CN117535328A

CN117535328A - High-yield hexamethylenediamine genetic engineering strain, construction method and application thereof

Info

Publication number: CN117535328A
Application number: CN202311432312.5A
Authority: CN
Inventors: 王丹; 肖开兴; 罗若诗; 刘雪梅; 周桢; 胡舸; 林凡祯
Original assignee: Chongqing University
Current assignee: Chongqing University
Priority date: 2023-10-31
Filing date: 2023-10-31
Publication date: 2024-02-09

Abstract

The invention belongs to the field of biochemical engineering, and particularly discloses recombinant plasmids for assisting in synthesizing hexamethylenediamine, a bacterial strain for synthesizing hexamethylenediamine, a construction method and application thereof. The invention uses seamless cloning method to make the hexamethylenediamine related gene to make the gene co-expression in one or more recombinant plasmids. The leucine pathway is directionally transformed by combining a carbon chain circulation extension strategy, so that flexible and controllable production of various high-added-value chemical products is realized, and an efficient and stable production platform of a nylon material monomer hexamethylenediamine by a one-pot method is built. Further selects an L-lysine-alpha-oxidase from Trichoderma viride (Trichoderma viride) as a multi-enzyme cascade high-performance synthesis way for initiating oxidation reaction to synthesize hexamethylenediamine, and provides a reasonable scheme for industrial production of hexamethylenediamine.

Description

High-yield hexamethylenediamine genetic engineering strain, construction method and application thereof

Technical Field

The invention belongs to the field of biochemical engineering, and in particular relates to a high-yield hexamethylenediamine genetic engineering strain, a construction method and application thereof.

Prior Art

In recent years, increasing global environmental, climate change, and fossil fuel sources issues are leading to a shift in the production of traditional bulk chemicals to greener, renewable, economical, and sustainable routes. The appearance and application of the cell factory greatly relieve the problem, and the low-cost raw materials can be utilized to continuously and efficiently produce high-added-value products. In vivo carbon chain extension is a great potential approach, and can be used for synthesizing similar acids and alcohols with different chain lengths, which are important constituent substances of biofuels and materials with important research values.

Nylon is one of the most common polyamide materials, and a monomer of the nylon is Hexamethylenediamine (Hexamethylenediamine), and according to the prior report, hexamethylenediamine is mainly prepared by an adiponitrile method, and adiponitrile raw materials depend on import, so that the problems of high cost and inconvenient supply exist, and the synthesis of Hexamethylenediamine still has the urgent problems of low yield, high energy consumption, environmental pollution and the like. The L-lysine is taken as an important commercial amino acid, has the production capacity of megaton in the global scope, has the combination of synthesis biology and biochemistry to be applied to the efficient and stable production of biochemical products with low cost raw materials in the past decades, can realize the efficient and controllable production of hexamethylenediamine products by taking the L-lysine as a substrate and taking genetically engineered recombinant escherichia coli as a carrier, and has important significance for establishing the efficient and continuously controllable biochemical industry. In the case of biological synthesis of hexamethylenediamine, the published patent CN113755419a describes a method for producing hexamethylenediamine by double-strain combined fermentation, but the experimental procedure is cumbersome and the yield of batch products is low. Therefore, the patent aims to obtain a path and a method which are more suitable for synthesizing hexamethylenediamine by screening the enzyme for combined catalysis and repeatedly comparing the influence of isoenzyme or heteroenzyme on the overall catalysis of hexamethylenediamine synthesis and performing directed evolution on synthesis paths such as alpha-keto acid, leucine and the like in microorganisms.

Thirty or more transaminases and twenty or more decarboxylases are screened, a group of advantageous combination modes are finally selected, and key genes for producing hexamethylenediamine are integrated, so that the modified engineering strain has the capability of independently producing hexamethylenediamine, the L-lysine one-pot method is realized for synthesizing polyamide material monomer hexamethylenediamine, other high-value intermediate products are obtained, and new breakthroughs for producing biological base materials are realized.

