CN117587013A - Construction method of zebra fish model for vascular dysplasia - Google Patents

Abstract

The invention discloses a method for constructing a zebra fish model with abnormal vascular development, and belongs to the technical field of genetic engineering. The invention adopts specific sgRNA to knock out the nucleotide sequence shown in SEQ ID NO on No. 10 zebra fish chromosome: 1 or SEQ ID NO:2, a zebra fish model is constructed by the sequence shown in the formula, and the vascular dysplasia of the zebra fish model is found, so that obvious correlation exists between the deletion of the gene segment and the vascular dysplasia, and a foundation is laid for screening of disease drugs caused by the vascular dysplasia.

Description

Construction method of zebra fish model for vascular dysplasia

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for constructing a zebra fish model with abnormal vascular development.

Background

The characteristics of zebra fish in genome, proteome, embryo development, disease generation mechanism and the like are highly consistent with human beings, so that the zebra fish becomes ideal genetics and developmental biology model organisms for researching vertebrate embryo, tissue organ development and human diseases. In addition, the zebra fish has the unique advantages of small volume, strong reproductive capacity, short reproductive cycle, in vitro fertilization, transparent embryo, rapid growth and the like. Particularly, the early development of the blood and cardiovascular system of the zebra fish is very similar to that of human beings, and the mutant with the defects of the blood and the cardiovascular system can still survive for a plurality of days, thereby providing very favorable conditions for researching the blood and the cardiovascular system.

During early embryo development in zebra fish, the hematopoietic system originates from ventral mesoderm. In the permanent hematopoietic stage, hematopoietic processes occur in the posterior blood island, or site known as the caudal hematopoietic tissue. Permanent hematopoietic stem cells originate from the dorsal aortic ventral wall and subsequently migrate to the caudal hematopoietic tissue where they undergo further proliferation, differentiation. Migrate to adult zebra fish hematopoietic organs-kidneys at 5dpf, and persist for lifetime hematopoietic as adult zebra fish hematopoietic organs at 13 dpf.

In the hematopoiesis process of zebra fish embryo, various signal path molecules and transcription factors involved in the process are also highly conserved with mammals. Some transcription factors such as scl, gata2, lmo2 are expressed in early blood and vascular precursor cells and are considered factors that regulate hematopoietic processes early. Transcription factors c-myb and runX1, which are key factors in the process of permanent hematopoiesis, are considered as marker genes for hematopoietic stem cells. In gata 1-deleted zebra fish embryos, erythroid precursor cells transformed into myeloid cells, suggesting that gata1 plays a key role in early erythropoiesis. Hbae1 encoding hemoglobin is a specific marker for mature red blood cells. Pu.1 is one of the members of the ETS family of transcription factors, and is involved in the early development of myeloid cells. Myeloperoxidase mpo, l-plastin and lyC are specifically expressed at various cell lineage development stages of the myeloid lineage, and appear later than Pu.1 expression, approximately up to 4-6dpf in duration, and are later myeloid precursor cell markers. Mpo is a granulocyte-specific marker and l-plastin marks mainly macrophages. In addition, zebra fish lymphoid system development initiates later than other lineages, rag1 specifically labels lymphocytes.

Vascular endothelial cells and pericytes and other blood vessel adjacent cells and secretion products thereof together form a blood vessel microenvironment, and important physiological processes such as hematopoiesis and the like are regulated in various modes. Endothelial cells form the inner wall of blood vessels and participate in various physiological processes such as blood-tissue barrier formation, hemofiltration, maintenance of vascular tension, nutrient transport, and immunoregulation. The regulation of hematopoiesis by the vascular microenvironment is achieved primarily by maintaining the survival and function of HSCs. HSCs cultured in vitro can sustain themselves by co-culture with endothelial cells, the effects of which are most pronounced. In addition, perivascular cells play an important role in the maintenance of hematopoietic stem cells, and most of them are hematopoietic stem cells and LEPR ⁺ There is a close positional relationship between cells and CAR cells, and the clearance of these cells causes a reduction in HSC numbers. Endothelial cells are a source of a number of important cytokines in the bone vascular microenvironment, including the chemokines CXC ligand 12 (C-X-C motif chemokine ligand, CXCl 12), stem Cell Factor (SCF), BMP and Notch ligands, among others. Conditional endothelial cell knockout of CXCL12 or SCF results in a substantial reduction in the number of hematopoietic stem cells and disruption of maintenance of hematopoietic homeostasis. In addition to cytokine regulation, the metabolic and physicochemical properties of the microenvironment may also have an impact on HSCs, such as oxygen tension, valine, etc.

