assessed by analysis of the ATP of the organoids. ATP is rapidly reduced and decomposed into adenosine and phosphoric acid due to the activity of an intrinsic ATP degrading enzyme in serum or cell origin. Thus, rapid disruption of cells and rapid and sufficient release of ATP becomes a critical factor in accurately detecting cell viability.

Firefly luciferase (Firefly Luciferase) is an enzyme that catalyzes the oxidation of firefly luciferin and the production of bioluminescence in the presence of ATP, divalent metal ions such as magnesium ions and oxygen. In the presence of excess firefly luciferase and luciferin, the generation of fluorescence is proportional to the amount of ATP present in the reaction, and this luminescence property makes firefly luciferase widely used in various studies, production, etc. for measuring ATP. However, the use of wild-type (WT) beetle luciferases is often limited by the inadequate stability of these enzymes at temperatures above 30 ℃. Furthermore, certain conditions may have an inhibitory effect on the luciferase reaction, thereby affecting the sensitivity of the assay.

The organoid is an in vitro 3D culture cultured by stem cells in an in-vivo microenvironment simulation mode, and with the development of 3D organoid culture technology, higher requirements are put forward on cell viability detection and the like, and when the common ATP chemiluminescent detection reagent is applied to organoid cell viability detection, the reagent has the defects of poor repeatability, poor linearity and poor accuracy. Therefore, there is a need to further improve the activity, stability, etc. of firefly luciferase and optimize the existing ATP chemiluminescent detection reagents so that they can meet the detection requirements of organoid viability.

Disclosure of Invention

In view of the deficiencies of the prior art, disclosed herein is a novel firefly luciferase variant and its use in organoid cell viability assays.

The invention comprises the following technical scheme:

a novel firefly luciferase variant comprising the amino acid sequence of any one of 1) -4):

1) An amino acid sequence as shown in SEQ ID No. 1;

2) An amino acid sequence of a fusion protein obtained by connecting a signal peptide and/or a tag to the N end and/or the C end of the amino acid sequence shown in SEQ ID No. 1;

2) Amino acid sequence of protein with same function obtained by substituting and/or deleting and/or adding one or several amino acid residues of the amino acid sequence shown in SEQ ID No. 1;

4) And SEQ ID No:1 is more than 95% and has the same function.

Preferably, the mutant of firefly luciferase according to the invention is a mutation occurring on the basis of a wild type firefly luciferase. The number of mutation sites is 4. The mutation site comprises that the 216 th amino acid is mutated from Asn to Ala, the 217 th amino acid is mutated from Ala to Leu, the 366 th amino acid is mutated from Lys to Arg, and the 465 th amino acid is mutated from Asn to Arg. In some embodiments, the amino acid sequence of the mutant is shown in SEQ ID NO.1.

Further, a biomaterial as described above comprising a biomaterial as defined in any one of a) to d),

a) A nucleic acid molecule comprising an amino acid sequence as set forth in SEQ ID NO. 1;

b) A recombinant vector comprising the nucleic acid molecule of a);

c) A recombinant microorganism comprising the nucleic acid molecule as described in a) or comprising the recombinant vector as described in b);

d) A recombinant cell comprising the nucleic acid molecule as set forth in a) or comprising the recombinant vector as set forth in b).

Further, the sequence of the nucleic acid molecule of the biological material is shown as SEQ ID NO. 2.

Further, the above-mentioned biological material, the said recombinant vector is a prokaryotic system expression vector or eukaryotic system expression vector; the prokaryotic system expression vector is an escherichia coli expression vector; the eukaryotic expression vector is a yeast expression vector, or an insect cell expression vector, or a mammalian cell expression vector.

Further, the above-mentioned biological material, the recombinant cell is a prokaryotic cell or a eukaryotic cell;

the prokaryotic cell is Escherichia coli; the eukaryotic cell is a yeast cell, or an insect cell, or a mammalian cell.

The invention also discloses a reagent for detecting the activity of organoid cells, which is characterized by comprising the firefly luciferase mutant according to claim 1.