Disclosure of Invention

The invention aims at the problems, provides a genetic engineering strain with high yield of hexamethylenediamine and two recombinant plasmids for assisting in synthesizing hexamethylenediamine, provides a construction method of the genetic engineering strain with high yield of hexamethylenediamine and the recombinant plasmids for assisting in synthesizing hexamethylenediamine, and provides a method of the genetic engineering strain and the recombinant plasmids in the processes of producing hexamethylenediamine by in vitro catalysis, whole cell catalysis and strain fermentation.

Through the research of the inventor, the determined technical ideas are as follows: the L-lysine oxidase LysOX catalyzes L-lysine to deaminate and synthesize alpha-keto-epsilon-aminocaproic acid, and the L-lysine oxidase LysOX catalyzes L-lysine to synthesize alpha-keto-epsilon-aminocaproic acid by LeuA gene, leuB gene, leuC gene and LeuD gene to complete carbon chain extension, and then performs serial ammonia conversion decarboxylation reaction by Vfl gene, kdcA gene, ddc gene and Dat gene to finally form a target product hexamethylenediamine, and forms other chemicals with high added value and has adjustability.

The invention provides a recombinant plasmid or a plasmid combination capable of assisting in producing hexamethylenediamine, which comprises a LysOX gene, a 2-isopropyl malate synthase LeuA gene, a 3-isopropyl malate dehydrogenase LeuB gene, a 3-isopropyl malate dehydratase gene LeuC and a 3-isopropyl malate dehydratase LeuD gene; and the aromatic-L-amino acid decarboxylase Ddc gene, the pyruvate transaminase Vfl gene, the alanine transaminase Dat gene and the branched-chain alpha-keto acid decarboxylase KdcA gene are constructed on one recombinant plasmid, or two, three, four, five, six, seven, eight or nine recombinant plasmids are respectively constructed to form a plasmid combination;

preferably, the 2-isopropyl malate synthase gene, the 3-isopropyl malate dehydrogenase gene, the 3-isopropyl malate dehydratase gene, and the 3-isopropyl malate dehydratase gene are derived from E.coli; the dcs gene was derived from mice (Mus musculus).

Preferably, the nucleotide sequence of the LysOX gene is shown as SEQ ID NO. 1, the nucleotide sequence of the LeuA gene is shown as SEQ ID NO. 2, the nucleotide sequence of the LeuB gene is shown as SEQ ID NO. 3, the nucleotide sequence of the LeuC gene is shown as SEQ ID NO. 4, and the nucleotide sequence of the LeuD gene is shown as SEQ ID NO. 5; the nucleotide sequence of the Vfl gene is shown as SEQ ID NO. 9, the nucleotide sequence of the Dat gene is shown as SEQ ID NO. 7, and the nucleotide sequence of the KdcA gene is shown as SEQ ID NO. 6

It is also preferred that the LysOX gene, the isopropyl 2-malate synthase LeuA gene, the 3-isopropyl malate dehydrogenase LeuB gene, the 3-isopropyl malate dehydratase gene LeuC and the 3-isopropyl malate dehydratase LeuD gene are constructed on one plasmid, called the first recombinant plasmid, preferably its starting plasmid pET28a; while the aromatic-L-amino acid decarboxylase Ddc gene, the pyruvate transaminase Vfl gene, the alanine transaminase Dat gene and the branched-chain alpha-keto acid decarboxylase KdcA gene are constructed on another recombinant plasmid, called a second recombinant plasmid, preferably its starting plasmid pET21a.

Specifically, preferably, each gene is connected and constructed on a starting plasmid through a seamless cloning technology to obtain a first recombinant plasmid and a second recombinant plasmid, preferably, the nucleotide sequence of the first recombinant plasmid is shown as SEQ ID NO. 10, and the nucleotide sequence of the second recombinant plasmid is shown as SEQ ID NO. 11.

