RU2420594C2 - Agent for adenosine-5'-triphosphate - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: agent contains mutant luciferase of glowworms Luciola mingrelica (SEQ ID No:2), recovered from recombinant cells E.coli transformed by plasmid pETL7, luciferin, magnesium sulphate, tris-(oxymethyl)-aminomethane, acetic acid, sodium ethylene aminotetraacetate, dithiotreitol, bovine serum albumin, sucrose and water.

EFFECT: higher sensitivity of ATP test, lower enzyme consumption.

2 cl, 3 dwg, 1 tbl, 4 ex

Description

The present invention relates to the field of biochemistry, and in particular to the composition of the reagent for the quantitative determination of adenosine 5'-triphosphate (ATP) based on the enzyme firefly luciferase.

The intensity of bioluminescence that occurs in the reaction of luciferin, oxygen, and ATP catalyzed by firefly luciferase is proportional to the concentration of ATP. When working with ATP solutions in a wide range of concentrations (several orders of magnitude), the calibration dependence is presented in logarithmic coordinates. The dependence of the logarithm of the intensity of bioluminescence on the logarithm of the concentration of ATP is described by the linear equation:

log (I, arb.) = α + b · log [ATP, mol / l],

where [ATP, mol / l] is the concentration of ATP in the luminometer cuvette,

(I, conventional units) - the intensity of bioluminescence in arbitrary units, recorded on a luminometer,

α and b are the coefficients of equation (1).

This reaction is widely used for analytical purposes to determine ATP, namely in medical diagnostics, in the control of microbial contamination of various products and the environment. Based on this method, “fast microbiology” methods have been developed to control the microbiological purity of food, food raw materials, medicines, cosmetic products, technological materials, water and other drinks, to assess the sterility of equipment and materials in especially clean rooms (Ugarova N.N. 1993, Applied Biochemistry and Microbiology, vol. 29, No. 2, pp. 180-191).

Closest to the claimed patent of the Russian Federation No. 2268944, 2004 (Ugarova N.N., Maloshenok L.G. "Reagent for determination of adenosine-5'-triphosphate"), adopted as a prototype, in which a reagent for determining adenosine-5 'is proposed triphosphate, including soluble luciferase isolated from recombinant E. coli cells containing the plasmid pLR with the native firefly luciferase gene Luciola mingrelica with specific activity of 20-100 U / ml (10-50 U / mg protein), magnesium sulfate, tris (oxymethyl) -aminomethane and acetic acid as a buffer mixture, a mixture of ethylenediaminetetra sodium cetate, dithiothreitol, bovine serum albumin and trehalose as stabilizers and water, in the following ratio, wt.%:

Luciferase 0.001-0.01 Luciferin 0.014-0.028 Magnesium sulfate 0.5-0.75 Tris- (hydroxymethyl) -aminomethane 2.4-4.8 Acetic acid 0.1-0.2 Ethylene diamine tetraacetate sodium 0.15-0.22 Dithiothreitol 0.04-0.08 Bovine Serum Albumin 2-5 D - (+) - trehalose 10-20 Water Rest

The disadvantage of the prototype is the insufficiently high catalytic activity of the native recombinant firefly luciferase L. mingrelica, which is used to obtain the ATP reagent. The disadvantage of the prototype is also the low yield of the active enzyme during biomass growth in E. coli strain LE392, transformed with the pLR plasmid encoding the native firefly luciferase Luciola mingrelica, 40-60 mg of luciferase with 1 l of culture medium. A significant disadvantage of the prototype is the length of the process of multi-stage purification of the enzyme using ion exchange and distribution chromatography, which is more than three days and allows you to get diluted solutions of the enzyme with a concentration of not more than 1-2 mg / ml and specific activity of 20-100 U / ml (10 -50 U / mg protein). A significant disadvantage of the prototype is the low thermal stability of the native recombinant luciferase, which leads to a noticeable decrease in luciferase activity in the process of isolation and long-term purification of the enzyme. In addition, the use of trehalose as one of the stabilizers significantly increases the cost of the target product.

The objective of the present invention is to increase the sensitivity of the determination of ATP, reduce the consumption of the enzyme by increasing the specific activity of the reagent and increasing the thermal stability of luciferase. The objective of the present invention is also to reduce the cost of the reagent by using instead of trehalose a more affordable stabilizer, sucrose, as well as by increasing the productivity of the process of producing the reagent by increasing the yield of the active enzyme during biomass growth and increasing the concentration of luciferase in the resulting enzyme preparation and, finally, by reduce the complexity and duration of the enzyme purification process.

