CN117562023A

CN117562023A - Application of spontaneous systemic lupus erythematosus animal model as spontaneous lupus encephalopathy animal model

Info

Publication number: CN117562023A
Application number: CN202311430045.8A
Authority: CN
Inventors: 陆前进; 田婧汝; 辛月; 王秀娇; 王依青; 史丽晴
Original assignee: Institute of Dermatology and Skin Disease Hospital of CAMS
Current assignee: Institute of Dermatology and Skin Disease Hospital of CAMS
Priority date: 2023-10-31
Filing date: 2023-10-31
Publication date: 2024-02-20

Abstract

The invention discloses an application of a spontaneous systemic lupus erythematosus animal model as a spontaneous lupus encephalopathy animal model, wherein the spontaneous systemic lupus erythematosus animal model enables mice to spontaneously generate systemic lupus erythematosus and lupus encephalopathy phenotypes, including sustained skin injury, sustained proteinuria, anxiety state, reduced learning cognitive function, increased autoantibody titer in serum and brain tissues, excessive activation of a brain hippocampus CA3 region and dentate microglial cells, increased expression of inflammatory factors such as IL-1 beta in brain tissues and the like by knocking out PPARgamma (Peroxisome proliferator-activated receptor gamma) in keratinocytes, so that the spontaneous systemic lupus erythematosus animal model simulates clinical symptoms of lupus encephalopathy and provides an important tool for related research of lupus encephalopathy.

Description

Application of spontaneous systemic lupus erythematosus animal model as spontaneous lupus encephalopathy animal model

Technical Field

The invention belongs to the technical field of disease animal model construction methods, and particularly relates to application of a spontaneous systemic lupus erythematosus animal model as a spontaneous lupus encephalopathy animal model.

Background

Systemic lupus erythematosus (Systemic lupus erythematosus, SLE) is an autoimmune disease, which is commonly seen in young women of childbearing age and has profound effects on the life of the patient. SLE patients exhibit multiple system lesions such as rashes, arthritis, nephritis, hematological abnormalities, and the like, while about 30% of patients exhibit symptoms of central nervous system involvement, known as lupus encephalopathy or neuropsychiatric lupus (Neuropsychiatric lupus, NPSLE). The central nervous system manifestations of lupus erythematosus are diverse and greatly affect the prognosis of patients. Lupus encephalopathy patients often present with nonspecific symptoms such as headache and cognitive dysfunction, but organic lesions such as cerebrovascular events and demyelinating lesions may also occur. The pathogenesis of lupus encephalopathy is currently unknown, and autoimmune overactivation is considered as a major cause of its pathogenesis, including brain-reactive autoantibodies, cytokines, complement-mediated inflammation, and the like. Other intracerebral factors, such as resident microglial cells, blood brain barrier and neuro-vascular interface damage, are also important contributors to lupus encephalopathy. However, so far, there is no unified theory to explain the pathogenesis of lupus encephalopathy. The development of an animal model which can simulate clinical symptoms and has cost advantages is of great significance to the research of the pathogenesis of lupus encephalopathy and the safe and effective novel therapy.

The current lupus encephalopathy animal model mainly comprises an F1 generation NZBWF1 mouse hybridized by New Zealand Black (NZB) and New Zealand White (NZW) mice and an MRL/lpr mouse, but the price of the mice is higher, the mice are ill late (usually ill at 16 weeks), the mice are easy to be influenced by environmental factors, the heterogeneity of the mice is large, and the gene phenotype and pathogenesis of the mice are greatly different from those of lupus encephalopathy patients. The artificially induced mouse model is relatively low in price, but lacks typical neuropsychiatric changes, and has no genetic background. Therefore, spontaneous lupus encephalopathy mouse models based on genetic background of patients are urgently needed to promote the research in the field and deepen the understanding of diseases.

Keratinocytes, immune cells and immune molecules together form the local immune microenvironment of the skin, maintaining tissue homeostasis. Although no studies have demonstrated a direct link between skin dysfunction and the onset of SLE or NPSLE, SLE patients often have skin involvement and an active inflammatory response in the patient's keratinocytes, suggesting that dysregulation of skin tissue homeostasis may be associated with systemic autoimmune responses. Because of the correlation between the symptoms of NPSLE and the severity of SLE, skin tissue dysfunction may regulate the occurrence and development of lupus encephalopathy.