Further, the organoid cell viability detection reagent further comprises: buffer solution, 1-10mg/ml fluorescein, 1-4% CHAPS, 1-4% ASB-14, 1-4% SB3-10, 1-5mM TBP, 5-50% glycerol, 3-7mM MgSO ₄ 。

Further, the invention discloses a kit for detecting the activity of organoid cells, which comprises the organoid cell activity detection reagent; the kit is formed by placing the above-described reagents in a suitable packaging material.

The invention also discloses application of the reagent or the kit in detecting the activity of organoid cells, wherein the detection of organoid cell activity refers to detection of cell activity in a drug screening experiment, a cell proliferation assay experiment, a cytotoxicity assay experiment or a tumor drug sensitivity experiment.

Furthermore, the invention discloses a using method of the organoid cell viability detection kit, which comprises the following steps:

uniformly mixing organoid cell viability detection reagent with organoid culture medium in equal proportion, then placing on a chemiluminescent plate reader, and setting a detection program as follows: shaking for 5min, incubating for 25min, and starting detection; and the luminescence value was recorded.

The invention has the following beneficial effects:

the invention provides a novel firefly luciferase mutant, which has obviously improved activity and stability, so that the organoid activity detection reagent has stronger chemiluminescence brightness and longer luminescence duration. The organoid activity detection reagent disclosed by the invention is specially used for detecting the cell activity of micro-tissues generated by 3D cell culture, contains a large amount of cracking components in a formula, has stronger cracking capacity, has stronger luciferase mutant stability, and further improves the stability of the reagent. Meanwhile, the organoid activity detection reagent provided by the invention can detect the result after 30min without cell washing, culture medium removal or multi-step pipetting operation, so that the efficiency is improved, the time is saved, and the organoid activity can be rapidly detected.

Drawings

Fig. 1: SDS-PAGE of luciferase mutant (M);

fig. 2: enzyme thermostability analysis graph;

fig. 3: a standard relationship between ATP solution concentration and fluorescence intensity;

fig. 4: a chemiluminescent brightness and stability comparison chart;

fig. 5: cell pellet lysis performance comparison.

Detailed Description

The following description of the technical solutions in the embodiments of the present invention will be clear and complete, and it is obvious that the described embodiments are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. The appropriate amount of the invention is determined by one of ordinary skill in the art according to national technical specifications and practical production conditions. The raw materials described in the present invention are commercially available unless otherwise specified.

The specific sequence is as follows:

SEQ ID No.1＝

Met Glu Asn Met Glu Asn Asp Glu Asn Ile Val Tyr Gly Pro Glu Pro Phe Tyr Pro Ile 20

Glu Glu Gly Ser Ala Gly Ala Gln Leu Arg Lys Tyr Met Asp Arg Tyr Ala Lys Leu Gly 40

Ala Ile Ala Phe Thr Asn Ala Leu Thr Gly Val Asp Tyr Thr Tyr Ala Glu Tyr Leu Glu 60

Lys Ser Cys Cys Leu Gly Glu Ala Leu Lys Asn Tyr Gly Leu Val Val Asp Gly Arg Ile 80

Ala Leu Cys Ser Glu Asn Cys Glu Glu Phe Phe Ile Pro Val Leu Ala Gly Leu Phe Ile 100

Gly Val Gly Val Ala Pro Thr Asn Glu Ile Tyr Thr Leu Arg Glu Leu Val His Ser Leu 120

Gly Ile Ser Lys Pro Thr Ile Val Phe Ser Ser Lys Lys Gly Leu Asp Lys Val Ile Thr 140

Val Gln Lys Thr Val Thr Ala Ile Lys Thr Ile Val Ile Leu Asp Ser Lys Val Asp Tyr 160

Arg Gly Tyr Gln Ser Met Asp Asn Phe Ile Lys Lys Asn Thr Pro Gln Gly Phe Lys Gly 180