To solve this problem, a reagent for determining ATP is proposed, including mutant thermostable firefly luciferase Luciola mingrelica with a specific activity of 3000-6000 U / ml (200 U / mg protein) isolated from recombinant E. coli cells transformed with pETL7 plasmid with the mutant firefly luciferase gene Luciola mingrelica, luciferin, magnesium sulfate, a mixture of tris (oxymethyl) aminomethane and acetic acid as a buffer mixture, a mixture of sodium ethylenediaminetetraacetate, dithiothreitol, bovine serum albumin and sucrose as a stabilizer congestion and water.

Unlike the composition adopted for the prototype, the proposed reagent contains a less concentrated buffer solution and a lower concentration of a number of other components (sodium ethylenediaminetetraacetate, dithiothreitol and bovine serum albumin), and also contains sucrose instead of trehalose. The use of a less concentrated solution and sucrose for the preparation of the reagent significantly reduces the cost of the reagent, which is an additional advantage of the invention.

Unlike the composition adopted for the prototype, the proposed reagent includes mutant firefly Luciola mingrelica firefly luciferase (SEQ ID No: 2) isolated from recombinant E. coli cells transformed with pETL7 plasmid with the mutant Luciola mingrelica firefly luciferase gene encoding (compared to the original enzyme, SEQ ID No: 1) the amino acid sequence of the enzyme with eight substitutions (Ser118Cis, Cis146Ser, Lys156Arg, Arg211Ley, Tre213Ser, Ala217 Val, Glu356Liz, Ser364Cis), an additional sequence of Met-Ala-Ser-Lys at the N-terminus and an additional sequence yu Ser-Glu-Pro-Val-Glu-Gis-Gis-Gis-Gis-Gis-Gis-Gis at the C-terminus instead of the Ala-Liz-Met sequence. The preparation of plasmid pETL7 is carried out by the method of random mutagenesis of plasmid pLR3 (Koksharov M.I., Ugarova N.N., 2008, Biochemistry, vol. 73, s, 1071-1080) using a polygrase chain reaction of reduced accuracy (Cirino R.S., Mauer K., Umeno D., 2003, Methods Mol Biol, v.231, p.3-9), as described in Example 1. Obtaining E. coli strain transformed with pETL7 plasmid, increasing cell biomass, isolation and purification of luciferase by metal chelate chromatography is carried out as described in example 2. The result is a solution of highly purified mutant firefly luciferase Luciola mingrelica with a concentrate tion of active enzyme of 15-30 mg / ml, a specific activity of 3000-6000 U / ml (200 U / mg protein), which exceeds the thermal stability of parent enzyme thermostability 65 times at 42 ° C. This luciferase preparation is used to prepare the reagent.

According to the invention, the reagent for determining adenosine 5'-triphosphate (ATP) contains a soluble recombinant mutant, highly purified, highly active and highly stable luciferase Luciola mingrelica, isolated from recombinant E. coli cells containing a plasmid with a mutant firefly luciferase gene, firefly sulphate, mixture tris- (oxymethyl) -aminomethane and acetic acid as a buffer mixture, a mixture of sodium ethyleneaminotetraacetate, dithiothreitol, bovine serum albumin and sucrose as stabilizers and water, with eduyuschem component ratio, wt.%:

Luciferase 0.003-0.006 Luciferin 0.014-0.028 Tris- (hydroxymethyl) -aminomethane 0.605-1.210 Magnesium sulfate 0.246-0.492 Acetic acid 0.10-0.20 Ethylene diamine tetraacetate sodium 0.038-0.076 Dithiothreitol 0.008-0.016 Bovine Serum Albumin 0.5-1.0 Sucrose 9.0-18.0 Water Rest

The increase in the activity of the reagent for determining ATP using the proposed reagent is achieved by increasing the specific activity of mutant luciferase used to obtain the reagent. In the case of the prototype, the specific activity of luciferase is 10-50 U / mg protein, and the activity of the reagent is 0.5-5.0 U / ml. Using the mutant luciferase according to the invention with a specific activity of 200 U / mg, a reagent with an activity of 6.0-12.0 U / ml is obtained. For the reagent according to this invention, the sensitivity of the determination of ATP increases by ~ 10 times: the limit of determination decreases from ~ 10 ^-12 M ATP (according to the prototype) to ~ 10 ^-13 M ATP (according to this invention). This reduces the consumption of the enzyme: according to the prototype, the reagent contains up to 0.01 wt.% Luciferase, and the proposed reagent contains up to 0.006 wt.% Luciferase. The increased thermal stability of luciferase is achieved by using the plasmid pETL7 with the mutant firefly luciferase gene Luciola mingrelica, which encodes eight substitutions in the amino acid sequence of the enzyme, the introduction of which leads to a 65-fold increase in luciferase stability at 42 ° C.

