CN117551766A

CN117551766A - Application of reagent for detecting gene expression quantity in preparation of TFEB rearranged renal cell carcinoma diagnostic product

Info

Publication number: CN117551766A
Application number: CN202311594109.8A
Authority: CN
Inventors: 请求不公布姓名
Original assignee: Affiliated Hospital of Guangdong Medical University
Current assignee: Affiliated Hospital of Guangdong Medical University
Priority date: 2023-11-27
Filing date: 2023-11-27
Publication date: 2024-02-13

Abstract

The application belongs to the technical field of biology, and particularly relates to application of a reagent for detecting expression quantity of genes Tyrp1, aqp8 or Gpnmb in preparation of TFEB rearranged renal cell carcinoma diagnostic products. According to the method, a mouse model of TFEB rearranged renal cell carcinoma is constructed, key downstream target genes and signal paths of the kidney cancer occurrence caused by the overexpression of Tfeb by PTEC are explored, the first 3 genes Tyrp1, aqp8 and Gpnmb with the highest difference multiple are screened out, specific biomarkers and treatment targets of TFEB rearranged renal cell carcinoma diagnosis are established according to the first 3 genes Tyrp1, aqp8 and Gpnmb, and a new technical approach is provided for clinically searching tumor biomarkers and treatment targets of TFEB rearranged renal cell carcinoma.

Description

Application of reagent for detecting gene expression quantity in preparation of TFEB rearranged renal cell carcinoma diagnostic product

Technical Field

The application belongs to the field of biotechnology, and particularly relates to application of a reagent for detecting gene expression quantity in preparation of TFEB rearranged renal cell carcinoma diagnostic products.

Background

TFEB rearranged renal cell carcinoma is a subtype of renal cell carcinoma that is well developed in children and adolescents. Although TFEB rearranged renal cell carcinoma is a low malignancy non-invasive tumor, 17% of patients clinically exhibit invasiveness, and about 17% of children and adolescent patients have relapses after surgery, adult patients exhibit stronger invasiveness, metastasis often occurs at the time of initial diagnosis, and prognosis of patients with metastasis is poor. Because of its broad morphological characteristics, it is difficult for pathology to accurately diagnose the disease, and current Fluorescence In Situ Hybridization (FISH) detection is the gold standard for diagnosing the disease. However, FISH detection is complex and expensive, so that the pathogenesis of TFEB rearranged renal cell carcinoma is deeply studied and clarified, and efficient and lower-detection-cost specific diagnosis markers and treatment targets are searched, so that the method is urgently needed for clinical diagnosis and treatment of the disease.

The "TFEB gene", i.e., transcription factor EB (transcription factor EB), in TFEB rearranged renal cell carcinoma is one of the microphtalmia-associated transcription factor (MIT) family members, the other three being TFE3, TFEC and MiTF, respectively. The most common translocation form of this disease is the fusion of the TFEB gene of chromosome 6 and the Alph (MALAT 1) gene of chromosome 11 to each other, forming Alpha-TFEB fusion genes, resulting in sustained overexpression of TFEB. After systematic molecular biological profiling of renal cell carcinoma by cancer genomic profile (Cancer Genome Atlas, TCGA) databases in recent years, a variety of novel translocation genes fused with TFEB, such as KHDRBS2, COL21A1, CADM2, CLTC, EWSR1, ACTB and PPP1R10, were found, further suggesting that the incidence and missed diagnosis rate of the disease may be far higher than current clinical cognition.

There is currently no relevant diagnostic product for TFEB rearranged renal cell carcinoma.

Disclosure of Invention

Based on the above, an embodiment of the present application provides an application of a reagent for detecting gene expression level in preparing a TFEB rearranged renal cell carcinoma diagnostic product.

In one aspect, the application provides application of a reagent for detecting expression level of genes Tyrp1, aqp8 or Gpnmb in preparation of TFEB rearranged renal cell carcinoma diagnostic products.

In one embodiment, the reagent for detecting the expression level of the gene Tyrp1, aqp8 or Gpnmb comprises one or both of a reagent for detecting the content of a protein product expressed by the gene Tyrp1, aqp8 or Gpnmb and a reagent for detecting the content of transcribed mRNA.

In one embodiment, the reagent comprises a primer for detecting the expression level of the gene Tyrp1, aqp8 or Gpnmb by using the PT-PCR principle.