Pparγ (peroxisome proliferator-activated receptor γ) is a key molecule of PPAR pathway, and can regulate adipocyte differentiation and function, regulate maturation and function of immune cells, affect cell proliferation of tissues and organs, and is also involved in tumor generation. There is no report of constructing an animal model of spontaneous lupus encephalopathy using keratinocyte-conditioned pparγ knockout mice.

Disclosure of Invention

The invention aims to: aiming at the defects of the prior art, the invention provides a novel spontaneous lupus encephalopathy animal model for researching and developing pathogenesis, pathological features and treatment methods of lupus encephalopathy.

In previous studies, the applicant spontaneously developed systemic lupus erythematosus phenotypes, including local skin depilatory, sustained skin loss, sustained proteinuria, serum autoantibodies, in mice by knocking out pparγ in keratinocytes; histological examination showed systemic lupus erythematosus-like changes such as dermal immune cell infiltration, basal lamina with IgG deposition, glomerular IgG deposition, etc., simulating clinical symptoms of systemic lupus erythematosus, see specifically CN116548385a. The applicant has unexpectedly found that this model also has some characterization of lupus encephalopathy, and can be used for construction of an animal model of spontaneous lupus encephalopathy.

Specifically, the invention discloses application of a spontaneous systemic lupus erythematosus animal model as a spontaneous lupus encephalopathy animal model, wherein the spontaneous systemic lupus erythematosus animal model is constructed by the following steps: (1) Constructing a keratinocyte-conditioned ppary knockout mouse, including a ppary heterozygous knockout and a ppary homozygous knockout C57BL/6 mouse, wherein the ppary heterozygous knockout mouse has a genotype of ppary flox/flox +/-Krt5-creert2+/-; the genotype of the PPARgamma homozygous knockout is PPARgamma flox/flox-/-Krt5-CreERT2+/-;

(2) Knocking out pparγ genes in keratinocytes using a gene knockout activator to mediate disease phenotype occurrence;

wherein the gene knockout activator is tamoxifen or 4-hydroxy tamoxifen, and when the tamoxifen is used as the gene knockout activator, continuously injecting tamoxifen solution into the abdominal cavity of a diagonal cell conditional PPARgamma knockout mouse for 1-7 days once a day; when 4-hydroxy tamoxifen is used as a gene knockout activator, 4-hydroxy tamoxifen solution is continuously smeared on the skin on the ventral side and the dorsal side of the skin double ears of a diagonally forming cell conditional PPARgamma knockout mouse body part without hair or after shaving for 1-7 days once a day; the tamoxifen solution is prepared according to the proportion of 100mg tamoxifen, 0.5ml ethanol and 9.5ml corn oil; the 4-hydroxy tamoxifen solution is prepared according to the proportion of 50mg of 4-hydroxy tamoxifen, 1ml of DMSO and 9ml of corn oil; the dose of the tamoxifen solution injected into the mice is 75mg/kg each time, and the dose of the 4-hydroxy tamoxifen solution externally smeared to the mice is 10-80 mu L each time; mice developed disease phenotypes 7 days after initial intraperitoneal injection of tamoxifen or 7 days after topical application of 4-hydroxy tamoxifen.

Specifically, the keratinocyte conditional pparγ knockout mice were constructed by the following method:

crossing PPARγflox/flox-/-and Krt5-CreERT2 +/-mice to obtain a filial generation, crossing heterozygote mice with the genotype PPARγflox/flox +/-Krt5-CreERT2 +/-with each other to obtain and retain C57BL/6 mice with the genotypes PPARγflox/flox-/-Krt5-CreERT2 +/-and PPARγflox/flox +/-Krt5-CreERT2 +/-.

The invention further provides application of the spontaneous lupus encephalopathy animal model constructed by the construction method in research of lupus encephalopathy mechanism.

The invention also provides application of the spontaneous lupus encephalopathy animal model constructed by the construction method in screening medicaments for targeted treatment of lupus encephalopathy.