Ser Ser Phe Lys Thr Val Glu Val Asn Arg Lys Glu Gln Val Ala Leu Ile Met Asn Ser 200

Ser Gly Ser Thr Gly Leu Pro Lys Gly Val Gln Leu Thr His Glu Ala Leu Val Thr Arg 220

Phe Ser His Ala Arg Asp Pro Ile Tyr Gly Asn Gln Val Ser Pro Gly Thr Ala Ile Leu 240

Thr Val Val Pro Phe His His Gly Phe Gly Met Phe Thr Thr Leu Gly Tyr Leu Thr Cys 260

Gly Phe Arg Ile Val Met Leu Thr Lys Phe Asp Glu Glu Thr Phe Leu Lys Thr Leu Gln 280

Asp Tyr Lys Cys Ser Ser Val Ile Leu Val Pro Thr Leu Phe Ala Ile Leu Asn Arg Ser 300

Glu Leu Leu Asp Lys Tyr Asp Leu Ser Asn Leu Val Glu Ile Ala Ser Gly Gly Ala Pro 320

Leu Ser Lys Glu Ile Gly Glu Ala Val Ala Arg Arg Phe Asn Leu Pro Gly Val Arg Gln 340

Gly Tyr Gly Leu Thr Glu Thr Thr Ser Ala Ile Ile Ile Thr Pro Glu Gly Asp Asp Lys 360

Pro Gly Ala Ser Gly Arg Val Val Pro Leu Phe Lys Ala Lys Val Ile Asp Leu Asp Thr 380

Lys Lys Thr Leu Gly Pro Asn Arg Arg Gly Glu Val Cys Val Lys Gly Pro Met Leu Met 400

Lys Gly Tyr Val Asp Asn Pro Glu Ala Thr Arg Glu Ile Ile Asp Glu Glu Gly Trp Leu 420

His Thr Gly Asp Ile Gly Tyr Tyr Asp Glu Glu Lys His Phe Phe Ile Val Asp Arg Leu 440

Lys Ser Leu Ile Lys Tyr Lys Gly Tyr Gln Val Pro Pro Ala Glu Leu Glu Ser Val Leu 460

Leu Gln His Pro Arg Ile Phe Asp Ala Gly Val Ala Gly Val Pro Asp Pro Ile Ala Gly 480

Glu Leu Pro Gly Ala Val Val Val Leu Glu Lys Gly Lys Ser Met Thr Glu Lys Glu Val 500

Met Asp Tyr Val Ala Ser Gln Val Ser Asn Ala Lys Arg Leu Arg Gly Gly Val Arg Phe 520

Val Asp Glu Val Pro Lys Gly Leu Thr Gly Lys Ile Asp Gly Lys Ala Ile Arg Glu Ile 540