The increase in the yield of the active enzyme is achieved by using the plasmid pETL7 and E. coli BL21 (DE3) CodonPlus cells to increase biomass, which allows to obtain up to 230 mg of active luciferase from 1 l of culture medium, while the prototype yield of active luciferase does not exceed 60 mg / l Reducing the complexity and reducing the duration of the enzyme purification process is achieved by using the plasmid pETL7 encoding an enzyme with a six-histidine sequence at the C-terminus. This allows you to quickly clean the enzyme using metal chelate chromatography and thereby reduce the cleaning time from three days (according to the prototype) to 4 hours according to this invention and to obtain an enzyme solution with a concentration of 15-30 mg / ml (3000-6000 E / ml).

ATP reagent is obtained by adding a concentrated solution of highly purified mutant luciferase to a Tris-acetate buffer solution, pH 7.8, containing luciferin, magnesium sulfate, sodium ethylenediaminetetraacetate, dithiothreitol, bovine serum albumin and sucrose. After thorough mixing, the solution is filtered through a sterile filter into a sterile flask, poured into sterile vials, frozen, lyophilized, hermetically sealed under vacuum and stored in a refrigerator until use. Before use, a certain volume of deionized sterile water is added to each vial to obtain a reagent for measuring ATP concentration with an enzyme activity of 6.0-12.0 U / ml.

The invention is illustrated by the following examples.

Example 1. Obtaining plasmids pETL7

Plasmid pETL7, containing the mutant thermostable firefly luciferase luciferase Luciola mingrelica gene, is obtained by random mutagenesis of the luciferase gene using low precision polymerase chain reaction (PCR). As the source, plasmid pLR3 is used (Fig. 1) containing the firefly luciferase gene L. mingrelica with the point substitution Ser118Cis. Plasmid pLR3 was previously described (Koksharov M.I., Ugarova N.N., 2008, Biochemistry, vol. 73, p. 1071-1080). Then, the mutant luciferase gene from the mutant plasmid pLR3 (FIG. 2) is cloned into the plasmid pET23b (FIG. 3).

1a. Obtaining plasmid pLR3 with the mutant gene of thermostable firefly luciferase L. mingrelica. Plasmid pLR3 (Fig. 1) was isolated from E. coli cells (strain XL1-blue) using a Kijen reagent kit and used in experiments on random mutagenesis of portions of the NheI-Bg1II gene (1-1180 base pairs) and XhoI-Bg1II (395 -1180 base pairs), which is carried out in four cycles.

In the first cycle, the luciferase gene region is amplified between the NheI-AatII restriction sites (~ 1800 base pairs) using the NheI forward primer (ATTATAGGAGGCTAGCAAAATGG) and the AatII reverse primer (TGCCACCTGACGTCTAA). During PCR, 50 μl of the reaction mixture contains 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 7 mM MgCl ₂ , 0.15 mM MnCl ₂ , 0.2 mM dATP, 0.2 mM dGTP, 1 mM dCTP, 1 mM dTTP, 20 pmol of each primer, ~ 2 pmol of plasmid pLR3, 2.5 units Taq DNA polymerase. PCR is performed on a Tertsik thermocycler (DNA-technology, Russia) at the following temperature conditions: incubation for 1 min at 95 ° C, then 25 incubation cycles of the mixture: 1 min at 94 ° C, 1 min at 53 ° C and 1 min at 72 ° C and finally incubation for 10 min at 72 ° C. The amplification product is isolated from the gel using a kit of reagents from Kijen, a fragment is cut out at the NheI-Bg1II sites, it is isolated from the gel and ligated into the plasmid pLR3 cut at the same sites to obtain a mixture of plasmids containing mutant luciferase genes. The E. coli strain XL1blue was transformed with the resulting plasmid mixture, and the cells were scattered into plates with LB medium with ampicillin. Plates with transformed cell colonies are incubated overnight at 37 ° C and the bioluminescence of the colonies is recorded in vivo according to the method described in (Wood KV, DeLuca M., 1987, Anal. Biochem .. v.16, p.501-507) ; the dishes are poured with a solution of 1 mM luciferin in 0.1 M Na-citrate buffer (pH 5.0), shaken in the dark and photographed. The brightest colony expressing the most stable mutant enzyme 1TM1, which is used in the next mutagenesis cycle, is selected.