In one embodiment, the primers comprise a detection primer pair as shown in SEQ ID NO. 1-SEQ ID NO. 6.

The application also provides an agent for promoting expression of the gene Tyrp1, aqp8 or Gpnmb, a transcription product of the gene Tyrp1, aqp8 or Gpnmb, or application of the expression product of the gene Tyrp1, aqp8 or Gpnmb in preparation of TFEB rearranged renal cell carcinoma prevention, treatment or prognosis medicines.

The application also provides a kit for detecting TFEB rearranged renal cell carcinoma, which comprises a reagent for detecting the expression quantity of genes Tyrp1, aqp8 or Gpnmb.

In one embodiment, the kit comprises one or both of a reagent for detecting the expression level of the gene Tyrp1, aqp8 or Gpnmb protein and a reagent for detecting the expression level of mRNA.

In one embodiment, the kit further comprises primers for detecting the expression level of the genes Tyrp1, aqp8 or Gpnmb by using the PT-PCR principle.

In one embodiment, the kit further comprises one or more of a negative control, a positive control, and a quality control.

In another aspect, the present application also provides a medicament for preventing, treating or prognosing TFEB rearranged renal cell carcinoma, wherein the active ingredient of the medicament comprises one or more of an agent expressed by a gene Tyrp1, aqp8 or Gpnmb, a transcription product of the gene Tyrp1, aqp8 or Gpnmb, or an expression product of the gene Tyrp1, aqp8 or Gpnmb.

In one embodiment, the composition further comprises pharmaceutically acceptable auxiliary materials.

In one embodiment, the adjuvant is selected from one or more of a diluent, a binder, a disintegrant, a lubricant, and a wetting agent.

According to the method, a mouse model of TFEB rearranged renal cell carcinoma is constructed, key downstream target genes and signal paths of the kidney cancer occurrence caused by the overexpression of Tfeb by PTEC are explored, the first 3 genes Tyrp1, aqp8 and Gpnmb with the highest difference multiple are screened out, specific biomarkers and treatment targets of TFEB rearranged renal cell carcinoma diagnosis are established according to the first 3 genes Tyrp1, aqp8 and Gpnmb, and a new technical approach is provided for clinically searching tumor biomarkers and treatment targets of TFEB rearranged renal cell carcinoma.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more fully understand the present application and its advantageous effects, the following brief description will be given with reference to the accompanying drawings, which are required to be used in the description of the embodiments. It is obvious that the drawings in the following description are only some embodiments of the present application, and that other drawings may be obtained from these drawings without inventive effort to a person skilled in the art.

FIG. 1 is a construction strategy for TFEB conditional overexpression gene-editing mice;

FIG. 2 is Tfeb ^fl/+ Genotype identification and gene over-expression efficiency verification of Ggt1-cre mice;

FIG. 3 is the effect of PTEC conditional overexpression of Tfeb on survival curve and kidney function in mice;

FIG. 4 is the effect of PTEC conditional overexpression of Tfeb on mouse kidney size;

FIG. 5 is the effect of PTEC conditional overexpression of Tfeb on mouse kidney morphology;

FIG. 6 shows that PTEC conditional overexpression of Tteb mice resulted in renal carcinogenesis;

FIG. 7 is a transcriptomic sequencing results analysis of PTEC conditional overexpression Tteb mice;

wherein targeting strategy is a targeting strategy; wild type allele; the targeting vector is a positioning vector; the survival rate is given by percentage survivin, and the transcription stop is given by transcriptional stop element; kidney weight is kidney weight; body weight is body weight.

Detailed Description

The present application will be described in further detail with reference to embodiments and examples. It should be understood that these embodiments and examples are provided solely for the purpose of illustrating the application and are not intended to limit the scope of the application in order to provide a more thorough understanding of the present disclosure. It is also to be understood that this application may be embodied in many different forms and is not limited to the embodiments and examples described herein, but is capable of numerous changes or modifications without departing from the spirit of the application, as equivalent forms are intended to be within the scope of this application. Furthermore, in the following description, numerous specific details are set forth in order to provide a more thorough understanding of the present application, it being understood that the present application may be practiced without one or more of these details.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

Terminology

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. Unless otherwise conflict with the purpose and/or technical solution of the present application, the present application relates to the cited documents which are incorporated by reference in their entirety for all purposes. When reference is made to a cited document in this application, the definitions of the relevant technical features, terms, nouns, phrases, etc. in the cited document are also incorporated by reference. Examples of the relevant technical features and preferred modes to be cited in the present application when the cited documents are referred to in the present application are incorporated by reference in the present application, but are not limited to being able to implement the present application. It should be understood that when a reference is made to the description herein, it is intended to control or adapt the present application in light of the description herein.