The vascular microenvironment is critical to surrounding cells and tissues, and deep analysis of the composition and function of the vascular microenvironment is helpful for deepening understanding of important physiological processes of the organism, and a new treatment strategy for blood and bone diseases is provided. Based on the method, a new blood vessel and blood disease model is constructed, and a foundation is laid for deep exploration of the relationship between the blood vessel microenvironment and hematopoiesis.

Disclosure of Invention

The invention aims to provide a method for constructing a zebra fish model with abnormal vascular development, which solves the problems in the prior art, and constructs the zebra fish model by knocking out 41048109-41048123 bases of an intergenic sequence on a zebra fish No. 10 chromosome, so that the abnormal vascular development of the model is found, the defect of the gene segment and the abnormal vascular development have obvious relevance, and a foundation is laid for screening medicaments for diseases caused by the abnormal vascular development.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides an sgRNA acting on a gene fragment on a zebra fish chromosome 10, wherein a targeting domain of the sgRNA is selected from SEQ ID NO: 3-5:

SEQ ID NO:3 is: 5'-ACACGGAATCTGCGCGCGC-3';

SEQ ID NO:4 is: 5'-CAGATTTTCTGCAAGTTA-3';

SEQ ID NO:5 is: 5'-TTATTAATTCTGTTTATT-3'.

Preferably, a primer set for amplifying the sgRNA of claim 1, said primer set comprising any one of the combinations of (1) - (3):

(1)sgRNA-F1(SEQ ID NO：6)：

5’-GCGTAATACGACTCACTATAGGTAACTTGCAGAAAATCTGGTTTTAGAGCTAGAAATAG-3’；

sgRNA-R(SEQ ID NO：7)：5’-AAGCACCGACTCGGTGCCACT-3’；

(3)sgRNA-F2(SEQ ID NO：8)：5’-GCGTAATACGACTCACTATAGGGCGCGCGCAGATTCCGTGGTTTTAGAGCTAGAAATAG-3’；

sgRNA-R(SEQ ID NO：9)：5’-AAGCACCGACTCGGTGCCACT-3’；

(3)sgRNA-F3(SEQ ID NO：10)：5’-GCGTAATACGACTCACTATAGGTTATTAATTCTGTTTATTGTTTTAGAGCTAGAAATAG-3’‘

sgRNA-R(SEQ ID NO：11)：5’-AAGCACCGACTCGGTGCCACT-3’。

the invention also provides a construction method of the zebra fish model with the abnormal vascular development, which comprises the step of knocking out a gene fragment on a zebra fish No. 10 chromosome by adopting the sgRNA to obtain the zebra fish model with the abnormal vascular development;

the nucleotide sequence of the gene fragment on the No. 10 zebra fish chromosome is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

SEQ ID NO. 1 is:

41048132

of the above sequences, the italic bold-marked sequencesPAM sequence is shown as the recognition cleavage site for cas9 protein. Grey highlights target site sequence 3, wavy lines indicate target site sequence 2, double underlined indicates target site sequence 1. The single underline indicates the detection primer sequence F2, the dotted line of the detection primer F1, the broken line of the detection primer R (the detection primer F1 and F2 share one reverse detection primer R), the base in bold and the "CCG" in italics are the base sequences of small fragment deletions and mutations.

SEQ ID NO:2 is: ACACGGAATC TGCGCGCGCA GAATTCCGCA GATTTTCTGC AGAATTCCGC AGATTTTCTGC AAGTTATTAG.