In the second and fourth cycles, random mutagenesis of the XhoI-Bg1II gene region is performed. PCR amplifies the XhoI-Af1II region (-1240 base pairs) using XhoI as a forward primer (GTATTCAGCTCGAGAAAAGGCTTACC) and Af1 II reverse primer (GCTTGTGGTTTCTTAAGAATTTCTCTAATTAC). The reaction mixture has the same composition as indicated for the first mutagenesis cycle, with the exception of the concentration of Mn ²⁺ , which is 0.25 mm. A section of XhoI-Bg1II (395-1180 base pairs) was excised from the amplified fragment and cloned into the plasmid pLR3 (Fig. 2).

Cups with colonies of transformed cells are incubated overnight at 37 ° C, then for 40 min at elevated temperature to inactivate in vivo insufficiently stable forms of luciferase (in the second and third cycles at 50 ° C, in the fourth at 55 ° C ) In each subsequent cycle, the most stable mutant obtained in the previous cycle is used as the initial matrix. After the 4th cycle, a 4TS mutant is obtained, the colonies of which retain a noticeable glow even after incubation for 20 min at 60 ° C. By sequencing the obtained 4TS mutant gene, the presence of eight mutations coding for the following amino acid substitutions is established: Ser118Cis, Cis146Cer, Lys156Arg, Arg211Ley, Tre213Ser, Ala217Val, Glu356Liz, Ser364Cis.

1b. Construction of the plasmid pETL7 (figure 3). Using PCR, a DNA fragment is obtained in which the last three amino acid residues of luciferase are altered and the SaiI restriction site is added without breaking the reading frame. The reaction mixture in PCR (50 μl) contains 60 mm Tris-HCl, pH 8.5, 1.5 mm MgCb, 25 mm KCl, 10 mm β-mercaptoethanol, 0.1% Triton X-100, 0.1 mm dATP, 0.1 mM dGTP, 0.1 mM dCTP, 0.1 mM dTTP, 20 pmol reverse mutagenic primer CtermHT (GTGGTCGACTGGGCCCGFTTGTGGTTTCTTFFGAATTTC) and 20 pmol forward XhoI primer (GTATTCAGCTCGAGAAAAGGCmtntg, 4 μg, 5 μg TTC TaqSE DNA polymerase. The polymerase chain reaction is carried out on a Tertsik thermocycler (DNA-technology, Russia) at the following temperature conditions: incubation for 1 min at 95 ° C, then 25 incubation cycles of the mixture: 1 min at 94 ° C, 1 min at 47 ° C and 2 min at 72 ° C and finally incubation for 10 min at 72 ° C.

The obtained fragment of the XhoI-SalI luciferase gene encoding the sequence SerGlyProValGluGisGisGisGisGisGisGis at the C-terminus of the enzyme is purified by electrophoresis and isolated from the gel. By restricting the XhoI-SalI gene fragment from the BamHI site, a BamHI-SalI fragment is obtained that encodes luciferase from the 225th amino acid residue to the end. The resulting fragment was purified by electrophoresis and then isolated from the gel. The pET23b vector, cut at the NheI and XhoI sites, ligates the NheI-BamHI fragment cut from the plasmid pLR3, which encodes 1-225 amino acid residues of luciferase, and the BamHI-SalI fragment described above. The sticky ends of the SaiI and XhoI sites are compatible, and after ligation both sites disappear.

The preparation of competent E. coli BL21 (DE3) CodonPlus cells and transformation of E. coli BL21 (DE3) CodonPlus cells with the plasmid pETL7 is carried out according to known methods. described in (D. Glover. Cloning of DNA. Methods. 1988, M., World).