Unless otherwise indicated or contradicted, terms or phrases used herein have the following meanings:

the term "and/or," "and/or," as used herein, includes any one of two or more of the listed items in relation to each other, as well as any and all combinations of the listed items in relation to each other, including any two of the listed items in relation to each other, any more of the listed items in relation to each other, or all combinations of the listed items in relation to each other. It should be noted that, when at least three items are connected by a combination of at least two conjunctions selected from "and/or", "or/and", "and/or", it should be understood that, in this application, the technical solutions certainly include technical solutions that all use "logical and" connection, and also certainly include technical solutions that all use "logical or" connection.

The term "conditional overexpression" in mice, the Cre-lox system was originally used to switch on gene expression in specific cell populations. Flox mice required for conditional gene expression typically carry a silent transgene, that is, a "stop-box" between the target gene and the promoter. This "termination cassette" is typically composed of a strong polyA signal and/or splice donor sequence that prevents transcription of the transgene. In the offspring mice obtained after mating these Flox mice with transgenic mice whose cell type specifically expresses Cre, in each cell expressing Cre recombinase, the termination cassette is excised by Cre, thus expressing only the desired transgene in these cells.

The term "transcriptome Sequencing (mRNA-Seq): is a technique that uses high throughput sequencing technology to reveal a snapshot of the presence and quantity of RNA from a genome at a given time, provides a new perspective for life sciences research, can be used to predict gene structure, variable cleavage and other transcriptional modifications, and can quantitatively determine changes in expression levels of each transcript during growth and under different conditions.

AQP8 was found to regulate esophageal cancer cell migration through EGFR-ERK1/2 signaling pathway. AQP8 knockdown of the inner membrane of the centromere in human liver cancer HepG2 cells results in ROS-induced mitochondrial depolarization and loss of viability, ultimately leading to death of tumor cells. Non-metastatic melanoma glycoprotein B (Glycoprotein nonmelanosoma protein B, GPNMB) is a highly glycosylated type I transmembrane glycoprotein that localizes to the cell membrane or is stored in endosomes and lysosomes. GPNMB is highly expressed in various tumor tissues (such as prostate cancer, breast cancer, lung cancer and the like), promotes proliferation and metastasis of tumor cells, and can inhibit growth and proliferation and metastasis invasion of cancer cells by knocking down GPNMB. The above demonstrates that high expression of TYRP1, AQP8 and GPNMB may be key mechanisms that mediate TFEB rearrangement renal cell carcinogenesis.

TFEB binds to the CLEAR element (The socalled coordinated lysosomal expression and regulation motif) of its promoter region of the gene of interest via the bHLH-ZL (basic helix-loop-helix-zipper) domain, thereby activating transcription of its downstream genes, the most predominant way TFEB regulates expression of its target genes.

Alternatively, the reagent for detecting the protein expression amount includes a reagent used in the following method: western blot, enzyme-linked immunosorbent assay, radioimmunoassay, sandwich assay, immunohistochemical staining, mass spectrometry, immunoprecipitation assay, complement fixation assay, flow cytometry and protein chip method.

In a specific example, the reagent for detecting the expression amount of mRNA includes a reagent used in the following method: PCR-based detection methods, southern hybridization methods, northern hybridization methods, dot hybridization methods, fluorescent in situ hybridization methods, DNA microarray methods, ASO methods, and high throughput sequencing platform methods.

The mRNA expression level auxiliary detection reagent includes, but is not limited to: and (3) a reagent for visualizing the amplicon corresponding to the primer, such as a reagent for visualizing the amplicon by agarose gel electrophoresis, enzyme-linked gel method, chemiluminescence method, in situ hybridization method, fluorescence detection method and the like, an RNA extraction reagent, a reverse transcription reagent and a cDNA amplification reagent, and preparing a standard substance, a positive control substance and a negative control substance for a standard curve.

