CN117568300A

CN117568300A - Amine dehydrogenase mutant and application thereof in preparation of optically active gamma/delta lactam

Info

Publication number: CN117568300A
Application number: CN202311585901.7A
Authority: CN
Inventors: 白云鹏; 张桐语; 张晓彦
Original assignee: East China University of Science and Technology
Current assignee: East China University of Science and Technology
Priority date: 2023-11-27
Filing date: 2023-11-27
Publication date: 2024-02-20

Abstract

The invention relates to an amine dehydrogenase mutant and application thereof in preparation of optically active gamma/delta lactam. The method specifically comprises a mutant of amine dehydrogenase from thermophilic hydrogen sulfide-producing thermophilic anaerobic bacillus (Thermoanaerobacter thermohydrosulfuricus), a gene, a recombinant expression vector and a recombinant expression transformant containing the gene, and a method for preparing optically active gamma/delta-lactam by using the amine dehydrogenase mutant or the recombinant expression transformant as a catalyst to catalyze asymmetric amination of medium-long-chain keto acid. Compared with the prior art, the amine dehydrogenase TtherAmDH mutant provided by the invention can be used for catalyzing the asymmetric amination of medium-long chain keto acid in a stereoselective manner to generate corresponding optically active medium-long chain gamma-/delta-amino acid, and then cyclizing to generate gamma-/delta-medium-long chain lactam by a chemical method, and has the advantages of mild reaction conditions, high conversion rate, good optical purity of the product and good industrial application prospect.

Description

Amine dehydrogenase mutant and application thereof in preparation of optically active gamma/delta lactam

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a mutant of amine dehydrogenase from thermophilic hydrogen sulfide-producing thermophilic anaerobic bacillus (Thermoanaerobacter thermohydrosulfuricus), a gene thereof, a recombinant expression vector and a recombinant expression transformant containing the gene, and a method for preparing optically active gamma/delta-lactam by using the amine dehydrogenase mutant or the recombinant expression transformant as a catalyst for catalyzing asymmetric amination of medium-long-chain keto acid.

Background

Cyclic lactams are widely used in organic chemistry as key intermediates in the synthesis of more complex structures, as well as core structures for natural products or important pharmaceutical compounds. Penicillin and cephalosporin are the main types of beta-lactams used today, the basic structure of which is a four-membered ring. Gamma-lactams, also known as 2-pyrrolidone, belong to the core structure of a large number of natural and unnatural substances, covering a wide range of biological activities. Delta-lactams, also known as 2-piperidinones, have attracted considerable attention in recent years because of the presence of these nitrogen-containing heterocyclic compounds in biologically active compounds.

However, the synthesis of gamma/delta-lactams by extraction from plants or by chemical methods has certain drawbacks such as low yields, poor optical purity and environmental pollution. The method for catalyzing the racemic lactam by dynamic resolution has high cost and low yield although more reports exist; although the amino acid dehydrogenase is present in a large amount and is easily available, reductive amination of a ketone substrate using a commercially available amino acid dehydrogenase requires the use of isopropylamine, alanine, or the like as an amine donor, the catalytic efficiency itself is not high, and by-products are accumulated as the reaction occurs. For the above reasons, developing a novel, low-cost, safe, green and excellent-selectivity lactam synthesis method has important scientific and application values.

Amine dehydrogenases (AmDH) are capable of catalyzing the reductive amination of a ketone substrate using free ammonia as an amine donor for the synthesis of amines. Most reported AmDH is engineered from amino acid dehydrogenase and few are reported for naturally occurring amine dehydrogenases. In 2016, mayol et al found that the native amine dehydrogenase AmDH4 from Petrotoga mobilis was able to catalyze the synthesis of chiral amino acids (S) -4-aminopentanoic acid by aminating a ketoacid substrate with a stereoselectivity ee (S) > 99.5%. In 2019, mayol et al performed protein crystallization on AmDH4, which found four amino acid residue mutations that could activate AmDH4 for the substrate 2-pentanone, and four amino acid mutations could alter the substrate specificity of the enzyme protein. In 2020, cai et al performed directed evolution on AmDH4 found by Mayol, and the mode substrate was levulinic acid, and succeeded in obtaining three mutants with a 6.7-fold improvement in wild-type specific activity. In 2020, caparo et al developed a series of novel amine dehydrogenases using genome mining techniques, successfully cloned and expressed 18 native amine dehydrogenases from nature, one of which, ttherAmDH, was from Thermoanaerobacter thermohydrosulfuricus, but had lower native enzyme activity. In general, the existing technology for preparing optically active chiral lactams by using a biocatalysis method has the problems of low activity and poor selectivity of natural enzymes of amine dehydrogenases.

Disclosure of Invention

The invention aims to solve the technical problems that the existing biocatalysis method for preparing the optically active chiral lactam technology has low natural enzyme activity and poor selectivity, and provides a mutant of the amine dehydrogenase with high catalytic activity and strong selectivity from Thermoanaerobacter thermohydrosulfuricus through technical means such as molecular transformation of enzyme protein. The invention further provides a recombinant expression vector and a recombinant expression transformant containing the amine dehydrogenase mutant gene, and provides application of the recombinant amine dehydrogenase mutant in asymmetric transformation of medium-long-chain carbonyl acid to preparation of corresponding optically active gamma-/delta-lactam.

The aim of the invention can be achieved by the following technical scheme:

one of the technical schemes of the invention is as follows: an amine dehydrogenase mutant with significantly improved catalytic performance is provided.