Leu Lys Lys Pro Val Ala Lys Met His His His His His His 554

SEQ ID No.2＝

ATGGAGAACATGGAGAATGATGAGAACATCGTGTACGGCCCGGAACCGTT

TTATCCGATTGAAGAAGGTAGCGCAGGTGCACAGCTGCGTAAATATATGG

ATCGTTATGCAAAACTGGGCGCCATTGCATTTACCAATGCACTGACCGGT

GTTGATTATACCTATGCAGAATATCTGGAGAAGAGCTGTTGCCTGGGTGA

AGCACTGAAAAATTATGGTCTGGTTGTTGACGGCCGCATTGCACTGTGTA

GCGAAAATTGTGAAGAATTTTTCATCCCGGTTCTGGCCGGCCTGTTTATT

GGTGTTGGTGTTGCACCGACCAATGAAATTTATACCCTGCGTGAACTGGT

TCACAGCCTGGGTATTAGCAAACCGACCATTGTTTTTAGCAGCAAAAAAG

GCCTGGATAAGGTGATCACCGTGCAGAAAACCGTTACCGCAATTAAAACC

ATTGTGATCCTGGACAGCAAGGTGGACTATCGCGGTTATCAGAGCATGGA

CAATTTTATCAAAAAGAACACCCCGCAGGGTTTTAAGGGTAGCAGCTTTA

AAACCGTTGAAGTGAACCGTAAGGAGCAGGTTGCACTGATTATGAATAGC

AGCGGTAGCACCGGTCTGCCGAAAGGTGTTCAGCTGACCCATGAAGCACT

GGTTACCCGTTTTAGCCATGCACGTGATCCGATTTATGGTAATCAGGTTA

GCCCGGGTACCGCAATTCTGACCGTTGTTCCGTTTCATCATGGTTTTGGT

ATGTTTACCACCCTGGGTTATCTGACCTGTGGTTTTCGTATTGTTATGCT

GACCAAATTCGACGAGGAGACATTTCTGAAAACCCTGCAGGATTATAAAT

GCAGCAGCGTTATTCTGGTGCCGACCCTGTTTGCAATTCTGAATCGTAGC

GAACTGCTGGATAAATATGATCTGAGCAATCTGGTTGAGATCGCCAGCGG

TGGTGCACCGTTAAGCAAAGAAATTGGTGAAGCAGTTGCACGCCGTTTTA

ATCTGCCGGGTGTTCGTCAGGGTTATGGTCTGACCGAAACCACCAGCGCA

ATTATTATTACCCCGGAAGGTGATGATAAACCGGGTGCAAGCGGTCGTGT

TGTTCCGCTGTTTAAAGCAAAAGTTATTGACCTGGACACCAAGAAAACCC

TGGGCCCGAATCGTCGTGGTGAAGTTTGTGTTAAAGGTCCGATGCTGATG

AAAGGTTATGTTGATAATCCGGAGGCCACCCGTGAAATTATTGATGAAGA

AGGTTGGCTGCATACCGGTGATATTGGTTATTATGATGAGGAGAAGCACT

TCTTCATCGTGGATCGCCTGAAAAGCCTGATCAAATATAAAGGCTACCAG

GTGCCGCCGGCAGAACTGGAAAGTGTTCTGCTGCAACATCCGCGTATTTT

TGATGCAGGTGTTGCAGGTGTTCCGGATCCGATTGCAGGTGAACTGCCGG

GTGCAGTTGTTGTTCTGGAAAAAGGTAAAAGCATGACCGAAAAAGAG

GTG

ATGGACTATGTTGCCAGCCAGGTTAGCAATGCAAAACGTCTGCGTGGT

GG

TGTTCGTTTTGTTGATGAAGTTCCGAAAGGTCTGACCGGTAAAATTGA

TG

GTAAAGCCATTCGTGAAATCCTGAAGAAGCCGGTTGCAAAAATGCATCAT

CATCATCATCATTAA。

example 1

Mutation, expression and purification of firefly luciferase.

The 216 th amino acid of the wild firefly luciferase is mutated from Asn to Ala, the 217 th amino acid is mutated from Ala to Leu, the 366 th amino acid is mutated from Lys to Arg, the 465 th amino acid is mutated from Asn to Arg, and the amino acid sequence is SEQ ID NO.1.

The preparation method of the firefly luciferase mutant comprises the following steps:

a. the 216 th amino acid of the amino acid sequence of firefly luciferase (GenBank: CAA 47358.1) is mutated from Asn to Ala, the 217 th amino acid is mutated from Ala to Leu, the 366 th amino acid is mutated from Lys to Arg, the 465 th amino acid is mutated from Asn to Arg, and a hexahistidine tag is added at the C end of the sequence to obtain a luciferase mutant, and the amino acid sequence of the luciferase mutant is SEQ ID NO.1. Optimizing the sequence of a gene coding region of the luciferase mutant according to the codon preference of the escherichia coli to obtain a firefly luciferase variant sequence with a nucleotide sequence of SEQ ID NO. 2;