Preferably, the gene fragment on chromosome 10 of the zebra fish is knocked out by introducing the sgRNA and Cas9 mRNA mixture into the zebra fish.

The invention also provides an application of the sgRNA in preparing a zebra fish model with abnormal vascular development.

The invention discloses the following technical effects:

the invention discovers that a plurality of binding sites exist between the aak b and antxr1b genes of the zebra fish No. 10 chromosome, and can be combined with the genes of cebpd, zbtb14 and the like, and the genes are related to blood vessels and hematopoiesis. Thus, it was deduced that the intergenic sequence located on chromosome 10 might be involved in vascular development and hematopoiesis. By knocking out the sequence of SEQ ID NO on chromosome 10 of zebra fish: 1 or SEQ ID NO:2, the result shows that: vascular dysplasia in zebra fish, and massive death of embryos, indicates the presence of the sequence of SEQ ID NO:1 or SEQ ID NO:2 with vascular development, which provides a new action target and direction for drug screening of vascular diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram of a bioinformatic analysis result;

FIG. 2 shows the results of an electrophoretic detection of amplified synthetic sgRNA; m is a standard DNA molecule, and 1-2 is a PCR amplification product;

FIG. 3 shows agarose gel electrophoresis of purified sgRNA; m is a standard DNA molecule, 1-2 is transcribed sgRNA;

FIG. 4 is a zebra fish embryo at different times; a: wild-type embryo at 5 dpf; b: hemorrhagic stroke mutant zebra fish embryos at 5 dpf; c: blood flow rate measurements of normal phenotype sibling embryos and hemorrhagic stroke mutant zebrafish embryos at4 dpf;

FIG. 5 shows amplification results; s1-s4 are PCR amplification results of sibling embryos, M1-M5 are PCR amplification results of phenotypic embryos, M is a standard DNA molecule;

FIG. 6 shows the sequencing results of the mutant;

FIG. 7 is a neutral staining result;

FIG. 8 is a graph of differential gene volcanic of wild-type and hemorrhagic stroke zebra fish;

FIG. 9 shows the results of differential gene GO enrichment analysis of wild type and hemorrhagic stroke zebra fish;

FIG. 10 shows the results of differential gene KEGG enrichment analysis of wild-type and hemorrhagic stroke zebra fish;

FIG. 11 shows the results of Q-PCR of blood cell-associated marker genes;

FIG. 12 shows the results of Q-PCR of vascular-related marker genes;

FIG. 13 shows the results of Q-PCR of a p53 signal pathway portion gene;

FIG. 14 shows the result of electrophoresis detection of the effectiveness of injection by PCR amplification after microinjection of zebra fish embryos; m is a standard DNA molecule, WT is the amplification result of a wild-type embryo, and 1-8 are the amplification results of the embryo after injection;

FIG. 15 shows the morphological observation of the gene mutant zebra fish.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The term "wild-type" or "WT" as used herein refers to wild-type zebra fish.

The term "dpf" as used herein refers to the number of days post-fertilization, and hpf refers to the number of hours post-fertilization.

Example 1

1. Credit analysis

The 41048073-41048142 base (SEQ ID NO: 2) located between the aak b and antxr1b genes of chromosome 10 of zebra fish was found by a letter analysis (ALGGEN-PROMO (https:// alggen.lsi.upc.es/cgi-bin/promo_v3/PROMO/prominit.cgidirDB=TF_8.3)), and the site on this base sequence was able to bind to the celpd (C/EBPdelta), zbtb14 (ZF 5), stat4 and the like genes (see FIG. 1 and Table 1), and was a candidate target for these genes. Wherein, CEBPD regulates angiogenesis through CEBPD-has-miR-429-VEGFA signal, and vascular inflammation can be caused through BRD4/CEBPD signal; zbtb14 regulates pu.1 expression; stat4 is expressed in neutrophils and has myeloid specificity. These genes are all associated with blood vessels and hematopoiesis. It is therefore thought that the intergenic sequence located on chromosome 10 may be involved in vascular development and hematopoiesis.