The invention takes amine dehydrogenase TtherAmDH from thermophilic hydrogen sulfide-producing thermophilic anaerobic bacillus (Thermoanaerobacter thermohydrosulfuricus) as a female parent, and screens mutants with improved catalytic performance, stability and enantioselectivity through random mutation and semi-rational modification, wherein the amino acid sequence of the amine dehydrogenase TtherAmDH is shown as SEQ ID No. 2. The nucleotide sequence of the amine dehydrogenase TtherAmDH gene is shown as SEQ ID No. 1.

In the invention, the amine dehydrogenase gene is used as a female parent, combined mutation strategies such as error-prone PCR, iterative saturation mutation, DNA (deoxyribonucleic acid) buffering and the like are adopted to further directionally evolve, and 5-carbonyl caproic acid is used as a mode substrate by combining high-throughput primary screening of an enzyme-labeling instrument and secondary screening of an ultraviolet spectrophotometer, so that the amine dehydrogenase with remarkably improved catalytic performance and enantioselectivity is identified.

The amine dehydrogenase mutant (also called as amine dehydrogenase TtherAmDH mutant) provided by the invention is a derivative protein of a novel amino acid sequence formed by replacing one or more amino acid residues of threonine 36, aspartic acid 37, serine 41, threonine 59, glutamic acid 119, glutamic acid 189, valine 191, methionine 251 and tyrosine 282 in an amino acid sequence shown in SEQ ID No.2 with other amino acid residues, and the derivative protein has higher catalytic performance and enantioselectivity than those of a protein consisting of the amino acid sequences shown in SEQ ID No. 2.

In one embodiment of the invention, the amine dehydrogenase mutant is a derivative protein of a novel amino acid sequence formed after the combination of mutations selected from one or more of the following, and the derivative protein has catalytic properties and enantioselectivity higher than those of the protein consisting of the amino acid sequence shown in SEQ ID No. 2:

(1) Substitution of threonine at position 36 of the amino acid sequence shown in SEQ ID No.2 with alanine;

(2) Substitution of aspartic acid at position 37 of the amino acid sequence shown in SEQ ID No.2 with glycine;

(3) Replacing serine at position 41 of the amino acid sequence shown in SEQ ID No.2 with lysine;

(4) Substitution of threonine at position 59 of the amino acid sequence shown in SEQ ID No.2 with alanine;

(5) Substitution of glycine for glutamic acid at position 119 of the amino acid sequence shown in SEQ ID No. 2;

(6) Substitution of glutamic acid at position 189 of the amino acid sequence shown in SEQ ID No.2 with glycine;

(7) Substitution of valine at position 191 of the amino acid sequence shown in SEQ ID No.2 with alanine;

(8) Substitution of methionine at position 251 of the amino acid sequence shown in SEQ ID No.2 with lysine;

(9) The 282 rd tyrosine of the amino acid sequence shown in SEQ ID No.2 is replaced by cysteine.

In one embodiment of the invention, the amino acid sequence of the amine dehydrogenase mutant is selected from one of the following:

(1) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine in the amino acid sequence shown in SEQ ID No. 2;

(2) Replacing serine at position 41 of the amino acid sequence shown in SEQ ID No.2 with lysine;

(3) Substitution of glutamic acid at position 189 of the amino acid sequence shown in SEQ ID No.2 with glycine;

(4) Substitution of methionine at position 251 of the amino acid sequence shown in SEQ ID No.2 with lysine;

(5) The 41 st serine of the amino acid sequence shown in SEQ ID No.2 is replaced by lysine, and the 189 rd glutamic acid is replaced by glycine;

(6) Replacing serine at position 41 of the amino acid sequence shown in SEQ ID No.2 with lysine, and replacing methionine at position 251 with lysine;

(7) Substitution of glutamic acid at position 189 with glycine and methionine at position 251 with lysine of the amino acid sequence shown in SEQ ID No. 2;

(8) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine in the amino acid sequence shown in SEQ ID No. 2;

(9) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of threonine at position 59 for alanine in the amino acid sequence shown in SEQ ID No. 2;

(10) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of glutamic acid at position 119 for glycine in the amino acid sequence shown in SEQ ID No. 2;

(11) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of valine at position 191 for alanine in the amino acid sequence shown in SEQ ID No. 2;

(12) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of threonine at position 59 for alanine, substitution of glutamic acid at position 119 for glycine in the amino acid sequence shown in SEQ ID No. 2;

(13) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of threonine at position 59 for alanine, substitution of valine at position 191 for alanine in the amino acid sequence shown in SEQ ID No. 2;

(14) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of valine at position 191 for alanine in the amino acid sequence shown in SEQ ID No. 2;

(15) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of threonine at position 59 for alanine, substitution of valine at position 191 for alanine in the amino acid sequence shown in SEQ ID No. 2;

(16) Substitution of serine at position 41 for lysine, substitution of glutamic acid at position 189 for glycine, substitution of methionine at position 251 for lysine, substitution of threonine at position 36 for alanine, substitution of threonine at position 59 for alanine, substitution of aspartic acid at position 37 for glycine in the amino acid sequence shown in SEQ ID No. 2;

(17) Serine at position 41 of the amino acid sequence shown in SEQ ID No.2 is replaced by lysine, glutamic acid at position 189 is replaced by glycine, methionine at position 251 is replaced by lysine, threonine at position 36 is replaced by alanine, threonine at position 59 is replaced by alanine, aspartic acid at position 37 is replaced by glycine, and tyrosine at position 282 is replaced by cysteine.

The second technical scheme of the invention is as follows: an isolated nucleic acid encoding the amine dehydrogenase ttheramadh mutant, i.e., a gene encoding the amine dehydrogenase ttheramadh mutant, and recombinant expression vectors comprising the same, are provided.