The beneficial effects are that: the invention constructs a spontaneous lupus encephalopathy animal model by knocking out PPARgamma in mouse keratinocytes, does not need artificial induction, can conditionally present systemic autoimmune inflammation and neuropsychiatric symptoms, comprises continuous skin loss, continuous proteinuria, anxiety state, reduced learning and cognition functions, increased autoantibody titer in serum and brain tissues, excessive activation of a brain hippocampus CA3 region and dentate microglial cells, simulates clinical symptoms of lupus encephalopathy, provides an important tool for related research of lupus encephalopathy, and provides an important tool for research and drug development of pathogenesis of lupus encephalopathy. Compared with other lupus encephalopathy models, the model has genetic background instead of drug induction, and is rapid, efficient and stable in onset. All mice with the model built developed a certain degree of phenotype 1-2 weeks after induction of PPARgamma knockdown in keratinocytes, with little intra-group heterogeneity and strong reproducibility. In addition, PPARγflox/flox +/-Krt5-CreERT2 +/-and PPARγflox/flox-/-Krt5-CreERT2 +/-mice can be obtained continuously through breeding, and are economical and convenient.

Drawings

The foregoing and/or other advantages of the invention will become more apparent from the following detailed description of the invention when taken in conjunction with the accompanying drawings and detailed description.

FIG. 1 is a schematic representation of the phenotype of spontaneous lupus encephalopathy induced in mice 15 days after PPARgamma knockout using localized keratinocytes with binaural 4-hydroxy tamoxifen as a gene knockout activator, wherein FIG. 1 shows the genotyping of keratinocyte PPARgamma conditional knockout mice;

FIG. 2 is a photograph of a mouse 15 days after PPARgamma knockdown of a localized keratinocyte, showing depilation and inflammatory skin lesions;

FIG. 3 shows peripheral blood antinuclear antibodies (ANA) and anti-double stranded DNA (dsDNA) antibody levels following PPARgamma knockdown in local mouse keratinocytes;

FIG. 4 shows mouse urine protein levels following PPARgamma knockout in local mouse keratinocytes;

FIG. 5 shows the results of a 14 day field test of mice after PPARgamma knockdown of topical keratinocytes;

FIG. 6 shows the results of a 14 day high-altitude cross experiment in mice after PPARgamma knockdown of local keratinocytes;

FIG. 7 shows the results of a mouse Y maze experiment 14 days after PPARgamma knockout of local keratinocytes;

FIG. 8 shows the results of immunofluorescent staining of microglial cells in the brain of mice 15 days after PPARgamma knockdown of local keratinocytes;

FIG. 9 shows the results of RT-qPCR experiments on mouse brain IL-1 beta and CCL-22 15 days after PPARgamma knockout of local keratinocytes.

Detailed Description

The present invention will be further described with reference to the following examples, but it should not be construed that the scope of the present invention is limited to the examples. Various substitutions and alterations are made according to the general technical knowledge and the conventional methods in the field without departing from the technical idea of the present invention, and all such substitutions and alterations are included in the protection scope of the present invention.

Example 1 4-hydroxy tamoxifen binaural application activated local keratinocyte pparγ knockout induced lupus encephalopathy model.

1. Experimental materials

1. Experimental drugs and reagents: DMSO (Sigma-Aldrich), tamoxifen (Sigma-Aldrich), corn oil (beyotide), rat tail genotype rapid identification kit (beyotide), proteinuria test paper (ulite), antinuclear and anti-double-stranded DNA antibody ELISA kit (Cusaibio), DAB horseradish peroxidase chromogenic kit (beyotide), 4% paraformaldehyde (Biosharp), OCT embedding agent (Sakura), anti IBA antibody (Biolegend), RNA extraction kit (novembrane), reverse transcription kit (novembrane), high specificity dye method quantitative PCR detection kit (novembrane).

