CN117530952A

CN117530952A - Animal model construction method for recovering telomere length during blastocyst stage transplantation and application

Info

Publication number: CN117530952A
Application number: CN202311324376.3A
Authority: CN
Inventors: 胡志斌; 顾亚云; 王铖; 江玥
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2023-07-19
Filing date: 2023-10-12
Publication date: 2024-02-09

Abstract

The present disclosure belongs to the technical field of animal model construction, and in particular relates to a construction method and an application of an animal model for recovering telomere length in blastocyst stage transplantation. Specifically, fertilized eggs of a non-human animal are obtained through in vitro fertilization, TERT mRNA solution is injected into the fertilized eggs, after the fertilized eggs are cultured in vitro to blastula stage, the obtained blastula stage embryos are implanted into a non-human female animal for pregnancy, and offspring are produced. The method does not need gene editing, has short molding cycle and reliable and stable effect; the effect of restoring the telomere length of the offspring can be achieved only by injecting mRNA (messenger ribonucleic acid) during in vitro fertilization to improve the expression level of the TERT gene, and the maternal reproduction rate is not obviously affected. Therefore, the invention can provide an animal model construction method and a research direction for researching a mechanism of telomere shortening and exploring an optimization scheme of a human clinical assisted reproduction technology.

Description

Animal model construction method for recovering telomere length during blastocyst stage transplantation and application

Technical Field

The present disclosure belongs to the technical field of animal model construction, and in particular relates to a construction method and an application of an animal model for recovering telomere length in blastocyst stage transplantation.

Background

With the annual rise of infertility rates, the use of assisted reproductive technology has grown rapidly worldwide. The assisted reproduction technology is divided into a cleavage stage transplanting strategy and a blastula stage transplanting strategy according to the embryo development period during embryo transplantation. The blastocyst stage transplantation strategy has higher live yield and is used clinically and gradually. However, the process of culturing blastomeres to blastocysts is in the critical window of Telomere extension, and studies have reported that both human and mouse novacells transplanted in blastocysts face the problem of shortening telomeres (Telomere). Telomeres are DNA-protein complexes located at the ends of chromosomes in eukaryotic cells that function to maintain genomic stability. As organisms age, telomeres continue to shorten during cell division due to terminal replication problems, and after telomeres shorten below a critical length, the structure of telomere complexes is destroyed, chromosome protection is weakened, cell cycle arrest pathways are activated, and cells gradually enter an aging state and cannot proliferate. A large number of group studies have found that telomere length is related to overall mortality and life expectancy of the group, and mouse model studies have found that mice with impaired telomere function develop a multisystem premature senility phenotype.

Although the length of telomeres is longer in the offspring of the blastogenesis stage compared with that of the offspring of the blastogenesis stage, the blastogenesis stage transplantation is not beneficial to screening embryos with good development conditions, the living yield is greatly reduced, and great psychological and economic pressures are brought to families treated by auxiliary reproductive technologies. On the other hand, the embryo in the cleavage stage is transplanted into uterus, which is unfavorable for the synchronization of the physiological conditions of the embryo and endometrium, and the risks of abnormal abortion and offspring development patterns are greatly increased.

Therefore, it is highly desirable to explore a telomere length recovery scheme aiming at blastocyst stage transplantation strategy, which has stable effect, simple operation and small risk, and provides clues and theoretical basis for optimizing auxiliary reproduction technical scheme in clinic. In addition, the related method for restoring the length of the transplanted telomeres in the blastula stage is discussed, and new clues and ideas are provided for researches on the aspects of telomere lengthening and shortening mechanisms, telomere biological functions, the relation between telomeres and aging and the like.

Disclosure of Invention

Aiming at the technical problems, the invention provides a construction method and application of an animal model for recovering telomere length in blastocyst stage transplantation, and the method is effective, reliable, simple and feasible and does not depend on a gene editing technology.

Telomere length generally shortens with age, but under the action of telomerase, embryos develop early with the biological process of telomere elongation. The invention discovers that up-regulating telomerase core component TERT will act to enhance telomerase activity. Based on the above, the invention tries to culture animal embryo in vitro to blastula stage after injecting TERT mRNA in fertilized egg stage, then transplant into mother body, and enhance telomere extension process under action of telomerase to recover telomere length of blastula stage transplanted animal.