b. adding restriction enzyme Nde I restriction enzyme site at the 5 'end of firefly luciferase variant sequence, adding restriction enzyme HindIII restriction enzyme site at the 3' end of optimized sequence, performing total gene synthesis (Beijing Liuhua big gene technology Co., ltd.), and connecting between Nde I restriction enzyme site and HindIII restriction enzyme site of prokaryotic expression vector pET30a (purchased from Novagen Co.), to obtain recombinant prokaryotic expression plasmid pET30a-M;

c. transforming the obtained recombinant prokaryotic expression plasmid pET30a-M into escherichia coli BL21 (DE 3) by a heat shock method, culturing on an LB plate containing kanamycin with the final concentration of 30 mug/ml, and selecting single colony for sequencing identification;

d. inoculating a single colony containing recombinant positive plasmid into LB liquid culture medium containing kanamycin with a final concentration of 30 mug/ml, culturing at 37 ℃ under shaking at 200rpm for 12-16 h, inoculating the cultured bacterial liquid into fresh LB liquid culture medium containing kanamycin with a volume ratio of 1%, culturing at 37 ℃ under shaking at 200rpm until the bacterial liquid concentration OD600 is 0.8-1.2, adding inducer IPTG to the working concentration of 1mM, continuing culturing for 24 h, centrifuging at 4 ℃ and 8000rpm for 10min, and collecting bacterial bodies;

e. the collected thalli are centrifugally washed twice by PBS, 1/10 volume of PBS is added into LB culture medium, thalli are fully suspended, PMSF is added into the mixture to the working concentration of 1mM, the mixture is uniformly mixed, the mixture is ultrasonically crushed on ice, the power is 200W, the ultrasonic waves are 5s, the interval is 5s and 10min, and then the mixture is centrifugally treated at the temperature of 4 ℃ and at the speed of 8000rpm for 30min, so that the supernatant containing the soluble total protein is obtained.

f. The method comprises the steps of adopting a Ni-NTA agarose chromatographic column, balancing the chromatographic column by using 5 times of column bed volume balancing buffer (20 mM phosphate, 500mM NaCl,5mM imidazole, pH 7.8), loading the supernatant containing the soluble total protein on the column at the speed of 1mL/min, adding an elution buffer (20 mM phosphate, 500mM NaCl,500mM imidazole, pH 7.8) for eluting after all the fluid in the chromatographic column flows out of a medium, collecting by a branch pipe, identifying the purity of each pipe of target protein by SDS-PAGE, collecting components with the purity of more than 95%, and storing in glycerol. The luciferase mutant (M) was subjected to SDS-PAGE electrophoresis, and the result of the electrophoresis is shown in FIG. 1.

Example 2

Luciferase mutant (M) activity assay and other enzymatic property assays.

Analysis of luminous intensity: protein concentration was measured by BCA protein concentration assay, and BSA was used as a standard curve. After the protein is quantified, 0.1mg/ml protein solution is prepared, and the measurement system is 10 mu l of the protein solution with the concentration of 0.1mg/ml, 30 mu l of pH 7.4, 50mM Tris-HCl and 10mM MgCl ₂ Is used as a substrate mixture of 10. Mu.l. As shown in Table 1, the modified luciferase mutant (M) showed an improvement in enzyme activity by about 2-fold increase in luminescence intensity compared with the wild-type luciferase (WT) when measured by using a multifunctional microplate reader (BioTek).

TABLE 1 luciferase mutant (M) compared to luciferase luminescence intensity (RLU) of Wild Type (WT)

Luciferase enzyme	RLU
		WT	265946
M	539752

Thermal stability analysis: the wild type enzyme solution and the mutant enzyme solution are respectively placed in water baths with the temperature of 25 ℃,30 ℃, 35 ℃,37 ℃ and 40 ℃ for incubation for 10min, quickly taken out, placed in ice water for cooling for 1min, and then subjected to luminescence measurement. As shown in FIG. 2 (a), the luminescence intensity of both the wild type and the mutant luciferases decreased with the increase of the water bath temperature, the enzyme activity of the wild type was almost lost after 10min of water bath at 40℃and the luminescence intensity was very weak, but the mutant could maintain the luminescence intensity of more than 90%.