Alternatively, the protein expression level-aiding detection reagent includes, but is not limited to: blocking solution, antibody diluent, washing buffer solution, chromogenic stop solution, and standard curve standard substance.

In a specific example, the reagent for detecting the protein expression level includes a reagent used in the following method: western blot, enzyme-linked immunosorbent assay, radioimmunoassay, sandwich assay, immunohistochemical staining, mass spectrometry, immunoprecipitation assay, complement fixation assay, flow cytometry and protein chip method.

It is understood that the reagent includes a primer for detecting the expression level of the gene Tyrp1, aqp8 or Gpnmb by using the PT-PCR principle, and the primer includes a detection primer pair shown as SEQ ID NO. 1-SEQ ID NO. 6.

In another aspect, the present application provides a kit for detecting TFEB rearranged renal cell carcinoma, the kit comprising a reagent for detecting expression level of gene Tyrp1, aqp8 or Gpnmb.

In a specific example, the kit includes one or both of a reagent for detecting the expression amount of the gene Tyrp1, aqp8 or Gpnmb protein and a reagent for detecting the expression amount of mRNA.

Optionally, the kit further comprises a detection primer pair shown as SEQ ID NO. 1-SEQ ID NO. 6. It can be understood that the following primer sequences are designed for homologous fragments of Tyrp1, aqp8 and Gpnmb genes in mice and humans, have trans-species universality, and can be used for detecting the expression level of related marker genes in TFEB rearranged renal cell carcinoma patients and model mouse deep renal carcinoma tissues.

Tyrp1 primer F1：ctcacatggcacaggtacca(5’-3’)(SEQ ID NO.1)

Tyrp1 primer R1：ctggatcccatcaagtcatc(5’-3’)(SEQ ID NO.2)

Aqp8 primer F1：gctctcttcatcttcatcgg(5’-3’)(SEQ ID NO.3)

Aqp8 primer R1：gcagggttgaagtgtccacc(5’-3’)(SEQ ID NO.4)

Gpnmb primer F1：gagaagttcgatggcaac(5’-3’)(SEQ ID NO.5)

Gpnmb primer R1：catgcttgtcacgaagca(5’-3’)(SEQ ID NO.6)

Further optionally, the kit further comprises one or more of a negative control, a positive control, and a quality control.

The application also provides a medicine for treating TFEB rearranged renal cell carcinoma, and the active ingredients of the medicine comprise one or more of an agent expressed by a gene Tyrp1, an Aqp8 or a Gpnmb, a transcription product of the gene Tyrp1, the Aqp8 or the Gpnmb, or an expression product of the gene Tyrp1, the Aqp8 or the Gpnmb.

Optionally, the dosage form of the medicament is one or more of a tablet, a capsule, a granule, a pill, an injection and a sustained release preparation.

Further optionally, the pharmaceutically acceptable excipients are selected from one or more of diluents, binders, disintegrants, lubricants and wetting agents.

Wherein the diluent is at least one selected from starch, dextrin, sucrose, glucose, lactose, mannitol, sorbitol, xylitol, microcrystalline cellulose, calcium sulfate, calcium hydrogen phosphate and calcium carbonate.

The binder is at least one selected from starch slurry, dextrin, syrup, mel, glucose solution, microcrystalline cellulose, acacia slurry, gelatin slurry, sodium carboxymethyl cellulose, methyl cellulose, hydroxypropyl methyl cellulose, ethyl cellulose, acrylic resin, carbomer, polyvinylpyrrolidone and polyethylene glycol.

The disintegrating agent is at least one selected from starch, microcrystalline cellulose, low-substituted hydroxypropyl cellulose, crosslinked polyvinylpyrrolidone, crosslinked sodium carboxymethyl cellulose, sodium carboxymethyl starch, polyoxyethylene, sorbitol, fatty acid ester and sodium dodecyl sulfonate.

Wherein the lubricant is at least one selected from talcum powder, silicon dioxide, stearate, tartaric acid, liquid paraffin and polyethylene glycol.

Wherein the wetting agent is at least one selected from water, ethanol and isopropanol.

Optionally, the medicament is an injection, and the pharmaceutically acceptable auxiliary material is at least one selected from a solubilizer, a pH regulator and an osmotic pressure regulator.

Further alternatively, the solubilizing agent is selected from at least one of ethanol, isopropanol, propylene glycol, polyethylene glycol, poloxamer, lecithin, and hydroxypropyl-beta-cyclodextrin.