1.2 laboratory animals

PPARγflox/flox-/-and Krt 5-Creet 2 +/-mice used in this experiment were about 6-12 weeks old and had a body weight of 20-30g, as supplied by Shanghai, nannon model biotechnology Co., ltd. Krt5-CreERT2 mice are able to express the CreERT2 fusion protein targeted in keratinocytes by means of the endogenous promoter/enhancer element of the Krt5 locus. The CreERT2 fusion protein consists of a ligand binding region mutant (ERT) of the estrogen receptor (estrogen receptor, ER) and a Cre recombinase protein. In the absence of tamoxifen induction, the Creet 2 protein is in an inactive state within the cytoplasm; after tamoxifen induction, the metabolite 4-hydroxy tamoxifen of tamoxifen is combined with ERT to make CreERT2 enter nucleus to generate the recombinant enzyme activity of Cre. PPARγflox/flox-/-mice, i.e. PPARγ conditional knockout mice, have a loxP site inserted at both ends of the specific exon of the PPARγ gene, which can be cleaved by the active Cre recombinase. The PPARgamma gene in Krt 5-expressing cells can be knocked out by tamoxifen-induced Cre-mediated gene recombination using Krt5-CreERT2 +/-mice mated with mice containing loxP flanking sequences to generate offspring mice of genotypes Krt5-CreERT2+/-PPARγflox/flox +/-and Krt5-CreERT2+/-PPARγflox-/-. The constructed Krt5-CreERT2+/-PPARγflox/flox +/-and Krt5-CreERT2+/-PPARγflox/flox-/-mice can precisely directionally knock out PPARγgene in keratinocytes. Compared with a common conditional knockout mouse, the gene knockout time can be accurately regulated, the phenotype of the mouse before and after gene knockout can be compared on the same individual, the disease occurrence process can be simulated to the greatest extent, and the model mouse is an ideal NPSLE disease model mouse.

C57BL/6 mice, about 6-12 weeks of week old, weighing 20-30g, supplied by Jiangsu Jiuyaokang Co. Crossing to generate a sub-generation, reserving PPARγflox/flox +/-Krt5-CreERT2 +/-mice, and continuously breeding to obtain PPARγflox/flox-/-Krt5-CreERT2 +/-mice. The mice used in the experiments were PPARγflox/flox-/-Krt5-CreERT2 +/-and PPARγflox/flox +/-Krt5-CreERT2 +/-mice. Feeding conditions: the room temperature is 18-20 ℃, the humidity is 50-60%, the brightness is alternate (12 hours), the luminosity is moderate, and the ventilation is clean. All experiments were approved and conducted as directed by the ethical committee of the dermatology hospital of the national academy of medical science (the dermatology institute of the national academy of medical science).

2. Experimental method

2.1 mouse keratinocyte knockout of PPARgamma

PPARγflox/flox+/-Krt5-CreERT 2+/-PPARγflox/flox-/-Krt5-CreERT 2+/-mice were grouped as required. Control, pparγ knockout (model). 50mg of 4-hydroxy tamoxifen was mixed in 1ml of DMSO, 9ml of corn oil was added, the suspension was thoroughly mixed using a vortexer, and sonicated in an ultrasonic bath at 37℃for 20 minutes to prepare a 4-hydroxy tamoxifen solution (5 mg/ml) ready for use. Binaural application of corn oil with 10% dmso in control; the PPARgamma knockout group (model group) was applied in both ears with 50ul of a solution of 5mg/ml 4-hydroxy tamoxifen. Two groups of mice were continuously double-applied with the corresponding solutions for 5 days.

2.2PCR identification of keratinocyte PPARgamma conditional knockout mouse genotype

Mouse tail genomic DNA was extracted according to the instructions using a rapid mouse tail genotype identification kit (beyotide). Fresh mouse tail was taken: scissors and forceps were rinsed with 70% ethanol prior to the experiment. Cutting tail tip of a mouse with the length of 0.2 cm to 1cm to prepare template DNA, and preparing a PCR reaction system:

TABLE 1PCR reaction System

Reagent(s)	Final concentration	Volume of
			Double distilled water or Milli-Q water	-	7.4ul
Stencil (digestion products)	2-20ng/ul	1ul
			Primer mix (10 uM each)	0.8uM	1.6ul
Easy-Load ^TM PCR Master Mix(Green,2X)	1X	10ul
			Total volume of	-	20ul