As shown in FIG. 2 (b), under the same measurement conditions, the luminous intensity of the wild type luciferase is reduced to about 30% of the original luminous intensity after 20min of water bath at 37 ℃ and weaker as the time is longer, but the mutant luciferase can still maintain more than 95% of the luminous intensity even after 20min of water bath at 37 ℃. The modified mutant has better thermal stability than wild luciferase, and can meet more practical application requirements.

Example 3

The organoid activity detection reagent is used for detecting ATP standard.

The protein concentration was determined according to the BCA protein concentration determination kit, and organoid activity detection reagents (formula: 5. Mu.g/ml firefly luciferase mutant, 50mM sodium citrate, pH 6.0,1mg/ml luciferin, 1% CHAPS, 1% ASB-14, 1% SB3-10, 1mM TBP, 5% glycerol, 3mM MgSO 4) were prepared from the firefly luciferase mutant obtained by purification.

The using effect of the 3D organoid activity detection reagent is determined by detecting an ATP standard substance, the ATP standard substance is diluted into ATP standard solutions with the concentration of 0, 20 mu M, 40 mu M, 60 mu M, 80 mu M and 100 mu M respectively by using PBS, 100 microliters of each ATP standard substance is added into a 96-well plate to be used as a standard substance hole, 100 microliters of the 3D organoid activity detection reagent is added into each hole, and chemiluminescence detection is carried out after uniform mixing. A standard relationship between ATP solution concentration and fluorescence intensity is plotted, see FIG. 3. The results show that the 3D organoid activity detection reagent has good linearity on the ATP standard in the concentration range of 0-100 mu M.

Example 4

The 3D organoid activity detection reagent is used for detecting organoid activity and detecting luminous signal stability.

According to the protein concentration measurement result of BCA protein concentration measurement kit, 3D organoid activity detection reagent (formula: 15. Mu.g/ml firefly luciferase mutant, 50mM MES, pH 6.0, 10mg/ml luciferin, 4% CHAPS, 4% ASB-14, 4% SB3-10, 5mM TBP, 50% glycerol, 7mM MgSO) was prepared from the firefly luciferase mutant obtained by purification ₄ )。

HCT116 cells were directly suspended in matrigel at 10 μl/well, the number of cells contained therein was 1000 cells/well, then the cell suspension was inoculated in a 48-well plate, the plate was turned over after the inoculation was completed, and the cell suspension formed suspended droplets, and was coagulated at 37 ℃ for 30min. After solidification, enough McCOY' S5A complete medium to cover the matrix was slowly added along the walls of the wells and incubated for 5 days. Adding organoid activity detection reagent with the same volume as the culture medium into the culture hole, uniformly mixing, then placing on a chemiluminescent plate reader, and setting a detection program as follows: shaking for 5min, incubating for 25min, and starting detection; and the luminescence value was recorded every 5 min.

Control experiment: the experimental conditions are the same, and the commercially available P brand 2D cell viability detection reagent and organoid viability detection reagent are used as a control experiment to detect the organoid viability. Results of testing the viability of HCT 116D cell spheres using the present invention are shown in FIG. 4. The formulation of the embodiment shows better chemiluminescence brightness and stability than the commercially available 2D cell viability detection reagent and organoid viability detection reagent.

Example 5

Detection of cleavage effect of organoid vitality detection reagent

According to the protein concentration measurement result of the BCA protein concentration measurement kit, a 3D organoid activity detection reagent (formula: 10. Mu.g/ml firefly luciferase mutant, 100mM phosphate buffer salt, pH 6.0,8mg/ml luciferin, 2% CHAPS, 2% ASB-14, 2% SB3-10, TBP at a concentration of 2.5mM, 20% glycerol, 5mM MgSO 4) was prepared from the firefly luciferase mutant obtained by purification.