The coding gene codes and expresses the amine dehydrogenase TtherAmDH mutant obtained by evolution modification in the technical scheme I, and the sources comprise: cloning the gene sequence of the series amine dehydrogenase TtherAmDH mutant according to the technical scheme I by a genetic engineering technology; alternatively, the nucleic acid molecule encoding the amine dehydrogenase TtherAmDH mutant according to claim one can be obtained by artificial total sequence synthesis.

The recombinant expression vector can be constructed by connecting the nucleotide sequence of the amine dehydrogenase TtherAmDH mutant gene of the invention to various empty vectors by a conventional method in the field. The commercially available empty vector may be various plasmid vectors conventional in the art, as long as the recombinant expression vector can normally replicate in a corresponding expression host and express a corresponding enzyme. Preferred plasmid vectors are different for different expression hosts. It will be clear to a person of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells. For E.coli hosts, the preferred plasmid vector is the pET-28a (+) plasmid. The escherichia coli recombinant expression vector can be prepared by the following method:

The amine dehydrogenase TtherAmDH mutant gene fragment obtained by PCR amplification is digested with restriction enzymes EcoR I and Hind III, simultaneously the empty plasmid pET-28a (+) is digested with restriction enzymes EcoR I and Hind III, the DNA fragment of the digested amine dehydrogenase TtherAmDH mutant and the empty plasmid are recovered, and the DNA fragment and the empty plasmid are connected by using T4 DNA ligase, so that a recombinant expression vector containing the nucleic acid molecule for expressing the amine dehydrogenase TtherAmDH mutant is constructed.

The synthetic primers involved are preferably as shown in SEQ ID No.11 (upstream primer) and SEQ ID No.12 (downstream primer):

an upstream primer: 5' -CCGGAATTCATGGAAAATATAAAAGTCGTAGTTTGGGG-3', the underlined sequence is the cleavage site for the restriction enzyme EcoR I;

a downstream primer: 5' -CCCAAGCTTTTAACGGCGACGAATCATAT-3', the underlined sequence is the restriction site for the restriction enzyme HindIII.

The third technical scheme of the invention: a recombinant expression transformant comprising the amine dehydrogenase TtherAmDH mutant gene of the present invention or a recombinant expression vector thereof is provided. Recombinant expression transformants can be prepared by transforming an already constructed recombinant expression vector into a host cell. The host cell is a variety of conventional host cells in the art, and it is required that the recombinant expression vector is capable of stably self-replicating and efficiently expressing after induction by an inducer. The invention takes escherichia coli as host cells, and more preferably escherichia coli E.coli BL21 (DE 3) is used for high-efficiency expression of target proteins by recombinant expression vectors.

The technical scheme of the invention is as follows: providing a recombinant amine dehydrogenase TtherAmDH mutant catalyst, wherein the recombinant amine dehydrogenase TtherAmDH mutant catalyst is in any of the following forms:

(1) Culturing said recombinant expression transformant and isolating a transformant cell containing said amine dehydrogenase mutant;

(2) Culturing the recombinant expression transformant, separating transformant cells containing the amine dehydrogenase mutant, and crushing the transformant cells containing the amine dehydrogenase mutant to obtain a cell crushing solution;

(3) Culturing the recombinant expression transformant, separating transformant cells containing the amine dehydrogenase mutant, disrupting the transformant cells containing the amine dehydrogenase mutant to obtain a cell disruption solution, and purifying and concentrating the cell disruption solution to obtain a pure enzyme solution.

Wherein the culture method and conditions of the recombinant expression transformant are those conventional in the art, comprising the steps of: the recombinant expression transformant of the present invention was cultured to obtain a recombinant amine dehydrogenase ttheramadh mutant.

For recombinant E.coli, the preferred medium is LB medium: 10g/L peptone, 5g/L yeast extract, 10g/L NaCl and pH 6.5-7.0. The preferred cultivation method is: recombinant E.coli constructed as described above was inoculated into 4mL of LB medium containing 50. Mu.g/mL kanamycin, and cultured overnight at 37℃with shaking at 220 rpm. Inoculating 1% (v/v) of the recombinant expression transformant into a 500mL Erlenmeyer flask containing 100mL of LB medium (containing 50. Mu.g/mL kanamycin), shaking and culturing at 37 ℃ with a shaking table at 220rpm, adding isopropyl-beta-D-thiogalactoside (IPTG) with a final concentration of 0.1-0.5mmol/L as an inducer when the OD600 of the culture solution reaches 0.6-0.8, inducing at 16-25 ℃ for 16-24h, centrifuging the culture solution, collecting the precipitate, and washing twice with physiological saline to obtain the recombinant expression transformant cell. And freeze-drying the obtained recombinant cells to obtain the freeze-dried cells containing the amine dehydrogenase TtherAmDH mutant. Suspending the obtained recombinant cells in buffer solution with the volume of 5-10 times (v/w), carrying out ultrasonic crushing, centrifuging and collecting supernatant, thus obtaining crude enzyme solution of the recombinant amine dehydrogenase TtherAmDH mutant. Freeze-drying the obtained crude enzyme solution to obtain freeze-dried enzyme powder; purifying the collected crude enzyme liquid by a nickel column, and performing ultrafiltration and concentration to obtain pure enzyme liquid. The obtained pure enzyme solution is added with 40 percent of glycerol with the volume of 1:1, and is stored in a refrigerator at the temperature of minus 80 ℃ after quick freezing by liquid nitrogen.