The invention provides a genetic engineering strain capable of producing hexamethylenediamine by using L-lysine, which is characterized in that LysOX gene, 2-isopropyl malate synthase LeuA gene, 3-isopropyl malate dehydrogenase LeuB gene, 3-isopropyl malate dehydratase LeuC gene and 3-isopropyl malate dehydratase LeuD gene, and 9 genes of aromatic-L-amino acid decarboxylase Ddc gene, pyruvate transaminase Vfl gene, alanine transaminase Dat gene and branched alpha-keto acid decarboxylase KdcA gene are simultaneously introduced into the genetic engineering strain;

preferably, the 2-isopropyl malate synthase gene, the 3-isopropyl malate dehydrogenase gene, the 3-isopropyl malate dehydratase gene, and the 3-isopropyl malate dehydratase gene are derived from E.coli, and the Ddc gene is derived from mouse (Mus musculus);

more preferably, the nucleotide sequence of the LysOX gene is shown as SEQ ID NO. 1, the nucleotide sequence of the LeuA gene is shown as SEQ ID NO. 2, the nucleotide sequence of the LeuB gene is shown as SEQ ID NO. 3, the nucleotide sequence of the LeuC gene is shown as SEQ ID NO. 4, the nucleotide sequence of the LeuD gene is shown as SEQ ID NO. 5, the nucleotide sequence of the Ddc gene is shown as SEQ ID NO. 8, the nucleotide sequence of the Vfl gene is shown as SEQ ID NO. 9, the nucleotide sequence of the Dat gene is shown as SEQ ID NO. 7, and the nucleotide sequence of the KdcA gene is shown as SEQ ID NO. 6.

In specific embodiments, the 9 genes are simultaneously constructed on one expression plasmid, or respectively constructed on two expression plasmids, three expression plasmids, four expression plasmids, five expression plasmids, six expression plasmids, seven expression plasmids, eight expression plasmids or nine expression plasmids, and introduced into a starting strain to obtain a genetic engineering strain for producing hexamethylenediamine;

more specifically, a genetically engineered strain producing hexamethylenediamine is obtained by introducing a plasmid according to any one of claims 1 to 4 or a combination of plasmids into a starting strain.

In a specific embodiment, the starting strain of the genetically engineered strain is a prokaryotic bacterium, such as E.coli, P.aeruginosa, salmonella, and the like.

The invention provides a method for producing hexamethylenediamine by using the genetic engineering strain, which uses L-lysine as a substrate to ferment and obtain hexamethylenediamine by using the genetic engineering strain; optionally, a step of separating or purifying the obtained hexamethylenediamine is also included.

Preferably, the fermentation process is as follows:

the culture medium is LB liquid culture medium, the pH value of the culture medium is regulated to be between 6.8 and 7.5 by sodium hydroxide solution, in the fermentation process, dissolved oxygen is controlled to be between 30 and 35 percent, the fermentation temperature is 32 ℃, the initial rotating speed is set to be 300rpm, then the culture medium is converted into rotating speed to couple dissolved oxygen, and when the glucose has obvious descending trend, the glucose is supplemented, so that the glucose concentration is maintained to be between 5.5 and 7.5g/L.

More specifically, the total amounts of L-lysine, amine donor alanine, amine donor glutamine and glucose added during fermentation were as follows:

(1) Total amount of L-lysine input: 10 g-120 g, the substrate L-lysine feeding time is respectively as follows: 16h to 21h, 34h to 39h and 52h to 57h;

(2) Total amount of amine donor alanine input: 5g-75g, the feeding time of the amine donor alanine is respectively as follows: 16h to 21h, 34h to 39h and 52h to 57h;

(3) Total amount of amine donor glutamine input: 5g-75g, the amine donor glutamine feed time is respectively: 16h to 21h, 34h to 39h and 52h to 57h;

(4) Total amount of glucose input: 25 g-150 g, glucose feeding time is respectively: 27 to 32 hours, 43 to 48 hours and 62 to 67 hours.