TABLE 2PCR reaction parameters

After the completion of the PCR reaction, agarose gel electrophoresis was performed. The genotype of the mice was detected. The primer sequences were as follows:

PPARγflox/flox primer 1:5'-CTTCCCCTTCCCCAAAATGAGTC-3';

PPARγflox/flox primer 2:5'-TCTGTGGCTGGACTACAGGA-3';

krt5-e (2A-CreERT 2) primer 1:5'-GTGGCTTACATTCTGCAACATTTT-3';

krt5-e (2A-CreERT 2) primer 2:5'-GGCCCACGCTTCACCAG-3';

krt5-e (2A-CreERT 2) primer 3:5'-GGATCCGCCGCATAACCAGT-3'.

Wherein for pparγflox: the size of the variant (Mutant) is 572bp, the size of the Heterozygote (heteozygate) is 572bp, and the Wild type (Wild type) is 445bp;

for Krt5-Cre: the variant (Mutant) was 610bp in size, the Heterozygote (Heterozygate) was 610bp in size, and the Wild-type (Wild type) was 453bp.

2.3 monitoring of body weight, skin lesions, urine proteins and autoantibodies in mice

Body weight was monitored, mice were observed weekly for skin loss, and camera photographs were taken for retention. The mice were periodically cleaned of midrange urine and urine protein was detected using a test paper for detection of ulide proteinuria. The content of peripheral blood serum antinuclear antibodies and anti-double-stranded DNA antibodies was detected using ELISA kit (Cusabio).

2.4 brain tissue autoantibody titre detection

On day 15, mice were sacrificed after anesthesia for cervical dislocation. The two groups of mouse brain tissues were carefully removed with forceps and ophthalmic scissors, the tissues were blotted with surface moisture and blood, weighed and placed in a 2ml grind tube with 200ul of chilled PBS containing protease inhibitors per 100mg brain tissue. Supernatants were collected by centrifugation after milling using a tissue mill and anti-nuclear antibodies and anti-dsdna antibody titers in the supernatants were detected using ELISA kit (Cusabio).

2.5 immunofluorescent staining

On day 15, mice were anesthetized and then perfused with physiological saline, 4% formaldehyde solution, in that order. The brain tissues of the two groups of mice were carefully removed with forceps and ophthalmic scissors and fixed by immersing them in 4% formaldehyde solution overnight. And (5) after fixation, dehydrating, waxing and embedding. After tissue slicing, spreading, baking, dewaxing, antigen repairing and sealing are carried out. Immunofluorescence: the tissue samples were immersed in anti-mouse IBA antibody (Biolegend) and incubated overnight at 4 ℃, nuclei were stained with DAPI working solution for 10 minutes after PBST washing, the plates were sealed after PBST washing, and the numbers and morphology of microglial cells in brain tissue of mice were observed by fluorescence microscopy imaging.

2.6RT-qPCR

On day 15, mice were sacrificed after anesthesia for cervical dislocation. The two groups of mouse brain tissues were carefully picked up with forceps and ophthalmic scissors, the tissues were blotted to remove surface moisture and blood, weighed and placed in a 2ml grinding tube, 1ml of RNA extract (Noruzan) was added to each 50mg of brain tissue, and RNA was extracted by the procedure of the RNA extraction kit (Noruzan) after grinding with a tissue grinder. cDNA synthesis was performed according to the instructions of the reverse transcription kit of Norpran, the reverse transcription reaction system is shown in Table 3, and the reaction conditions are shown in Table 4. The qPCR reaction is completed according to the instruction book of the quantitative PCR detection kit of the high-specificity dye method of the Norflua, the reaction system is shown in Table 5, and the reaction conditions are shown in Table 6. The primer sequences of IL-1 beta and CCL-22 are as follows: TGGACCTTCCAGGATGAGGACA;