The activity determination method of the amine dehydrogenase TtherAmDH mutant comprises the following steps: 1ml of a reaction system (3M ammonium formate buffer, pH 6.5) containing 8 mmol/L5-oxodecanoic acid and 0.2mmol/L NADH was preheated to 40℃and then an appropriate amount of the amine dehydrogenase TtherAmDH mutant was added thereto, the reaction was incubated at 40℃and the change in absorbance of NADH at 340nm was detected on a spectrophotometer and the change in absorbance within 1 minute was recorded.

The enzyme activity was calculated using the following formula: enzyme activity (U) =ew×v×103/(6220×l)

Wherein EW is the change in absorbance at 340nm within 1 minute; v is the volume of the reaction solution, and the unit is mL;6220 is the molar extinction coefficient of NADH, in L/(mol cm); l is the optical path distance in cm.1 enzyme activity unit (U) is defined as the amount of enzyme required to catalyze the oxidation of 1. Mu. Mol NADH per minute under the above conditions.

The fifth technical scheme of the invention is as follows: the application of the recombinant amine dehydrogenase TtherAmDH mutant or the amine dehydrogenase TtherAmDH mutant catalyst in the synthesis of gamma/delta-lactam compounds is provided, namely a method for preparing lactam by utilizing the heavy histamine dehydrogenase TtherAmDH mutant to enzyme asymmetric amination of long-chain keto acid is provided. Wherein the acid structure of the medium-long chain carbonyl acid is as follows:

The compounds described above utilize amine dehydrogenase ttherambh mutants or amine dehydrogenase ttherambh mutant catalysts to asymmetrically aminate carbonyl groups to amino groups, which are then cyclized to form the corresponding lactams.

The specific synthetic route for lactams is as follows:

in the above application, the concentration of the long-chain carboxylic acid in the substrate may be 1 to 8mmol/L, and the amount of the amine dehydrogenase TtherAmDH mutant or the amine dehydrogenase TtherAmDH mutant catalyst may be selected to be 50 to 200U/mol of the substrate.

In one embodiment of the invention NADH or NAD is required in the reaction ⁺ The amount of (C) is 0.1 to the whole0.5mmol/L. In the reaction process, formic acid can be used as an auxiliary substrate, and the coenzyme circulation of NADH in the reaction system is realized through the catalysis of formate dehydrogenase, wherein the consumption of the formate dehydrogenase can be 50-200U/mmol of substrate, and the consumption of the formic acid can be 1.5 times of mmol of the latent chiral carbonyl compound.

In one embodiment of the invention, the buffer required in the asymmetric amination process is ammonium formate buffer, preferably at a concentration of 3mol/L.

In one embodiment of the invention, the asymmetric reduction reaction is carried out under shaking or stirring conditions.

In one embodiment of the invention, the temperature of the asymmetric amination reaction is 20 to 40 ℃, preferably 40 ℃. The time of the asymmetric amination reaction is based on the time when the substrate is completely reacted or the reaction is automatically stopped, and the reaction time is preferably 24-48 h.

Compared with the prior art, the invention has the positive progress effects that:

the amine dehydrogenase TtherAmDH mutant provided by the invention can be used for catalyzing the asymmetric reduction of medium-long chain carbonyl acid in a stereoselective manner to generate corresponding optically active medium-long chain gamma-/delta-amino acid, and then cyclizing to generate gamma-/delta-lactam by a chemical method, and has the advantages of mild reaction conditions, high conversion rate, good optical purity of the product, and an ee value higher than 95%, and has good industrial application prospect.

Detailed Description

The reaction or detection conditions in the summary of the invention or in the examples below may be combined or modified in accordance with common general knowledge in the art and may be verified experimentally. The technical solutions and technical effects of the present invention will be clearly and completely described in the following in conjunction with specific embodiments, but the scope of the present invention is not limited to these embodiments, and all changes or equivalent substitutions without departing from the concept of the present invention are included in the scope of the present invention.

The sources of materials in the following examples are:

the female parent recombinant plasmid pET28a-TtherAmDH contains a nucleic acid sequence shown as a sequence table SEQ ID No.1, and is self-constructed by the inventor.

Plasmid vector pET28a was purchased from Novagen.

E.coli DH 5. Alpha. And E.coli BL21 (DE 3) competent cells, 2X Taq PCR MasterMix, agarose gel DNA recovery kit were purchased from Beijing Tiangen Biochemical technology Co.

The restriction enzymes EcoR I and Hind III are commercial products of the company New England Biolabs (NEB).

Unless otherwise indicated, the specific experiments in the following examples were performed according to methods and conditions conventional in the art, or following the commercial specifications of the kit.

Example 1 semi-rational design screening of TtherAmDH mutants with improved Activity

The activity of the enzyme is enhanced by site-directed saturation mutagenesis of amino acids near the substrate pocket and combination of mutations. In the TtherAmDH steric space structure of the amino acid sequence shown in SEQ ID No.2, the amino acid residues around the substrate 5-carbonyl hexanoic acid binding site include: serine at position 41, glutamic acid at position 189, methionine at position 251, etc. Site-directed saturation mutagenesis was used to saturate the amino acid residues at these sites.