TABLE 1

2. Construction of a Small fragment Gene knockout Strain

2.1 primer design

The CRISPR/Cas9 knockout target site was designed on the 41048073-41048142 base sequence between the aak b and antxr1b genes of chromosome 10 and sgrnas were synthesized.

The sgRNA primers are shown below.

sgRNA-F1： (underlined is the target site sequence)

sgRNA-R (universal reverse primer): 5'-AAGCACCGACTCGGTGCCACT-3';

universal template sequence: TTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT.

2.1 PCR amplification

And (3) carrying out PCR amplification by taking the universal template sequence as a template and the sgRNA-R as a reverse primer and the sgRNA-F1 as a forward primer to obtain double-stranded DNA for specific gRNA synthesis.

The PCR reaction was as follows (50. Mu.L): ddH ₂ O3. Mu.L, 5X enhancer Buffer 10. Mu.L, 2 XBuffer (20 mM Mg) ²⁺ ) 25 mu L, sgRNA-F1 (or sgRNA-F2, 10. Mu.M) 5 mu L, sgRNA-R (10. Mu.M) 5. Mu.L and template (synthetic) 2. Mu.L.

After shaking and mixing evenly, centrifuging at4 ℃, and carrying out amplification reaction on a PCR instrument; after the detection determines that the band is correct, agarose gel DNA recovery is performed, and the PCR product is purified and recovered.

2.2 in vitro transcription

Measuring the concentration of purified DNA, and using the DNA as a template to carry out in vitro transcription by using a 20 mu L system to synthesize specific gRNA; the in vitro transcription reaction system is shown in Table 2.

TABLE 2

The reactants were all added to a 1.5mL EP tube, mixed well and then water-bath at 37℃for 2h; after the water bath is completed, the DNA template is digested and then subjected to agarose electrophoresis.

2.3 purification of sgRNA

Purifying the successfully transcribed gRNA, namely sgRNA-1, by using an RNeasy Mini kit, and storing the gRNA-1 at the temperature of-20 ℃; agarose gel electrophoresis was performed to examine the purified product and the gRNA concentration after purification was determined with Nano drop.

2.4 microinjection

Firstly, 0.5 mu L of sgRNA-1 is uniformly mixed with 0.5 mu L of Cas9 (Thermo Fisher company) and 2 mu L of RNase-free water, and about 1.0nL of mixed solution of Cas9 mRNA and gRNA is injected into fertilized eggs of zebra fish in a cell stage; the fertilized eggs were placed in E3 water and incubated at 28 ℃.

2.5 construction of lines

Culturing the injected embryo to adult fish, hybridizing the adult fish with wild TU zebra fish to obtain F1-generation embryo, and collecting embryo when the F1-generation embryo grows to 36hpf, wherein two embryos are collected in each tube. Extracting embryo total genome for genotyping. The PCR amplification primers were as follows:

detection primer F1:5'-CCTTAACTTATTGGTAGGCCCA-3';

detection primer R:5'-TTCCTCCCAAAAGAAATCCAC-3'.

The template is the genome extracted from the embryo.

The PCR products were subjected to PAGE gel electrophoresis in which 1 zebra fish offspring PCR amplified products appeared in a band different from the wild type. The zebra fish is F0 generation zebra fish which is knocked out successfully. The offspring of the zebra fish are cultivated until 3 months of tail cutting for genotyping. F1 generation zebra fish which is knocked out successfully is selected and selfed. About 1/4 of the selfing offspring were found to have a slow blood flow beginning on day 4 to all embryos stopped in blood flow and heart beat on day 6 with a small head, small eyes, and enlarged heart chamber (see fig. 4). Phenotypic embryos and sibling embryos were collected for genotyping. As shown in FIG. 5, s1-s4 are the PCR amplification results of sibling embryos, and m1-m5 are the PCR amplification results of phenotypic embryos. The results showed that the phenotypic embryos were homozygote and the sibling embryos were wild type and heterozygote. Thus, the phenotype was judged to be caused by mutation of the 41048073-41048142 base fragment.