IL1β-R：GTTCATCTCGGAGCCTGTAGTG；

CCL22-F：GACACCTGACGAGGACACA；

CCL22-R：GCAGAGGGTGACGGATGTAG；

TABLE 3 reverse transcription reaction system

RNase-free ddH ₂ O	to 20μl
		5×qRT SuperMix	4μl
Template RNA	1μg

TABLE 4 reverse transcription reaction conditions

50℃	15min
		85℃	2min

TABLE 5 qPCR reaction System

2×qPCR SYBR Green Master Mix	10μl
		Primer 1(10μM)	0.4μl
Primer 2(10μM)	0.4μl
		Template cDNA	2μl
ddH ₂ O	7.2μl

TABLE 6 qPCR reaction conditions

2.7 open field experiments

Before the experiment starts, 75% ethanol is wiped on the bottom of the experiment box to remove the excrement, urine and the like left by the animal tested in the previous experiment. The mice are gently taken out from the rearing cage, are rapidly placed in the central area of the experimental box, immediately leave, open animal behavioural analysis software, automatically record the moving track of the animals in the box, and the experimental time is set to be 5 minutes; after the experiment is finished, the experimental animals are placed in other raising cages. The smell was removed by alcohol spraying apparatus and dried by paper towel, and then the next mouse experiment was performed.

2.8 high-altitude cross experiment

Before the experiment starts, 75% ethanol is wiped on the bottom of the experiment box to remove the excrement, urine and the like left by the animal tested in the previous experiment. The animal is gently placed in the central area of the instrument uterus, the animal faces the open arm, and then the experimenter rapidly and quietly leaves; opening animal behavior analysis software, tracking the track motion of animals in an overhead plus maze instrument, and automatically calculating indexes, wherein the experimental duration is 5min; after the experiment is finished, the experimental animals are taken out and put into a raising cage, the marked information of the animals is finished through the experiment, and meanwhile, the maze is cleaned by alcohol and paper towels.

2.9Y maze New arm exploration experiment

The experiment was performed in an acrylic box with three arms. Before the experiment starts, 75% ethanol is wiped on the bottom of the experiment box to remove the excrement, urine and the like left by the animal tested in the previous experiment. During the learning phase, one arm was closed and each animal was placed in the maze separately, allowing the animal to explore the other two arms freely for 10 minutes. The test phase was entered after 2 hours, at which time the previously closed arm was opened and defined as a "new arm". Each mouse was placed in the maze and the number of times the mouse entered the new arm was tracked using animal behavioral analysis software.

3. Experimental results

FIG. 1 is a graph showing genotyping of keratinocyte PPARgamma conditional knockout mice. The mice of interest are either PPARγhomozygous knockouts (genotype PPARγflox/flox-/-Krt5-CreERT2+/-, e.g., no. 58) or PPARγheterozygous knockouts (genotype PPARγflox/flox+/-Krt5-CreERT2+/-, e.g., no. 51, 61).

Fig. 2 is a photograph of a day 15 mouse with keratinocyte pparγ knockdown, showing depilation and inflammatory skin lesions, and no skin lesions in the control group. Indicating that mice with reduced levels of PPARgamma protein in keratinocytes spontaneously develop inflammatory lesions.

FIG. 3 shows the anti-nuclear and anti-dsDNA antibody levels in peripheral blood 15 days after PPARgamma knockout in mouse keratinocytes. Peripheral blood antinuclear and anti-dsdna antibody titers were significantly increased in pparγ knockout mice at day 12 and day 15 of molding compared to control. The above results indicate that a decrease in pparγ in keratinocytes results in an increase in autoantibodies in mice.

FIG. 4 shows urine protein levels in mice within 15 days after PPARgamma knockout of keratinocytes. Compared with the control group, the PPARgamma knockout group mice have obviously raised urine proteins on the 7 th, 12 th and 15 th days of modeling. The above results indicate that reduction of pparγ in keratinocytes causes kidney damage in mice.

Fig. 5 shows the results of open field experiments in day 14 mice with keratinocyte pparγ knockdown. Compared with the control group, the number of times that the PPARgamma knockout group mice enter the open field center is obviously reduced. The above results indicate that reduction of pparγ in keratinocytes causes anxiety symptoms in mice.

FIG. 6 shows the results of a high-altitude cross experiment in day 14 mice with PPARgamma knockdown of keratinocytes. Compared with the control group, the number of times, distance and time of entering the open arm of the PPARgamma knockout group are reduced. The above results indicate that reduction of pparγ in keratinocytes causes anxiety symptoms in mice.