Wherein the pH regulator is at least one selected from citrate, phosphate, carbonate, acetate, hydrochloric acid and hydroxide, and the osmotic pressure regulator is at least one selected from sodium chloride, mannitol, glucose, phosphate, citrate and acetate.

Embodiments of the present application will be described in detail below with reference to examples. It should be understood that these examples are illustrative only of the present application and are not intended to limit the scope of the present application. The experimental methods, in which specific conditions are not noted in the following examples, are preferably referred to in the guidelines given in the present application, may be according to the experimental manual or conventional conditions in the art, may be according to the conditions suggested by the manufacturer, or may be referred to experimental methods known in the art.

In the specific examples described below, the measurement parameters relating to the raw material components, unless otherwise specified, may have fine deviations within the accuracy of weighing. Temperature and time parameters are involved, allowing acceptable deviations from instrument testing accuracy or operational accuracy.

Example 1: construction and identification of a mouse model of TFEB rearranged renal cell carcinoma

1. Genotyping and gene overexpression efficiency verification of PTEC conditional overexpression Tfeb mice

The method constructs a gene editing mouse with Tfeb conditional overexpression sequence (CAG-loxP-STOP-loxP-Tfeb) inserted into the Rosa26 site by selecting a commonly used cre-loxP system as a gene editing scheme of the conditional gene editing mouse, and hybridizes with a Ggt1-cre mouse capable of specifically expressing cre recombinase in proximal tubular epithelial cells (Proximal tubule epithelial cell, PTEC), thereby successfully obtaining a mouse (Tfeb) with Tfeb conditional overexpression in PTEC ^fl/+ Ggt1-cre mice), the construction strategy is shown in FIG. 1.

Ggt1-cre mice were combined with Tfeb ^fl/+ Or Tfeb ^fl/fl Mouse hybridization to successfully obtain Tfeb ^fl/+ Ggt1-cre mice, as shown by A in FIG. 2, i.e., tfeb mice conditionally overexpressed in PTEC. Tfeb detection by RT-PCR and immunoblotting ^fl/+ The overexpression efficiency of Ggt1-cre mice, as shown in B-D in FIG. 2, shows that: tfeb compared to Ggt1-cre mice ^fl/+ The average of TFeb mRNA and TFEB protein levels was significantly elevated in Ggt1-cre mice (P<0.0001 and P<0.01). Meanwhile, to further verify that TFEB protein is specifically over-expressed in PTEC, TFEB and LTL (markers of PTEC) are co-stained by immunofluorescence, and the result shows that Tfeb ^fl/+ The expression of TFEB in LTL positive tubules (i.e., proximal tubules) in kidney tissue of Ggt1-cre mice is shown as E in FIG. 2, which demonstrates that the present application successfully achieves conditional overexpression of Tfeb in mouse PTEC.

Wherein,a in FIG. 2 is the PCR method for detecting the genotype of mice, tfeb ^fl/+ Ggt1-cre mice have bands at 500bp and 248 bp. B in FIG. 2 is the RT-PCR method for detecting the Tfeb mRNA level of the kidney tissue of the mice. C in fig. 2 is the protein expression level of mouse kidney tissue TFEB detected by immunoblotting. D in fig. 2 is the mean relative gray statistics of TFEB proteins. E in FIG. 2 is the immunofluorescence assay for the detection of TFEB and LTL expression and localization in kidney tissue in mice.

2. PTEC conditional overexpression of Tfeb leads to reduced survival and renal dysfunction in mice

The present application found that Tfeb compared to Ggt1-cre mice ^fl/+ The survival rate of Ggt1-cre mice was significantly reduced (P<0.0001 Survival decreased with increasing ages of weeks as shown by a in figure 3 (while finding Tfeb ^fl/+ The kidney function index of Ggt1-cre mice, blood creatinine and blood urea nitrogen, were significantly elevated 3 and 4 weeks after birth (P)<0.001 and P<0.05 As shown in B-C of fig. 3. In addition, autopsy detection did not reveal significant abnormalities in other organs. These results suggest that death of mice may be associated with failure of kidney function in mice.

Wherein a in fig. 3 is a survival graph of mice. And (3) injection: the abscissa represents the number of days after birth of the mice. B in fig. 3 is the detection of blood urea nitrogen in mice of different ages. C in FIG. 3 is the measurement of creatinine in mice of different ages.