The invention has the advantages that: through genetic engineering transformation, hexamethylenediamine is flexibly catalyzed and synthesized by double-way co-hosts, so that the catalytic resistance in a single synthesis way is weakened; the whole gene integration of the hexamethylenediamine synthesis way greatly omits complicated experimental steps and reduces the energy consumption; the recombinant strain obtained by the invention can be used for high-yield hexamethylenediamine engineering strain, and has obvious advantages in a specific experiment that the hexamethylenediamine yield is up to 10.58g/L.

Drawings

FIG. 1 is a pET28a-OXLeuABCD plasmid map.

FIG. 2 is a LeuA, leuB, leuC, leuD gene electrophoresis pattern, wherein A is a LeuA, leuB, leuC gene electrophoresis pattern; b is a Le uD gene electrophoresis pattern.

FIG. 3 is a pET21a-ATLC plasmid map.

FIG. 4 is a diagram of Vfl, lysOX, ddc, kdcA gene electrophoresis.

FIG. 5 is a diagram of Dat gene electrophoresis.

FIG. 6 is a schematic diagram of a two-way co-host flexible catalytic synthesis of hexamethylenediamine.

FIG. 7 is a graph of glucose supplementation time versus glucose consumption.

FIG. 8 is a fermentation production of hexamethylenediamine by high yielding strain WD-HMD.

Fig. 9 is a qualitative identification of hexamethylenediamine UPLC.

Detailed Description

The present invention will be further described in detail by way of examples, and it should be understood that the specific embodiments described herein are merely illustrative of and not limiting on the present invention, and that modifications and substitutions may be made in the details and form of the technical solution of the present invention without departing from the spirit and scope of the invention, as will be understood by those skilled in the art, but these modifications and substitutions fall within the scope of the present invention.

EXAMPLE 1 construction of recombinant plasmid pET28a-OXLeuABCD

The embodiment provides a recombinant plasmid capable of assisting in synthesizing hexamethylenediamine, the recombinant plasmid is named as pET28a-OXLeuABCD, the total of the recombinant plasmid is 11758bp, the recombinant plasmid comprises a LysOX gene (1488 bp), a LeuA gene (1572 bp), a LeuB gene (1092 bp), a LeuC gene (1401 bp) and a LeuD gene (606 bp), the recombinant plasmid is assembled on a pET-28a carrier with a kanamycin resistance marker in a seamless cloning mode, and the map of the recombinant plasmid pET28a-OXLeuABCD is shown in figure 1. The electrophoresis patterns of the LeuA gene, the LeuB gene, the LeuC gene, the Leu D gene and the LysOX gene are shown in FIG. 2.

Specifically, the nucleotide sequence of the LysOX gene is shown in SEQ ID NO: 1.

Specifically, the nucleotide sequence of the LeuA gene is shown in SEQ ID NO: 2.

Specifically, the nucleotide sequence of the LeuB gene is shown in SEQ ID NO: 3.

Specifically, the nucleotide sequence of the LeuC gene is shown in SEQ ID NO: 4.

Specifically, the nucleotide sequence of the LeuD gene is shown in SEQ ID NO: shown at 5.

Artificially synthesizing LysOX genes, designing homology arms of the LysOX by using a PCR method, and designing primers as follows:

LysOX-F:TGACTTGCTGGCTCATCTCCTTTTACAGTTCGTCCTTGG

LysOX-R:TAACTTTAAGAAGGAGATATACCATGGAGCACCTGGCAGACTGTCTG。

using Escherichia coli MG1655 (DE 3) as a template, amplifying and modifying LeuA genes, leuB genes, leuC genes and LeuD genes, and simultaneously adding respective homologous arm fragments, wherein the primer design is as follows:

LeuA-F:CTTCGACATCTCCTTTCACACGGTTTCCTTGTTGTTTTC

LeuA-R:GTAAAAGGAGATGAGCCAGCAAGTCATTATTTTCG

LeuB-F:GTCTTAGCCATCTCCTTTTACACCCCTTCTGCTAC

LeuB-R:CAAGGAAACCGTGTGAAAGGAGATGTCGAAGAATTACC

LeuC-F:CTCTGCCATCTCCTTTTATTTAATGTTGCGAATGTC

LeuC-R:GAAGGGGTGTAAAAGGAGATGGCTAAGACGTTATACG

LeuD-F:TCTCAGTGGTGGTGGTGGTGGTGTTAATTCATAAACGCAGGTTG

LeuD-R:CATTAAATAAAAGGAGATGGCAGAGAAATTTATCAAAC。

the pET28a plasmid is used as a template, a vector fragment is obtained through amplification, and the primer design is as follows:

pET28a-F:GGTATATCTCCTTCTTAAAGTTAAACAAAAT

pET28a-R:TGAGATCCGGCTGCTAAC

amplification of the fragment of interest was performed using Prime star Max Premix (2X), with the 40uL system configured as follows:

the PCR parameters were set as follows:

using the Norwegian cloning kitMultiS One Step Cloning Kit) the assembly of the multiple fragments is carried out at 37 ℃ for 30min, thereby completing the connection of the target gene and the vector, and obtaining the recombinant plasmid pET28a-OXLeuABCD, wherein a 10uL system is configured as follows:

EXAMPLE 2 construction of recombinant plasmid pET21a-ATLC

The embodiment provides a recombinant plasmid capable of assisting in synthesizing hexamethylenediamine, the recombinant plasmid is named as pET21a-ATLC, 10582bp of the recombinant plasmid comprises KdcA gene (1831 bp), dat gene (849 bp), ddc gene (1443 bp) and Vfl gene (1365 bp), and the recombinant plasmid is assembled on a pET-21a carrier with an ampicillin resistance marker in a seamless cloning mode, and a plasmid map is shown in figure 3. The Kd cA gene, the Ddc gene and the Vfl gene are shown in FIG. 4, and the Dat gene is shown in FIG. 5.

Specifically, the nucleotide sequence of the KdcA gene is shown in SEQ ID NO: shown at 6.

Specifically, the nucleotide sequence of the Dat gene is shown in SEQ ID NO: shown at 7.

Specifically, the nucleotide sequence of the Ddc gene is shown as SEQ ID NO: shown at 8.

Specifically, the nucleotide sequence of the Vfl gene is shown in SEQ ID NO: shown at 9.

Artificially synthesizing KdcA gene, dat gene, ddc gene and Vfl gene, designing corresponding homology arms by using a PCR method, and designing primers as follows:

KdcA-F:ATTTTGTTTAACTTTAAGAAGGAGATATACATATGTTTAAATAAGTC

KdcA-R:CATCTCCTTAAAAACATTAGGAAAATCCTAATGTTTTTAC

Dat-F:CTAATGTTTTTAAGGAGATGTCTCCGCGGTGTAAAACAG

Dat-R:GCATCTCCTTGTTTGGTGATGGTGTATATGAAGTAGTTCG

Ddc-F:TCATCTCCTTTCATTCTTTCTCTGCCCTC

Ddc-R:CTAGAAATAATAAGGAGTATACATATGGATTCCCGTGAATTC

Vfl-F:CACCAAACAAGGAGATGCTAGAGTTTTCTTTAGTCATAATTC

Vfl-R:AATGAAAGGAGATGAATAAACCCCAATCATGG。

the pET21a plasmid is used as a template, a vector fragment is obtained through amplification, and the primer design is as follows:

pET21a-F:CACCACCACCACCACCACTGAGATC

pET21a-R:ATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTC。

the construction method of the recombinant plasmid pET21a-ATLC is described in example 1.