Fig. 7 shows the results of experiments performed on new arm of Y maze of day 14 mice with pparγ knockdown of keratinocytes. The number of times pparγ knockout mice entered the new arm was reduced compared to the control group. The above results indicate that the decrease of pparγ in keratinocytes causes learning, memory and cognitive dysfunction in mice.

FIG. 8 shows the results of microglial immunofluorescent staining of the CA3 region, dentate Gyrus (DG) region of the brain hippocampus of day 15 mice with PPARgamma knockdown of keratinocytes. Compared with the control group, the PPARgamma knockout group mice have obviously increased numbers of microglial cells activated by the brain hippocampus CA3 region and the dentate gyrus region, and the levels of the microglial cells are similar to those of the positive control group MRL/lpr mice (classical lupus encephalopathy model mice). The above results indicate that pparγ reduction in keratinocytes results in abnormal activation of hippocampal microglia in the brain of mice.

FIG. 9 shows the results of RT-qPCR experiments on IL-1β and CCL-22 in the brains of mice 15 days after PPARγ knockdown of local keratinocytes. Compared with the control group, the expression level of microglial related inflammatory factors IL-1 beta and chemotactic factor CCL-22 in brain tissues of the PPARgamma knockout group mice is obviously increased. The above results indicate that a decrease in pparγ in keratinocytes increases brain inflammation levels in mice.

The total of 15 PPARgamma heterozygous knockout mice and PPARgamma homozygous knockout mice are used for molding, and the molding success rate of 15 mice is 100 percent. The results show that the animal model has the characteristics of stable phenotype and rapid onset.

In conclusion, the model of the invention has genetic background rather than drug induction compared to other lupus encephalopathy models,

the disease is rapid, the disease is developed 7 days after the molding is started, the peak is reached 14 days, and the efficiency is high and stable. All mice with the model built developed a certain degree of phenotype 1-2 weeks after induction of PPARgamma knockdown in keratinocytes, with little intra-group heterogeneity and strong reproducibility. In addition, PPARγflox/flox +/-Krt5-CreERT2 +/-and PPARγflox/flox-/-Krt5-CreERT2 +/-mice can be obtained continuously through breeding, and are economical and convenient. Whereas traditional MRL/lpr, pristane induction models, etc., because they usually take 3 months to 6 months for onset. Therefore, the model of the application solves the difficulties of long modeling time, few types, difficult acquisition, high price and instability of the current lupus encephalopathy model.

The invention provides a thought and a method for preparing a spontaneous lupus encephalopathy animal model by knocking out keratinocyte PPARgamma, and particularly the method and the method for realizing the technical scheme are a plurality of preferred embodiments of the invention, and it should be pointed out that a plurality of improvements and modifications can be made by one of ordinary skill in the art without departing from the principle of the invention, and the improvements and the modifications are also considered as the protection scope of the invention. The components not explicitly described in this embodiment can be implemented by using the prior art.

Claims

1. An application of a spontaneous systemic lupus erythematosus animal model as a spontaneous lupus encephalopathy animal model, wherein the spontaneous systemic lupus erythematosus animal model is constructed by the following steps:

(1) Constructing a keratinocyte-conditioned ppary knockout mouse, including a ppary heterozygous knockout and a ppary homozygous knockout C57BL/6 mouse, wherein the ppary heterozygous knockout mouse has a genotype of ppary flox/flox +/-Krt5-creert2+/-; the genotype of the PPARgamma homozygous knockout is PPARgamma flox/flox-/-Krt5-CreERT2+/-;

2. The use according to claim 1, wherein said keratinocyte conditional pparγ knockout mouse is constructed by the following method:

3. The use according to claim 1, the spontaneous systemic lupus erythematosus animal model as a spontaneous lupus encephalopathy animal model for studying lupus encephalopathy disease mechanisms.

4. The use according to claim 1, wherein the spontaneous systemic lupus erythematosus animal model is used as a spontaneous lupus encephalopathy animal model for screening for drugs for treating lupus encephalopathy.