3. PTEC conditional overexpression of Tfeb leads to polycystic kidney changes in mice

(1) Applicants found that Tfeb compared to Ggt1-cre mice ^fl/+ The apparent increase in kidney volume in the Ggt1-cre mice is shown by A-B in FIG. 4, and the kidney weight increases from 1 week postnatal (P<0.01 Kidney weight and kidney weight/body weight increased significantly at 3 weeks post-natal (P)<0.0001 As shown in C-D of fig. 4.

Wherein a-B in fig. 4 is a change in the size of the kidney of the mouse, and the region in the circle refers to the kidney. C in fig. 4 is a line graph of kidney weight for mice of different ages. D in fig. 4 is a line graph of kidney weight/body weight for mice of different ages.

(2) Effect of PTEC conditional overexpression of Tfeb on mouse kidney morphology

B-ultrasonic examination of kidney of postnatal 3-week mice found Tfeb ^fl/+ The kidneys of the Ggt1-cre mice present a number of different size vesicles as shown by A in FIG. 4. Likewise, HE staining found Tfeb ^fl/+ The Ggt1-cre mice had progressively larger kidney volumes with increasing age, increased luminal formation as shown by B in FIG. 4, and a kidney lesion incidence of 100%.

Wherein, in fig. 5, a is the kidney morphology of the living mice 3 weeks after birth by the B-ultrasonic examination, the arrow on the left side of the a-graph indicates the kidney of the control mice, and the arrow on the right side of the a-graph indicates the capsule inside the kidney of the mice. B in fig. 5 is a chart of the pathology of HE staining of the whole kidney cross section of mice of different ages.

(3) Conditional overexpression of Tfeb by PTEC leads to the development of kidney cancer in mice

Deep observation is carried out on the kidney lesion part of the mice, and the kidney lesion of the mice with the Tfeb over-expressed PTEC is found to be shown as expansion of a tubular lumen of a kidney, the tubular wall of the kidney is gradually changed into a plurality of layers from a single layer of cells, the single layer distribution characteristics of epithelial cells of a proximal small tube are lost, a cell cancer nest appears in part of the capsule cavity, and finally the cells in the capsule cavity fall off and cell transparency are changed, as shown by A in fig. 6.

Immunofluorescence results showed that Tfeb compared to Ggt1-cre mice ^fl/+ TFEB overexpression was observed in all kidney lesions of Ggt1-cre mice, and PTEC gradually lost LTL, suggesting that PTEC may transdifferentiate as shown in FIG. 6B. Immunohistochemical discovery of Tfeb ^fl/+ Renal carcinoma index CD10 and PAX8 positive expression in Ggt1-cre mice, vimentin and P504S focal positive expression, as shown by C in FIG. 6. The above results indicate that PTEC over-expression of Tfeb results in the occurrence of renal cancer.

Wherein a in fig. 6 is a kidney HE staining pathology chart of mice of different ages. B in FIG. 6 is the immunofluorescence method for detecting the change and location of TFEB and LTL in kidney tissue of mice of different ages. C in FIG. 6 is the detection of Tfeb by immunohistochemical method ^fl ^/+ Renal cancer markers CD10, PAX8, vimentin and P504S of Ggt1-cre mouse kidney tissue.

Example 2

Analysis of transcriptomic sequencing results of PTEC conditional overexpression Tfeb mice

To explore the specific mechanisms of overexpression of Tfeb to trigger renal carcinogenesis and to screen for specific tumor biomarkers, applicant selected 1-cre Ggt mice and Tfeb 1, 2 and 3 weeks postnatal ^fl/+ Ggt1-cre mice, 3 in each group, were transcriptomed with a total of 18 kidney tissue samples. First, the correlation test results of the sequencing results show that the differences in each group are small, and the repeatability of the samples is good, as shown by A in FIG. 7. Subsequently 4 differential genes with significant upregulation (higher upregulation fold) at1 week, 2 weeks and 3 weeks were selected for RT-PCR validation in the sequencing results.