The combination of the surfactants ASB-14, SB3-10 and TBP enables the reagent to have stronger cracking capability, and the 3D organoid activity detection reagent of the embodiment is compared with the commercially available 2D cell activity detection reagent and organoid activity detection reagent for HCT 116D cytoball cracking performance, the detection result is shown in figure 5, and the cracking capability shown by the formula of the embodiment is better than that of the commercially available 2D cell activity detection reagent and organoid activity detection reagent.

From the above examples, the present invention provides a novel firefly luciferase mutant, the activity and stability of which are significantly improved, so that the organic organ activity detection reagent has stronger chemiluminescent brightness and longer luminescence duration. The organoid activity detection reagent disclosed by the invention is specially used for detecting the cell activity of micro-tissues generated by 3D cell culture, contains a large amount of cracking components in a formula, has stronger cracking capacity, has stronger luciferase mutant stability, and further improves the stability of the reagent. Meanwhile, the organoid activity detection reagent provided by the invention can detect the result after 30min without cell washing, culture medium removal or multi-step pipetting operation, so that the efficiency is improved, the time is saved, and the organoid activity can be rapidly detected.

The above embodiments are only preferred embodiments of the present invention, and the scope of the present invention is not limited thereto, i.e. the present invention is not limited to the above embodiments, but is capable of being modified and varied in all ways according to the following claims and the detailed description.

Claims (10)

1. A novel firefly luciferase variant comprising an amino acid sequence according to any one of claims 1) to 4):

1) An amino acid sequence as shown in SEQ ID No. 1;

2) An amino acid sequence of a fusion protein obtained by connecting a signal peptide and/or a tag to the N end and/or the C end of the amino acid sequence shown in SEQ ID No. 1;

2) Amino acid sequence of protein with same function obtained by substituting and/or deleting and/or adding one or several amino acid residues of the amino acid sequence shown in SEQ ID No. 1;

4) And SEQ ID No:1 is more than 95% and has the same function.

2. A biomaterial comprising a biomaterial according to any one of a) to d),

a) A nucleic acid molecule comprising an amino acid sequence as set forth in SEQ ID NO. 1;

b) A recombinant vector comprising the nucleic acid molecule of a);

c) A recombinant microorganism comprising the nucleic acid molecule as described in a) or comprising the recombinant vector as described in b);

d) A recombinant cell comprising the nucleic acid molecule as set forth in a) or comprising the recombinant vector as set forth in b).

3. The biomaterial according to claim 2, wherein the sequence of the nucleic acid molecule is as shown in SEQ ID No. 2.

4. The biomaterial of claim 2, wherein the recombinant vector is a prokaryotic or eukaryotic expression vector;

the prokaryotic system expression vector is an escherichia coli expression vector; the eukaryotic expression vector is a yeast expression vector, or an insect cell expression vector, or a mammalian cell expression vector.

5. The biomaterial of claim 2, wherein the recombinant cell is a prokaryotic cell or a eukaryotic cell;

the prokaryotic cell is Escherichia coli; the eukaryotic cell is a yeast cell, or an insect cell, or a mammalian cell.

6. An organoid cell viability assay reagent comprising the firefly luciferase mutant according to claim 1.

7. The organoid cell viability assay reagent of claim 6, further comprising: buffer solution, 1-10mg/ml fluorescein, 1-4% CHAPS, 1-4% ASB-14, 1-4% SB3-10, 1-5mM TBP, 5-50% glycerol, 3-7mM MgSO ₄ 。

8. A kit for detecting organoid cell viability, said kit comprising the organoid cell viability detection reagent of claim 6.

9. The use of a reagent according to claim 6 or 7 or a kit according to claim 8 for detecting organoid cell viability, wherein detecting organoid cell viability is detecting cell viability in a drug screening assay, a cell proliferation assay, a cytotoxicity assay or a tumour drug sensitivity assay.

10. The method of using the organoid cell viability assay kit of claim 8 comprising the steps of: uniformly mixing organoid cell viability detection reagent with organoid culture medium in equal proportion, then placing on a chemiluminescent plate reader, and setting a detection program as follows: shaking for 5min, incubating for 25min, and starting detection; and the luminescence value was recorded.