EXAMPLE 3 construction of Strain WD-HMD

The recombinant plasmid pET28a-OXLeuABCD and the recombinant plasmid pET21a-ATLC are transferred into BL21 (DE 3) strain, and the specific operation is as follows:

(1) DH5 alpha competent cells were placed on ice, 2uL of recombinant plasmid pET28a-OXLeuABCD and 2uL of recombinant plasmid pET21a-ATLC were extracted from the competent cells, respectively, and were left standing on ice for 30min, placed in a water bath at 42℃for 30sec, ice-bathed for 2min, added with LB medium 1mL, placed in a shaker with parameters set at 37℃and 200rpm. Samples were removed, centrifuged, and centrifuge parameters were set at 7000rpm,1min. Most of the supernatant was discarded, and the remaining 50uL was resuspended by pipetting, and the bacterial liquid transformed into pET28a-OXLeuABCD was spread on a solid LB plate containing 50. Mu.g/uL kanamycin, and the bacterial liquid transformed into pET21a-ATLC recombinant plasmid was spread on a solid LB plate containing 50. Mu.g/uL ampicillin.

(2) Single colonies transferred into pET28a-OXLeuABCD were picked for verification, the set of verification bands should be 6782bp in size, and the sequence of the verification primers is as follows:

ABCD-YZ-LF：ATGTCGGCGATATAGGCGCC

ABCD-YZ-LR：GCAGCCAACTCAGCTTCCTTT。

single colonies transferred into pET21a-ATLC were picked for verification, the size of the verification band of the group was 5516bp, and the sequence of the verification primer was as follows:

DTLC-YZ-LF：TCATGAGCCCGAAGTGGCGA

DTLC-YZ-LR：CAGCAGCCAACTCAGCTTCC。

sequencing and verifying two groups of colonies with correct verification, extracting corresponding plasmids after verifying the colonies are correct, transferring the two plasmids into BL21 (DE 3) competent cells simultaneously, performing transformation operation in the same way as (1), finally coating a resuspension bacterial liquid on an LB solid plate containing kanamycin and ampicillin simultaneously, and culturing in an incubator for 16 hours, wherein the parameters of the incubator are set to be 37 ℃. Thus, a double plasmid expression strain WD-HMD was obtained.

EXAMPLE 4 biosynthesis of hexamethylenediamine

In this example, the constructed WD-HMD strain was subjected to induced expression fermentation, and hexamethylenediamine was synthesized using L-lysine as a fermentation substrate and alanine and glutamine as amine donors, with the synthesis route shown in FIG. 6.

(1) Culture medium configuration

LB medium was used for tube and shake flask culture, and the 1L medium was prepared as follows:

5.0g of yeast extract powder, 10.0g of peptone and 10.0g of sodium chloride are weighed, distilled water is used for constant volume to 1L, and the yeast extract powder is used after being sterilized and cooled by high-pressure steam, and the parameters of a sterilizing instrument are set to 121 ℃ for 20min.

The preparation method of the fermentation medium and 1L of the medium is as follows:

25.0g of glucose, 2.0g of yeast extract, 1.0g of magnesium sulfate heptahydrate, 1.0g of potassium dihydrogen phosphate, 5.0g of L-lysine, 2.0g of alanine and 2.0g of glutamine are weighed, sterilized and cooled by high-pressure steam, and the parameters of a sterilizing instrument are set to 115 ℃ for 30min.

(2) Seed liquid preparation

Draw WD-HMD frozen bacteria and streak on solid double-antibody plate containing 50 mug/mL kanamycin and 50 mug/mL ampicillin, and place in incubator for 16h cultureIncubator parameters were set to 37 ℃. Picking single colony, culturing in 5mL double-antibody LB liquid culture medium for 16h, sucking bacterial liquid according to 2% inoculum size, transferring into shake flask containing fermentation culture medium, culturing, shake culturing at 32deg.C and 220rpm until bacterial liquid OD ₆₀₀ =0.8, seed liquid preparation was completed.