The results show that: tfeb compared to Ggt1-cre mice ^fl/+ The differential genes of kidney tissues of Ggt1-cre mice were all significantly elevated (P<0.05 As shown in B in fig. 7, it was shown that the sequencing results were reliable. Then dividing the differential gene into 9 Cluster according to different expression modes, wherein the gene expression trend in each Cluster is similar, and selecting Tfeb ^fl/+ The differential genes of the Ggt1-cre mice were analyzed for genes in Cluster up-regulated at 3 weeks of age, cluster3, as shown in FIG. 7C. Genes in Cluster3, genes 1 week postnatal according to fold difference > 10, tfeb ^fl ^/+ The conditions that the gene abundance of Ggt1-cre mice was > 100 screened 24 genes altogether, as shown by D in FIG. 7. Then, the first 3 genes Tyrp1, aqp8 and Gpnmb with the highest difference multiple are selected for PT-PCR verification, and the result shows that: tfeb compared to Ggt1-cre mice ^fl/+ Tyrp1, aqp8, gpnmb mRNA levels were significantly elevated in Ggt1-cre mice (P<0.05 The results were identical to the sequencing results, as shown by E in fig. 7. Meanwhile, the 3 genes of Tyrp1, aqp8 and Gpnmb are all possible downstream target genes of TFEB through website prediction, as shown by F in FIG. 7.

In fig. 7, a is a correlation analysis chart of each sample. CON stands for Ggt1-cre mice, OE stands for Tfeb ^fl/+ Ggt1-cre mice; p6 represents 6 days after birth (1 week), P14 represents 14 days after birth (2 weeks), and P21 represents birth21 days after (3 weeks). B in FIG. 7 is the RT-PCR method for detecting Tfeb, maoa, sox and Pmel mRNA levels of sequencing samples of mice of different ages. C in FIG. 7 is Cluster in which the differential gene of the mice overexpressed Tfb was selected to be up-regulated at 3 weeks of age.

Example 3: RT-PCR primer design of three genes of Tyrp1, aqp8 and Gpnmb for human and mouse

The following primer sequences are designed for homologous fragments of Tyrp1, aqp8 and Gpnmb in mice and humans, have trans-species universality, and can be used for detecting the expression level of related marker genes in TFEB rearranged renal cell carcinoma patients and model mouse deep renal carcinoma tissues, and the expression level is specifically shown in table 1:

TABLE 1

Product sequence information:

Tyrp1 primer F1：ctcacatggcacaggtacca(5’-3’)(SEQ ID NO.1)

Tyrp1 primer R1：ctggatcccatcaagtcatc(5’-3’)(SEQ ID NO.2)

fragment mouse (146 bp) (5 '-3') was synthesized:

ctcacatggcacaggtaccatctgctgcagctggagagagacatgcaggagatgctgcaggagccttctttctcccttccttactggaattttgcaactgggaaaaacgtctgcgatgtctgcactgatgacttgatgggatccag(SEQ ID NO.7)

synthetic fragment human (146 bp) (5 '-3'):

ctcacatggcacaggtaccacctcctgcgtctggagaaagacatgcaggaaatgttgcaagagccttctttctcccttccttactggaattttgcaacggggaaaaatgtctgtgatatctgcacggatgacttgatgggatccag(SEQ ID NO.8)

Aqp8 primer F1：gctctcttcatcttcatcgg(5’-3’)(SEQ ID NO.3)

Aqp8 primer R1：gcagggttgaagtgtccacc(5’-3’)(SEQ ID NO.4)

fragment mouse (146 bp) (5 '-3') was synthesized:

gctctcttcatcttcatcggatgtctatcggtcattgagaatagtccgaatactgggctcctgcagcctgccttggctcatgggctggccttggggctcatcattgctaccttggggaacatcagcggtggacacttcaaccctgc(SEQ ID NO.9)

synthetic fragment human (146 bp) (5 '-3'):

gctctcttcatcttcatcgggtgcctgtcggtcattgagaatgggacggacactgggctgctgcagccggccctggcccacgggctggctttggggctcgtgattgccacgctggggaatatcagtggtggacacttcaaccctgc(SEQ ID NO.10)

Gpnmb primer F1：gagaagttcgatggcaac(5’-3’)(SEQ ID NO.5)