The PCR amplified products of homozygous mutant embryos were sent to the Biotechnology company for sanger sequencing. The sequencing result is shown in FIG. 6, and the analysis result shows that the sequence is 32bp deleted (the base deletion of 41048093-41048122 and 41048125-41048126 bases of the intergenic sequence on the No. 10 zebra fish chromosome) compared with the NCBI reference sequence; compared with the wild type sequence measured in the laboratory, the mutant sequence is deleted by 11bp and mutated by 1 base.

NCBI reference sequence: (the wavy line and underlined bases indicate the actual sequence of deletion of the wild-type from the reference sequence, the underlined bases indicate the sequence of deletion of the mutant from the wild-type, and C/T and G/T indicate NCBI reference sequences and mutant/mutant bases of the wild-type in the laboratory)

Sequence alignment of the mutant with NCBI wild-type reference sequence. Query is wild type and Sbjct is mutant.

The mutant was aligned with the wild-type sequence of the present laboratory. Query is wild type and Sbjct is mutant.

2.6 neutral Red dyeing

At 4dpf, wild-type and mutant embryos were stained with 2.5 μg/mL neutral red staining solution (vital stain, 30mL E3 water+75 μg neutral red powder per embryo) for 6 hours, rinsed with E3 water, and observed for the number and distribution of neutrophils under a split microscope. As shown in fig. 7, in the wild-type embryo, macrophages are concentrated in the tail hematopoietic tissue, while in the mutant embryo, macrophage signals are distributed throughout the body. Macrophages are classified into resident macrophages and infiltrating macrophages, and when inflammation occurs, the infiltrating macrophages aggregate toward the site of inflammation. The difference in neutral red signal distribution between wild type and mutant embryos indicates that the mutant has a broader inflammatory response. Macrophages are an important source of vascular endothelial growth factor (vascular endothelial growth factor, VEGF-A), and the recruitment of blood-derived macrophages and the VEGF-A derived from macrophages can initiate angiogenesis and increase vascular permeability, and promote proliferation and migration of endothelial cells. Thus, abnormal macrophage distribution may suggest that the mutant embryo blood vessel is dysplastic.

2.7 detection of differentially expressed genes in mutant embryos by transcriptome analysis and Q-PCR methods

Juvenile fish of 5dpf WT and 5dpf mutants were collected, transcriptome sequenced by the Megaku organism, and the remaining embryos were used to extract total RNA from the embryos using trizol, performed according to the procedure described. Reverse transcription into cDNA is performed using reverse transcriptase. Q-PCR was performed using zebra fish 18s as an internal reference gene, wherein the sequence information of the primers is shown in Table 3 below, and the Q-PCR reaction system and reaction procedure are shown in tables 4 and 5 below.

TABLE 3 Table 3

TABLE 4 RT-qPCR reaction System

TABLE 6 RT-qPCR reaction conditions

The results are shown in FIG. 8, volcanic plots of the differential genes of wild-type and hemorrhagic stroke zebra fish, and further analysis of these differential genes, and the results are shown in FIG. 9 and FIG. 10, wherein the differential expression genes of hemorrhagic stroke zebra fish are mainly enriched in metabolic and apoptosis-related signaling pathways, such as lipid metabolism, drug metabolism, p53 signaling pathway, etc., as compared to wild-type. As shown in fig. 11-13, the expression of the blood cell marker gene of the zebra fish is abnormal in hemorrhagic stroke, the expression of the hematopoietic related gene such as cmyb is obviously down-regulated, and the mature red blood cell marker gene hbae1, the myeloid marker genes I-plaetin and lyz, the gonorrhoeae marker gene rage1 and the like are obviously up-regulated by the detection of Q-PCR; vascular marker genes fli1a and kdrl are significantly upregulated; the p53 signaling pathway such as tp53, mdm2 and the like genes are significantly up-regulated. The results show that in the mutant zebra fish, vascular development and hematopoiesis are disturbed, apoptosis is increased, and inflammation is generated.