Example 2. The preparation of highly purified thermostable mutant luciferase L.mingrelica

Thermostable mutant luciferase is obtained by culturing E. coli BL21 (DE3) CodonPlus cells containing the plasmid pETL7 with the mutant firefly luciferase gene L mingrelica. Cells are grown in 200 ml of medium containing 1% bacto-tryptone, 0.5% yeast extract, pH 7.0, 0.5% glycerin, 0.05% glucose, 0.2% lactose monohydrate, 0.1 mg / ml ampicillin when incubating on a rocking chair for ~ 2 hours at 37 ° C, 180 rpm to A ₆₀₀ = 0.2-0.8, then 14-16 hours at 23 ° C to A ₆₀₀ = 5 ÷ 8. Cells are pelleted by centrifugation (5500 g, 10 min, 4 ° C). The precipitate was resuspended in 20 ml of 20 mm sodium phosphate buffer, pH 7.5, containing 0.5 M NaCl, 20 mm imidazole, 0.5% Triton X-100. Cells are destroyed on an ultrasonic disperser. Cell walls and DNA are pelleted by centrifugation (39100 g, 30 min, 4 °) and discarded. The supernatant solution (~ 20 ml) at 4 ° C is applied to a 1 ml Ni-IDA column (Amersham, USA), washed with 20-40 ml of 20 mM sodium phosphate buffer solution containing 0.5 M NaCl, pH 7 , 5 and 20 mM imidazole. The enzyme is eluted with the same buffer solution containing 300 mM imidazole. To the resulting luciferase solution (2-4 ml) was added 0.5 M sodium ethylenediaminetetraacetate, pH 8.0, to a concentration of 2 mM, 1 M dithiothreitol in 10 mM Na-acetate buffer, pH 5.2 to a concentration of 1 mM. The result is a solution of highly purified thermostable recombinant luciferase in 20 mm sodium phosphate buffer solution containing 0.5 M NaCl, pH 7.5, 0.3 M imidazole, 2 mm ethylene diamine tetraacetate, 1 mm dithiothreitol, with an activity of 3000-6000 E / ml (200 U / mg protein). The yield of the active enzyme is about 230 mg per 1 liter of culture medium. The luciferase concentration in the resulting solution is 15-30 mg / ml.

Example 3. The preparation of the reagent for the determination of ATP based on highly purified thermostable mutant luciferase

but. 0.1 ml of a concentrated solution of luciferase, obtained as described in example 2, in 20 mm sodium phosphate buffer solution containing 0.5 M NaCl. pH 7.5, 0.3 M imidazole, 2 mM sodium ethylenediaminetetraacetate, 1 mM dithiothreitol with an activity of 3000 U / ml, is added to 49.9 ml of 0.05 M Tris- (hydroxymethyl) -aminomethane acetate solution, pH 7.8 containing 0.5 mm luciferin, 10 mm magnesium sulfate, 1 mm sodium ethylenediaminetetraacetate, 0.5 mm dithiothreitol, 5 mg / ml bovine serum albumin, 90 mg / ml sucrose, mix thoroughly, filtered under sterile conditions (under the laminar) through sterile filter into a sterile flask, pour into 2.0 ml sterile vials, freeze lyophilized, seal hermetically under vacuum, and stored prior to use in the refrigerator. Before use, 2.0 ml of deionized sterile water is added to each bottle and a reagent for measuring ATP concentration with an activity of 6 U / ml is obtained, in the following ratio, wt.%:

Luciferase 0.003 Luciferin 0.014 Tris- (hydroxymethyl) -aminomethane 0.605 Magnesium sulfate 0.246 Acetic acid 0.10 Ethylene diamine tetraacetate sodium 0,038 Dithiothreitol 0.008 Bovine Serum Albumin 0.5 Sucrose 9.0 Water Rest

b. All operations are carried out as described in example 3a, but using a concentrated luciferase solution with an activity of 6000 U / ml and 49.9 ml of 0.1 M Tris (oxymethyl) aminomethane acetate solution, pH 7.8, containing 1.0 mmol luciferin, 20 mM magnesium sulfate, 2 mM sodium ethylenediaminetetraacetate, 1 mM dithiothreitol, 10 mg / ml bovine serum albumin, 180 mg / ml sucrose. Get the reagent for measuring the concentration of ATP with an activity of 12.0 U / ml, in the following ratio of components, wt.%:

Luciferase 0.006 Luciferin 0,028 Tris- (hydroxymethyl) -aminomethane 1,210 Magnesium sulfate 0.492 Acetic acid 0.20 Ethylene diamine tetraacetate sodium 0,076 Dithiothreitol 0.016 Bovine Serum Albumin 1,0 Sucrose 18.0 Water Rest