Gpnmb primer R1：catgcttgtcacgaagca(5’-3’)(SEQ ID NO.6)

fragment mouse (123 bp) (5 '-3') was synthesized:

gagaagttcgatggcaaccctgacatgctgggcatgcctttcatgtatcagtgccagctcttcatggaaaagagcaccagagatttctcagttgaccgcatccgtgtgtgcttcgtgacaagcatg(SEQ ID NO.11)

synthetic fragment human (123 bp) (5 '-3'):

gagaagttcgatggcaacccagacatgctggctcctttcatggcccagtgccagatcttcatggaaaagagcaccagggatttctcagttgatcgtgtccgtgtctgcttcgtgacaagcatg(SEQ ID NO.12)

example 4 sensitivity and specificity verification

The performance of TFEB rearranged renal cell carcinoma samples was tested by PT-PCR method using PT-PCR primers of three genes, tyrp1, aqp8 and Gpnmb, which are common to human and mice in example 3.

15 samples of TFEB rearranged renal cell carcinoma verified by FISH detection were collected, and 21 samples of common renal clear cell carcinoma were detected by immunohistochemical detection, which showed low expression of TFEB and TFE 3. The expression levels of three genes of Tyrp1, aqp8 and Gpnmb were detected by PT-PCR using the primer set in example 3, and the expression level of the target gene was recorded as high by 3 times higher than that of the control group with the paracancerous tissue as a control. The detection result can effectively distinguish TFEB rearranged renal cell carcinoma samples from common renal clear cell carcinoma samples. As shown in table 2:

TABLE 2

The above examples merely represent a few embodiments of the present application, which facilitate a specific and detailed understanding of the technical solutions of the present application, but are not to be construed as limiting the scope of the claims. It should be noted that it would be apparent to those skilled in the art that various modifications and improvements could be made without departing from the spirit of the present application, which would be within the scope of the present application. Further, it will be understood that various changes or modifications may be made to the present application by those skilled in the art after reading the foregoing teachings, and equivalents thereof will be within the scope of the present application. It should also be understood that those skilled in the art, based on the technical solutions provided in the present application, can obtain technical solutions through logical analysis, reasoning or limited experiments, all fall within the protection scope of the claims attached to the present application. The scope of the patent application is therefore intended to be limited by the content of the appended claims, which description and drawings may be interpreted accordingly.

Claims

1. The application of the reagent for detecting the expression quantity of the genes Tyrp1, aqp8 or Gpnmb in preparing a TFEB rearranged renal cell carcinoma diagnostic product.

2. The use according to claim 1, wherein the reagent for detecting the expression level of the gene Tyrp1, aqp8 or Gpnmb comprises one or both of a reagent for detecting the content of a protein product expressed by the gene Tyrp1, aqp8 or Gpnmb and a reagent for detecting the content of transcribed mRNA.

3. The use according to any one of claims 1 to 2, wherein the reagent comprises a primer for detecting the expression level of the gene Tyrp1, aqp8 or Gpnmb using PT-PCR principle;

optionally, the primer comprises a detection primer pair shown as SEQ ID NO. 1-SEQ ID NO. 6.

4. An agent for promoting expression of gene Tyrp1, aqp8 or Gpnmb, a transcription product of gene Tyrp1, aqp8 or Gpnmb, or an expression product of gene Tyrp1, aqp8 or Gpnmb is used for preparing TFEB rearranged renal cell carcinoma prevention, treatment or prognosis medicines.

5. A kit for detecting TFEB rearranged renal cell carcinoma, comprising a reagent for detecting expression level of gene Tyrp1, aqp8 or Gpnmb.

6. The kit according to claim 4, wherein the kit comprises one or both of a reagent for detecting the expression amount of the gene Tyrp1, aqp8 or Gpnmb protein and a reagent for detecting the expression amount of mRNA.

7. The kit according to claim 4, further comprising a primer for detecting expression level of gene Tyrp1, aqp8 or Gpnmb using PT-PCR principle;

8. The kit of any one of claims 4-7, further comprising one or more of a negative control, a positive control, and a quality control.

9. A medicament for preventing, treating or prognosing TFEB rearranged renal cell carcinoma, characterized in that the active ingredient comprises one or more of an agent expressed by a gene Tyrp1, aqp8 or Gpnmb, a transcription product of the gene Tyrp1, aqp8 or Gpnmb, or an expression product of the gene Tyrp1, aqp8 or Gpnmb.

10. The medicament of claim 9, further comprising pharmaceutically acceptable excipients;

optionally, the auxiliary material is selected from one or more of diluents, binders, disintegrants, lubricants and wetting agents.