3. Construction of large fragment Gene knockout Strain

3.1 to further confirm the relationship between the 41048073-41048142 bases located between the aak b and antxr1b genes of chromosome 10 and hematopoiesis, sgRNA-2 and sgRNA-3 were designed, and the sgRNA-2 and sgRNA-3 can completely knock out the 41048073-41048142 bases of chromosome 10.

sgRNA-F2：

sgRNA-F3：

The sequence which is thickened in the above sequence is the target site sequence.

3.2sgRNA synthesis and injection were identical to the procedure described above for "construction of 2, small fragment knockout lines" (gDNA synthesis results are shown in FIG. 2, and gRNA purification results are shown in FIG. 3). The system was changed to cas9 protein 0.5. Mu.L, sgRNA-2.5. Mu.L, sgRNA-3.5. Mu.L and enzyme-free water 0.5. Mu.L at the time of microinjection.

3.3 detecting whether the knockout was successful

After microinjection of zebra fish embryos, 8 tubes of embryos developed to 2dpf were collected, 2 embryos per tube, and the presence or absence of mutation in the intergenic sequence was detected.

The PCR amplification primers were as follows:

detection primer F2:5'-CTGCAAAACTGACGCACACT-3';

detection primer R:5'-TTCCTCCCAAAAGAAATCCAC-3'.

The PCR product (SEQ ID NO: 1) was subjected to agarose gel electrophoresis.

As a result, as shown in FIG. 14, lanes 1, 4, 5, 6, and 7, except for the 469bp wild-type band (see SEQ ID NO: 1), there was a small band, indicating successful knockout.

3.4 morphological observations of Gene mutants of zebra fish

The injected embryos were observed under an in-vitro microscope at 4dpf, and phenotypes such as small head, small eye, enlarged heart-surrounding cavity, slow or even stopped blood flow appeared, as shown in fig. 15, consistent with the phenotypes of the above-described small fragment knockout line. And the embryo after injection is dead (more than 3/4), which shows that the intergenic sequence has important functions in the development process of zebra fish blood vessels.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (5)

1. A sgRNA acting on a gene fragment on chromosome 10 of zebra fish, the targeting domain of the sgRNA being selected from the group consisting of SEQ ID NOs: 3-5.

2. The primer set for amplifying sgrnas of claim 1, wherein the primer set comprises any one of the combinations of (1) - (3):

(1)sgRNA-F1：

5’-GCGTAATACGACTCACTATAGGTAACTTGCAGAAAATCTGGTTTTAGAGCTAGAA ATAG-3’；

sgRNA-R：5’-AAGCACCGACTCGGTGCCACT-3’；

(2)sgRNA-F2：5’-GCGTAATACGACTCACTATAGGGCGCGCGCAGATTCCGTGGTTT TAGAGCTAGAAATAG-3’；

sgRNA-R：5’-AAGCACCGACTCGGTGCCACT-3’；

(3)sgRNA-F3：5’-GCGTAATACGACTCACTATAGGTTATTAATTCTGTTTATTGTTTTA GAGCTAGAAATAG-3’‘

sgRNA-R：5’-AAGCACCGACTCGGTGCCACT-3’。

3. the method for constructing the zebra fish model with the vascular dysplasia is characterized by comprising the step of obtaining the zebra fish model with the vascular dysplasia by knocking out a gene fragment on a chromosome 10 of the zebra fish by using the sgRNA of claim 1;

the nucleotide sequence of the gene fragment on the No. 10 zebra fish chromosome is shown as SEQ ID NO. 1 or SEQ ID NO. 2.

4. The method of claim 3, wherein the gene fragment on chromosome 10 of the zebra fish is knocked out by introducing the sgRNA and Cas9 mRNA mixture into the zebra fish.

5. Use of the sgRNA of claim 1 for the preparation of a zebra fish model of vascular dysplasia.