The primers used were:

name of the name	Sequence(s)	SEQ ID No.
			S41-FP	ACCGATCCAAACAAANNKGGTAAAGATTTGAAT	SEQ ID No.3
S41-RP	ATTCAAATCTTTACCMNNTTTGTTTGGATCGGT	SEQ ID No.4
			E189-FP:	AACGGCACCGTTGCCNNKCATATTGGCTTTCCG	SEQ ID No.5
E189-RP	CGGAAAGCCAATATGMNNGGCAACGGTGCCGTT	SEQ ID No.6
			M251-FP	GCAGGTTGCCGTCAGNNKGGTTACGGCAAAGTT	SEQ ID No.7
M251-RP	AACTTTGCCGTAACCMNNCTGACGGCAACCTGC	SEQ ID No.8

PCR amplification was performed using pET28a-TtherAmDH as a template and PrimeStar HS premix to construct a site-directed saturation mutant library. The PCR system was (20. Mu.L):

1. Mu.l of pET28a-TtherAmDH plasmid, 1. Mu.l of each of the upstream and downstream primers (10. Mu.M), 0.2. Mu.l of PrimeStar HS DNA polymerase, 4. Mu.l of 5 XPrimeStar buffer, 1.6. Mu.l of dNTP mix (2.0 mM each), and the Mixture was supplemented with sterilized distilled water to 20. Mu.l.

PCR reaction procedure:

(1) Pre-denaturation at 95℃for 3min;

(2) Denaturation at 98℃for 10s;

(3) Annealing at Tm-5 ℃ for 15s;

(4) Extending at 72 ℃ for 6min 40s;

steps (2) to (4) are carried out for 30 cycles in total

(5) Extending at 72℃for 5min.

After the PCR is completed, the PCR product needs to be digested, and the digestion system is as follows:

8.5. Mu.L of PCR product, 0.5. Mu.L of Dpn I enzyme and 1. Mu.L of rSmartCuffer.

After incubation at 37℃for more than 3h, the digested product was transformed into E.coli BL21 (DE 3) competent cells, and spread evenly on LB agar plates containing 100. Mu.g/ml kanamycin, and placed in a 37℃incubator for resting culture for 8-10h.

Mutants on the transformation plate were picked with toothpicks into 96-well deep well plates and incubated overnight at 37℃in a 220rpm shaker. And (3) sucking 10 mu L of bacterial liquid from the holes of the primary plate, inoculating the bacterial liquid into the corresponding holes of the secondary plate, culturing for 2-3 h in a shaking table at 37 ℃ and 220rpm, and then adding IPTG with the final concentration of 0.2mM, and culturing for 24h at 16 ℃. Then, centrifugation was performed at 3500rpm for 10min at 4℃and the upper medium was removed, 300. Mu.L of lysozyme solution (0.3 g of lysozyme and 3mg of DNase were dissolved in 300mL of ammonium formate) was added to each well, and the mixture was stirred and mixed well, and then, the mixture was subjected to shaking and treatment on a shaker at 37℃for 2.5 hours. Centrifugation at 3500rpm at 4℃for 20min, 100. Mu.L of the cell disruption supernatant was transferred to a 96-well ELISA plate to which 100. Mu.L of the reaction solution was added per well (100. Mu.L of the reaction solution consisted of 3mol/L ammonium formate buffer (pH 6.5) and 16 mmol/L5-carbonyl hexanoic acid and 0.4mmol/L NADH). The decrease in absorbance at 340nm was read on a microplate reader. The expressed protein is subjected to high-flux activity screening in a 96-well plate, mutants with higher activity are subjected to purification characterization, and the corresponding genes are sequenced.

Through high throughput screening by the microplate reader of example 1, it was found that the activity of mutants such as serine at position 41, lysine (S41K), glutamic acid at position 189, glycine (E189G), methionine at position 251, lysine (M251K) and the like on 5-carbonyl hexanoic acid was improved, and specific mutation sites and activities are shown in table 1:

table 1: specific Activity of TtherAmDH mutant on 5-carbonyl hexanoic acid

Combining three mutations of S41K, E189G, M K, and improving the enzyme activity of TtherAmDH by 1.5 times to successfully obtain a mutant TtherAmDH _M1 . On the basis, the mutant is used as a new generation female parent for TtherAmDH _M1 And (5) performing rational design.

EXAMPLE 2 rational design screening of TtherAmDH mutants with improved Activity

Molecular docking is carried out on the TtherAmDH three-dimensional structure model and 5-carbonyl hexanoic acid, and a proper docking posture model is selected according to the catalysis mechanism and the binding energy condition of the short-chain dehydrogenase. The activity of the enzyme is further enhanced by alanine scanning of the amino acids in the vicinity of the substrate pocket.

The primers used were:

name of the name	Sequence(s)	SEQ ID No.
			T36A-FP	GTGGGTGCCATCGACGCAGATCCAAACAAAAGT	SEQ ID No.9
T36A-RP	ACTTTTGTTTGGATCTGCGTCGATGGCACCCAC	SEQ ID No.10

With pET28a-TtherAmDH _M1 As templates, primeStar HS was usedpremix was subjected to PCR amplification to mutate selected amino acid residues to alanine. The PCR system was (20. Mu.L):

pET28a-TtherAmDH _M1 1. Mu.l of plasmid, 1. Mu.l of each of the upstream and downstream primers (10. Mu.M), 0.2. Mu.l of PrimeStar HSDNA polymerase, 4. Mu.l of 5 XPrimeStar buffer, 1.6. Mu.l of dNTP mix (2.0 mM each), and the Mixture was supplemented with sterilized distilled water to 20. Mu.l.

PCR reaction procedure:

(1) Pre-denaturation at 95℃for 3min;

(2) Denaturation at 98℃for 10s;

(3) Annealing at Tm-5 ℃ for 15s;

(4) Extending at 72 ℃ for 6min 40s;

steps (2) to (4) are carried out for 30 cycles in total

(5) Extending at 72℃for 5min.