(3) Fermentation tank culture

The addition mode of the optimal feed medium is determined by carrying out small test process study on hexamethylenediamine synthesis of the strain WD-HMD in a 3L fermentation tank. The liquid amount of the fermentation tank is 2L, the pH value of the sodium hydroxide solution is regulated to be between 6.8 and 7.5, and the substrate and amine donor feeding operation is carried out for 20h, 36h and 56h, so that the concentrations of L-lysine, alanine and glutamine are respectively maintained at about 2.5g/L, 1.0g/L and 1.0 g/L. In the fermentation process, the dissolved oxygen is controlled to be 30-35%, the initial rotating speed is set to be 300rpm, then the rotating speed is converted into the rotating speed for coupling the dissolved oxygen, and when the glucose has obvious descending trend, the glucose is supplemented, so that the glucose concentration is maintained to be 5.5-7.5 g/L, and the glucose consumption curve and the glucose supplementing time are shown in figure 7.

(4) UPLC detection method of hexamethylenediamine

Liquid chromatography-Mass Spectrometry analysis Using a Dionex Ultimate 3000UPLC system, HESI-II probes (Thermo Scientif ic) were equipped. The chromatographic column model is Hypersil Gold C18 (50 mm multiplied by 2.1mm, particle size 1.9 μm, chromatographic column temperature is set to 40 ℃ C. A phase is 0.1% formic acid aqueous solution, B phase is 0.1% formic acid methanol solution, flow rate is 0.2ml/min, sample injection amount is 10 mu L, flow gradient is 0-1.5min:100% A, 1.5-7.0min:0% A,100% B, 10-11 min:100% A,0% B, 11.0-15.0 min:100% A. Data collection is completed in positive ionization mode.

The corresponding hexamethylenediamine yields were examined in different combinations of sugar supplementation times, and the examination results are shown in table 1. When the fermentation time is 28h, 48h and 64h, sugar is supplemented, and the maximum yield of hexamethylenediamine is 10.58g/L. The hexamethylenediamine yield over time is shown in FIG. 8. Qualitative identification of the product hexamethylenediamine UPLC is shown in FIG. 9.

TABLE 1 production of corresponding hexamethylenediamine in different combinations of sugar-supplementing times

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Claims

1. A recombinant plasmid or a plasmid combination capable of assisting in producing hexamethylenediamine is characterized in that a LysOX gene, a 2-isopropyl malate synthase LeuA gene, a 3-isopropyl malate dehydrogenase LeuB gene, a 3-isopropyl malate dehydratase gene LeuC and a 3-isopropyl malate dehydratase LeuD gene; and the aromatic-L-amino acid decarboxylase Ddc gene, the pyruvate transaminase Vfl gene, the alanine transaminase Dat gene and the branched-chain alpha-keto acid decarboxylase KdcA gene are constructed on one recombinant plasmid, or two, three, four, five, six, seven, eight or nine recombinant plasmids are respectively constructed to form a plasmid combination;

2. The recombinant plasmid or plasmid combination according to claim 1, wherein the nucleotide sequence of LysOX gene is shown in SEQ ID No. 1, the nucleotide sequence of LeuA gene is shown in SEQ ID No. 2, the nucleotide sequence of LeuB gene is shown in SEQ ID No. 3, the nucleotide sequence of LeuC gene is shown in SEQ ID No. 4, and the nucleotide sequence of LeuD gene is shown in SEQ ID No. 5; the nucleotide sequence of the Vfl gene is shown as SEQ ID NO. 9, the nucleotide sequence of the Dat gene is shown as SEQ ID NO. 7, and the nucleotide sequence of the KdcA gene is shown as SEQ ID NO. 6.