Example 4. The method for determining ATP

0.05 ml of the reagent obtained as described in example 3, is introduced into a cylindrical microcuvette with a volume of 0.2 ml and a diameter of 7 mm The cuvette is placed in the cuvette compartment of the LUM-1 luminometer and a background signal is recorded, which, as a rule, is equal to or less than 50 conventional units. Then, 0.05 ml of a known ATP solution is added. The solution is rapidly mixed and the intensity of bioluminescence (I) is recorded. The difference between the measured bioluminescence intensity (I) and the background signal is a value that characterizes the bioluminescence intensity of the measured ATPF solution and is proportional to the ATP concentration in the luminometer cuvette. The procedure is repeated for solutions with different concentrations of ATP. The measurement results using the reagents obtained in example 3A-3B are shown in the table.

The dependence of the logarithm of the bioluminescence intensity on the logarithm of the ATP concentration is described by equation (1). For the reagent obtained in example 3A, this dependence is described by the equation:

Igf [I, conv.] = 13,494 + 0,9307 · lg [ATP, mol / l]

with a value of R ² = 0.9946.

For the reagent obtained in example 3b, this dependence is described by the equation:

Ig [I, conv.] = 13,259 + 0,8983 · log [ATP, mol / l]

with a value of R ² = 0.9943.

The concentration of ATP in an unknown sample is determined by the intensity of bioluminescence recorded for an unknown sample, as described above. The numerical value of the ATP concentration is found using equation (1). A comparison of equations (1) obtained for the reagents prepared according to example 3a and 3b shows that the coefficients in both equations coincide within the measurement error. The detection limit of ATP using the reagent obtained in example 3a is 9.6 · 10 ^-14 M, and when using the reagent obtained in example 3b, it is 8.2 · 10 ^-14 M. Therefore, despite the difference in the composition of the reagents and in the activity of luciferase used to obtain them, both reagents allow you to determine the concentration of ATP in the range from 10 ^-13 to 5 × 10 ^-9 mol / L.

Table 1 The results of measuring the concentration of ATP using the reagent obtained in examples 3a-3b The concentration of ATP in the cell, mol / l The intensity of bioluminescence, (I), conventional units (minus background) The reagent according to example 3A The reagent according to example 3b 5 × 10 ^-9 694988 846484 2.5 × 10 ^-9 359988 369984 5 × 10 ^-10 75388 84984 2.5 × 10 ^-10 35788 38384 5 × 10 ^-11 6028 8584 2.5 × 10 ^-11 3688 4084 5 × 10 ^-12 1088 1684 2.5 × 10 ^-12 430 547 5 × 10 ^-13 202 230 2.5 × 10 ^-13 61 122 Background signal 12 16

Claims (2)

1. Reagent for the determination of adenosine 5'-triphosphate, including luciferase isolated from recombinant E. coli cells containing a plasmid with the firefly luciferase gene, luciferin, magnesium sulfate, tris (oxymethyl) aminomethane, acetic acid, ethylenediaminetetra tetraacetate bovine serum albumin and water, characterized in that it contains sucrose as a stabilizer and mutant firefly luciferase Luciola mingrelica (SEQ ID No: 2) isolated from recombinant E. coli cells transformed with pETL7 plasmid with the mutant luciferase gene Fireflies Luciola mingrelica, encoding (in comparison with the initial enzyme, SEQ ID No: 1) the amino acid sequence of the enzyme with eight substitutions (Ser118Cis, Cis146Ser, Lys156Arg, Arg211Ley, Tre213Ser, Ala217Val, Glu356Liz, Serla-Seris-64Cis) Lys at the N-terminus and an additional sequence of Ser-Glu-Pro-Val-Glu-Gis-Gis-Gis-Gis-Gis-Gis at the C-end instead of the Ala-Liz-Met sequence in the following ratio of components, wt.%:
Luciferase 0.003-0.006 Luciferin 0.014-0.028 Tris- (hydroxymethyl) -aminomethane 0.605-1.210 Magnesium sulfate 0.246-0.492 Acetic acid 0.10-0.20 Ethylene diamine tetraacetate sodium 0.038-0.076 Dithiothreitol 0.008-0.016 Bovine Serum Albumin 0.5-1.0 Sucrose 9.0-18.0 Water Rest 2. The reagent for determining adenosine 5'-triphosphate according to claim 1, characterized in that it contains mutant firefly luciferase Luciola mingrelica with a specific activity of 3000-6000 U / ml (200 U / ml protein).

Images