The mutants on the transformation plate were inoculated into LB medium containing 50. Mu.g/ml kanamycin, shake cultured at 37℃for 12 hours, then inoculated into 500ml Erlenmeyer flasks containing 100ml LB medium (containing 50. Mu.g/ml kanamycin) at an inoculum size of 1% (v/v), placed in shaking culture at 37℃with a shaker at 220rpm, and when the OD600 of the culture solution reached 0.6, IPTG was added as an inducer at a final concentration of 0.2mmol/L, and induced at 16℃for 24 hours. The culture broth was centrifuged at 7500rpm for 10min and the cells were collected. Cells obtained in 100ml of the culture broth were suspended in 15ml of sodium phosphate buffer (100 mM, pH 7.4), sonicated in an ice-water bath as follows, centrifuged at 7500rpm at 4℃for 60 minutes, and the supernatant crude enzyme solution was collected. Purifying the collected crude enzyme liquid by a nickel column, ultrafiltering and concentrating, and measuring the activity of the obtained pure enzyme liquid by a spectrophotometer.

M1 mutant base was found by the alive-detection screening described in example 2Based on the above, the activity of mutants such as threonine 36 substituted by alanine (T36A) on 5-carbonyl hexanoic acid is improved. Thus, the mutant TtherAmDH was finally determined by rational design _M2 (M1-T36A)。

EXAMPLE 3 random mutation screening Activity-improved TtherAmDH mutant

The error-prone PCR technique is adopted to randomly mutate TtherAmDH of the amino acid sequence shown as SEQ ID No. 2.

The primers used were:

the upstream primer is shown as SEQ ID No. 11:

5’-CCGGAATTCATGGAAAATATAAAAGTCGTAGTTTGGGG-3', the underlined sequence is the cleavage site for the restriction enzyme EcoR I;

the downstream primer is shown as SEQ ID No. 12:

5’-CCCAAGCTTTTAACGGCGACGAATCATAT-3', the underlined sequence is the restriction site for the restriction enzyme HindIII.

With pET28a-TtherAmDH _M2 Error-prone PCR was performed using rTaq DNA polymerase as template to construct a random mutant pool. The PCR system was (50. Mu.L):

pET28a-TtherAmDH _M2 100ng of plasmid, 2. Mu.l of each of the upstream and downstream primers (10. Mu.M), 0.5. Mu.l of rTaq DNA polymerase, 10 XPCR buffer (Mg ²⁺ Plus) 5. Mu.l, dNTP mix (2.0 mM each) 4. Mu.l, mnCl at a final concentration of 150. Mu. Mol/L ₂ Sterilized distilled water was added to make up to 50. Mu.l.

PCR reaction procedure:

(1) Pre-denaturation at 95℃for 3min;

(2) Denaturation at 95℃for 30s;

(3) Annealing at 54 ℃ for 30s;

(4) Extending at 72℃for 1min 10s;

steps (2) - (4) are carried out for 30 cycles altogether;

(5) Final extension at 72℃for 10min;

the product was stored at 4 ℃.

The PCR product is purified and recovered by agarose gel electrophoresis analysis and verification, and the recovered target gene and empty plasmid pET28a are respectively subjected to double enzyme digestion for 20min at 37 ℃ by using restriction enzymes EcoR I and Hind III. And (3) performing agarose gel electrophoresis analysis and verification on the double-enzyme-digested product, then performing gel-digested purification and recovery, and connecting the obtained linearized pET28a plasmid with the purified target gene fragment at 16 ℃ by using T4 DNA ligase for overnight. The ligation product was transformed into E.coli BL21 (DE 3) competent cells, and uniformly spread on LB agar plates containing 100. Mu.g/ml kanamycin, and placed in a 37℃incubator for stationary culture for about 10 hours.

Mutants on the transformation plate were picked with toothpicks into 96-well deep well plates and incubated overnight at 37℃in a 220rpm shaker. And (3) sucking 10 mu L of bacterial liquid from the holes of the primary plate, inoculating the bacterial liquid into the corresponding holes of the secondary plate, culturing for 2-3 h in a shaking table at 37 ℃ and 220rpm, and then adding IPTG with the final concentration of 0.2mM, and culturing for 24h at 16 ℃. Then, centrifugation was performed at 3500rpm for 10min at 4℃and the upper medium was removed, 300. Mu.L of lysozyme solution (0.3 g of lysozyme and 3mg of DNase were dissolved in 300mL of ammonium formate) was added to each well, and the mixture was stirred and mixed well, and then, the mixture was subjected to shaking and treatment on a shaker at 37℃for 2.5 hours. Centrifugation at 3500rpm at 4℃for 20min, 100. Mu.L of the cell disruption supernatant was transferred to a 96-well ELISA plate to which 100. Mu.L of the reaction solution was added per well (100. Mu.L of the reaction solution consisted of 3M ammonium formate buffer (pH 6.5) and 16mM 5-carbonyl hexanoic acid and 0.4mM NADH). The decrease in absorbance at 340nm was read on a microplate reader. The expressed protein is subjected to high-flux activity screening in a 96-well plate, mutants with higher activity are subjected to purification characterization, and the corresponding genes are sequenced.

Through the high throughput screening of the microplate reader described in example 3, it was found that the activity of mutants such as glycine (D37G) for aspartic acid at position 37, alanine (T59A) for threonine at position 59, glycine (S70G) for serine at position 70, glycine (E119G) for glutamic acid at position 119, alanine (V191A) for valine at position 191, and cysteine (Y282C) for 5-carbonyl hexanoic acid was improved.