3. Recombinant plasmid or combination of plasmids according to claim 1, characterized in that LysOX gene, isopropyl 2-malate synthase LeuA gene, 3-isopropyl malate dehydrogenase LeuB gene, 3-isopropyl malate dehydratase gene LeuC and 3-isopropyl malate dehydratase LeuD gene are constructed on one plasmid, called first recombinant plasmid, preferably its starting plasmid pET28a; while the aromatic-L-amino acid decarboxylase Ddc gene, the pyruvate transaminase Vfl gene, the alanine transaminase Dat gene and the branched-chain alpha-keto acid decarboxylase KdcA gene are constructed on another recombinant plasmid, called a second recombinant plasmid, preferably its starting plasmid pET21a.

4. The method for constructing recombinant plasmids according to claim 3, wherein each gene is constructed on a starting plasmid by a seamless cloning technique to obtain a first recombinant plasmid and a second recombinant plasmid, preferably, the nucleotide sequence of the first recombinant plasmid is shown as SEQ ID NO. 10, and the nucleotide sequence of the second recombinant plasmid is shown as SEQ ID NO. 11.

5. A genetically engineered strain capable of producing hexamethylenediamine from L-lysine, characterized in that 9 genes of LysOX gene, 2-isopropyl malate synthase LeuA gene, 3-isopropyl malate dehydrogenase LeuB gene, 3-isopropyl malate dehydratase gene LeuC and 3-isopropyl malate dehydratase LeuD gene, aromatic-L-amino acid decarboxylase Ddc gene, pyruvate transaminase Vfl gene, alanine transaminase Dat gene and branched alpha-keto acid decarboxylase KdcA gene are simultaneously introduced into the genetically engineered strain;

6. The genetically engineered strain of claim 5, wherein the 9 genes are simultaneously constructed on one expression plasmid or respectively constructed on two expression plasmids, three expression plasmids, four expression plasmids, five expression plasmids, six expression plasmids, seven expression plasmids, eight expression plasmids or nine expression plasmids, and introduced into a starting strain to obtain a genetically engineered strain for producing hexamethylenediamine;

7. The genetically engineered strain of claim 6, wherein the starting strain of the genetically engineered strain is a prokaryotic bacterium, such as e.coli, pseudomonas aeruginosa, salmonella, and the like.

8. A method for producing hexamethylenediamine using the genetically engineered strain according to claim 5 or 6 or 7, characterized in that: fermenting the genetically engineered strain with L-lysine as a substrate to obtain hexamethylenediamine; optionally, a step of separating or purifying the obtained hexamethylenediamine is also included.

9. The method of claim 8, wherein the fermentation process is as follows:

the culture medium is LB liquid culture medium, the pH value of the culture medium is regulated to be 6.8-7.5 by sodium hydroxide solution, in the fermentation process, dissolved oxygen is controlled to be 30-35%, the fermentation temperature is 32 ℃, the initial rotating speed is set to be 300rpm, then the culture medium is converted into rotating speed coupling dissolved oxygen, and after the glucose has obvious descending trend, glucose supplementing is started, so that the glucose concentration is maintained to be 5.5-7.5 g/L.

10. The method according to claim 9, wherein the total amounts of L-lysine, amine donor alanine, amine donor glutamine and glucose added during fermentation are as follows:

(1) Total amount of L-lysine input: 10 g-120 g, the substrate L-lysine feeding time is respectively as follows: 16 h-21 h, 34 h-39 h, 52 h-57 h;

(2) Total amount of amine donor alanine input: 5g-75g, the feeding time of the amine donor alanine is respectively as follows: 16 h-21 h, 34 h-39 h, 52 h-57 h;

(3) Total amount of amine donor glutamine input: 5g-75g, the amine donor glutamine feed time is respectively: 16 h-21 h, 34 h-39 h, 52 h-57 h;

(4) Total amount of glucose input: 25 g-150 g, and glucose feeding time is respectively as follows: 27 h-32 h, 43-48 h, 62-67 h.