Specific mutation sites and activities are shown in table 2:

table 2: specific Activity of TtherAmDH mutant on 5-carbonyl hexanoic acid

/>

In Table 2, the second column of mutant amino acid positions are described as follows: "/" means simultaneous mutation, M1 means mutant TtherAmDH _M1 The corresponding mutant amino acid site, namely the mutant amino acid site denoted by M1 is S41K/E189G/M251K, M1/T36A refers to that T36A mutation is also carried out on the basis of M1 mutation, namely S41K/E189G/M251K/T36A, and the corresponding mutant is TtherAmDH _M2 ；

Similarly, M2 refers to the mutant TtherAmDH _M2 The corresponding mutant amino acid site, namely M2 refers to the mutant amino acid site S41K/E189G/M251K/T36A, M2/T59A refers to the mutant of T59A based on the mutation of M2, namely S41K/E189G/M251K/T36A/T59A, and the corresponding mutant is TtherAmDH _M3 The method comprises the steps of carrying out a first treatment on the surface of the The others are explained in the same way;

m3 refers to mutant TtherAmDH _M3 The corresponding mutant amino acid site, namely M3 refers to a mutant amino acid site S41K/E189G/M251K/T36A/T59A, M3/D37G refers to D37G mutation based on M3 mutation, namely S41K/E189G/M251K/T36A/T59A/D37G, and the corresponding mutant is TtherAmDH _M4 ；

M4 refers to mutant TtherAmDH _M4 The corresponding mutant amino acid site, namely M4 refers to the mutant amino acid site S41K/E189G/M251K/T36A/T59A/D37G, M4/Y282C refers to the mutation of Y282C, namely S41K/E189G/M251K/T36A/T59A/D37G/Y282C, based on the mutation of M4, and the corresponding mutant is TtherAmDH _M5 。

Through the screens of examples 1, 2, 3, mutants having significantly improved activity on 5-carbonyl hexanoic acid were obtained, and the sequences of these mutants and the activities of these mutants on 5-carbonyl hexanoic acid are shown in Table 3. In Table 3, there is provided an amine dehydrogenase TtherAmDH of the specific sequence disclosed in the present invention having the relevant activity _M5 List of mutants in the following list, the sequence numbers refer to the series following Table 1, respectivelyThe sequence, a plus sign "+" indicates that the specific activity of the mutant protein is improved by 0.1-2 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the two plus signs "++" indicate that the specific activity of the mutant protein is improved by 2-6 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2; the three plus signs "++ + +" indicate that the specific activity of the mutant protein is improved by 6-10 times compared with the protein consisting of the amino acid sequence shown in SEQ ID No. 2.

Table 3: aminodehydrogenase TtherAmDH mutant sequences and corresponding lists of activity improvements

In Table 3, specific mutations of the mutant marks M1, M1-2, M1-3, M1-4, M1-5, M1-6, M2, M3-1, M3-2, M3-3, M3-4, M3-5, M3-6, M4, M5 corresponding to SEQ ID No.2 compared with the amino acid sequence shown in SEQ ID No.2 are further illustrated as follows:

EXAMPLE 4 expression of recombinant E.coli BL21 (DE 3)/pET 28a-TtherAmDH and enzymatic method

The mutant TtherAmDH obtained in example 2 was used _M5 E.coli BL21 (DE 3)/pET 28a-TtherAmDH _M5 Inoculated into LB medium containing 50. Mu.g/ml kanamycin, shake cultured at 37℃for 12 hours, then inoculated into 500ml Erlenmeyer flask containing 100ml LB medium (containing 50. Mu.g/ml kanamycin) at an inoculum size of 1% (v/v), placed at 37℃and shake cultured at 220rpm, when OD600 of the culture solution reached 0.6, IPTG with a final concentration of 0.2mmol/L was added as an inducer, and induced at 16℃for 24 hours. The culture broth was centrifuged at 7500rpm for 10min and the cells were collected. Cells obtained in 100ml of the culture were suspended in 15ml of sodium phosphate buffer (100 mM, pH 7.4) and subjected to the following ultrasonication in an ice-water bath: the crude enzyme solution was collected by centrifugation at 7500rpm at 4℃for 60 minutes at a power of 350W for 4s with a break time of 10min at a batch time of 6 s. Freeze-drying the obtained crude enzyme solution to obtain freeze-dried enzyme powder; purifying the collected crude enzyme liquid by a nickel column, and performing ultrafiltration and concentration to obtain pure enzyme liquid. Adding the obtained pure enzyme solution into 40% glycerol with the volume of 1:1, and quick-freezing by liquid nitrogen Stored in a refrigerator at-80 ℃.

EXAMPLE 5 recombinant TtherAmDH _M5 Catalytic asymmetric reduction of 4-carbonyl capric acid and 5-carbonyl caproic acid

The reaction was performed in a 2mL centrifuge tube, and 4mM 5-carbonyl hexanoic acid, 3mM formic acid, 0.2mM NAD were added to 1mL ammonium formate buffer (3M, pH 6.5) ⁺ 0.5U of recombinant TtherAmDH obtained in example 3 _M5 Pure enzyme solution, 1mg of formate dehydrogenase. The reaction was carried out at 1000rpm and 40℃on a shaker. The reaction was terminated with 2M sulfuric acid solution for 24 hours, extracted with an equal volume of ethyl acetate, dried over night with anhydrous sodium sulfate, and the substrate conversion and ee value of the reduced product were determined. The results are shown in Table 2.

Enantiomeric excess of the body analysis conditions (GC column CP-Chirail-DEX CB): the initial column temperature is 110 ℃,10 ℃/min is raised to 160 ℃, the temperature is kept for 5min,10 ℃/min is raised to 180 ℃, and the temperature is kept for 10min.

Table 4: ttherAmDH _M5 Results of asymmetric reduction reactions catalyzing different potential chiral substrates

The previous description of the embodiments is provided to facilitate a person of ordinary skill in the art in order to make and use the present invention. It will be apparent to those skilled in the art that various modifications can be readily made to these embodiments and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the above-described embodiments, and those skilled in the art, based on the present disclosure, should make improvements and modifications without departing from the scope of the present invention.

The sequences referred to in this application are as follows:

SEQ ID No.1：

nucleotide sequence of parent amine dehydrogenase TtherAmDH

SEQ ID No.2：

Amino acid sequence of parent TtherAmDH

MENIKVVVWG AGAMGSGIAK MILSKKGMEI VGAIDTDPNK SGKDLNEILG TNSKPVYITS 60

EPQDIIKKGS ADIAVIVTAS YTEKVFPLIK LAVENGINVI TCAEEMAYPS AQHLELAKEI 120

DRLARENGVS VLGTGINPGF VLDYLIIALT GVCVDVDSIK AARINDLSPF GPAVMEEQGV 180

GLTPEEFEEG VKNGTVASHI GFPESISMIC DALGWKLSGI EQTRESIVSK TYRETPYARV 240

EPGYVAGCRQ MGYGKVDGEV KIELEHPTQI LPQKEGVETG DYIEIKGTPN IKLSIKPGIP 300

GGLGTIALCV NMIPHVINAE PGLVTMLDLP VPRAIMGDAR DMIRRR 346

SEQ ID No.3：

Primer S41-FP sequence

accgatccaa acaaannkgg taaagatttg aat 33

SEQ ID No.4：

Primer S41-RP sequence

attcaaatct ttaccmnntt tgtttggatc ggt 33

SEQ ID No.5：

Primer E189-FP sequence

ccagaggaat ttgaannkgg tgttaagaac ggc 33

SEQ ID No.6：

Primer E189-RP sequence

gccgttctta acaccmnntt caaattcctc tgg 33

SEQ ID No.7：

Primer M251-FP sequence

gcaggttgcc gtcagnnkgg ttacggcaaa gtt 33

SEQ ID No.8：

Primer M251-RP sequence

aactttgccg taaccmnnct gacggcaacc tgc 33

SEQ ID No.9：

Primer T36A-FP sequence

gtgggtgcca tcgacgcaga tccaaacaaa aaa 33

SEQ ID No.10：

Primer T36A-RP sequence

ttttttgttt ggatctgcgt cgatggcacc cac 33

SEQ ID No.11：

Upstream primer sequences

ccggaattca tggaaaatat aaaagtcgta gtttgggg 38

SEQ ID No.12：

Downstream primer sequences

cccaagcttt taacggcgac gaatcatat 29

Claims

1. An amine dehydrogenase mutant, wherein the amine dehydrogenase mutant is a derivative protein of a novel amino acid sequence formed by selecting one or more of the following combinations of mutations, and wherein the derivative protein has catalytic properties and enantioselectivity over a protein consisting of the amino acid sequence set forth in SEQ ID No. 2:

2. The amine dehydrogenase mutant of claim 1, wherein the amino acid sequence of the amine dehydrogenase mutant is selected from one of the following:

3. An isolated nucleic acid encoding the amine dehydrogenase mutant of claim 1 or 2.

4. A recombinant expression vector comprising the isolated nucleic acid of claim 3.

5. A recombinant expression transformant comprising the recombinant expression vector according to claim 4.

6. An amine dehydrogenase mutant catalyst, characterized by being selected from any one of the following forms:

(1) Culturing the recombinant expression transformant according to claim 5, and isolating a transformant cell containing the amine dehydrogenase mutant according to claim 1 or 2;

(2) Culturing the recombinant expression transformant according to claim 5, isolating the transformant cells containing the amine dehydrogenase mutant according to claim 1 or 2, disrupting the transformant cells containing the amine dehydrogenase mutant, and obtaining a cell disruption solution;

(3) Culturing the recombinant expression transformant according to claim 5, isolating the transformant cells containing the amine dehydrogenase mutant according to claim 1 or 2, disrupting the transformant cells containing the amine dehydrogenase mutant to obtain a cell disruption solution, and purifying and concentrating the cell disruption solution to obtain a pure enzyme solution.

7. Use of an amine dehydrogenase mutant according to claim 1 or 2 or an amine dehydrogenase mutant catalyst according to claim 6 for the catalysis of medium-long chain keto acids for the preparation of optically active γ -/δ -lactams, characterized in that the medium-long chain carbonyl acid has the following structure:

8. the use according to claim 7, characterized in that in formate dehydrogenase, formate and NAD ⁺ In the presence of an amine dehydrogenase mutant according to claim 1 or 2 or an amine dehydrogenase mutant catalyst according to claim 6, catalyzing asymmetric reduction of medium-long-chain keto acids to produce optically active gamma-/delta-lactams.

9. The use according to claim 8, characterized in that after completion of the asymmetric reduction reaction, the medium-long chain gamma-/delta-hydroxy acid is cyclized by chemical means to obtain the corresponding optically active gamma-or delta-lactam.

10. The use according to claim 9, wherein the concentration of the substrate in the reaction solution is 4 to 8mmol/L, the amount of carbonyl reductase in the amine dehydrogenase catalyst is 1U/L, the concentration of formic acid in the reaction solution is 3mmol/L, and additionally added NADP ⁺ The dosage of (C) is 0.2mmol/L;

the pH of the reaction system was 6.5 and the temperature was 40 ℃.