For this purpose, the invention provides the following technical scheme:

use of TERT mRNA in the preparation of a product for restoring telomere length in an animal or human.

Alternatively, the restoring telomere length in an animal or human comprises restoring telomere length in a new offspring of an animal or human transplanted in a blastocyst stage.

Alternatively, the TERT mRNA concentration is 10 ng/. Mu.L to 50 ng/. Mu.L; preferably, 25 ng/. Mu.L;

optionally, the product is a medicament.

Alternatively, TERT mRNA is injected during fertilized egg periods.

A construction method of an animal model for recovering telomere length in blastocyst stage transplantation comprises the following steps:

obtaining fertilized eggs of non-human animals through in vitro fertilization, then injecting TERT mRNA solution into the fertilized eggs, culturing the fertilized eggs in vitro to a blastula stage, and implanting the obtained blastula stage embryos into non-human female animals and producing offspring.

Optionally, the concentration of the TERT mRNA solution is 10-50 ng/. Mu.L; preferably, the concentration of the TERT mRNA solution is 25 ng/. Mu.L;

and/or, the TERT mRNA injection tool employs a microinjection apparatus (brand: eppendorf, model: femtoJet 4 i)

And/or, the TERT mRNA solution is injected in an amount of 1-3pL per fertilized egg; preferably, the TERT mRNA solution is injected in an amount of 2pL per fertilized egg;

and/or, the blastula period refers to: 70 to 120 hours after fertilization; preferably 72±2 hours.

Optionally, the method comprises the following steps:

1) TERT mRNA was obtained and diluted to the desired concentration using nuclease-free water;

2) Obtaining sperm from a non-human male animal, contacting the sperm with a capacitation medium to obtain capacitation sperm;

3) Obtaining a cumulus-oocyte complex from a non-human female animal;

4) Contacting the obtained sperm in step 2) with a cumulus-oocyte complex in vitro to obtain fertilized eggs;

5) Microinjection of TERT mRNA from step 1) into fertilized eggs obtained in step 4);

6) Allowing the fertilized egg obtained in the step 5) to develop in vitro to a blastula stage;

7) Implanting the blastocyst-stage embryo into a non-human surrogate female and producing offspring;

optionally, the non-human animal is SPF grade;

The order of steps 2) and 3) may be interchanged or parallel.

Optionally, the non-human animal is a rodent;

optionally, the non-human animal is a mouse (Mus musculus);

alternatively, the mouse is selected from any one of the following strains: ICR, A/He, A/J, A/SnSf, A/WySN, AKR, AKR/A, AKR/J, AKR/N, BALB/C, B6SJLF1, B6C3F1, B6D2F1, C3H, C F1, C3Hf, C57BR, C57L, C57BL/A, C BL/An, C57BL/Grfa, C57BL/KaLwN, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10ScSn, C57BL/10Cr, C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, CBA/H, CB F1, CD2F1, CFW, DBA/1, DBA/2, FACA, FVB, KM, NIH, NIH (S), RF, SJL, SWR, TA, CBA/H, CB F1 or 129.

Alternatively, male mice are 8 to 20 weeks old; preferably, 8 to 12 weeks of age;

and/or, the female mouse is a adolescent female mouse, which is 3 to 12 weeks old; preferably, 4 to 5 weeks of age;

and/or, the surrogate mice are 6 to 10 weeks old; preferably, 8 weeks of age.

Optionally, in step 2):

contacting the sperm and capacitation medium at 35 ℃ to 38 ℃ for 0.5 to 1.5 hours at a carbon dioxide content of 4% -7%;

optionally, contacting the sperm and capacitation medium at 37 ℃ ± 1 ℃ with a carbon dioxide content of 5% for 1 hour;

Optionally, the capacitation medium comprises any one or combination of the following selected from: sodium, potassium, calcium, magnesium, glucose, beta-cyclodextrin or polyvinyl alcohol.

Optionally, in step 4):

contacting said capacitating sperm and said cumulus-oocyte complex in an in vitro fertilization medium at a temperature of 35 ℃ to 38 ℃ and a carbon dioxide content of 4% -7% for 4-10 hours; optionally, contacting in an in vitro fertilization medium for 5.5-6.5 hours;

optionally, contacting said capacitating sperm and said cumulus-oocyte complex in an in vitro fertilization medium at 37 ℃ ± 1 ℃ with a carbon dioxide content of 5% for 5.5-6.5 hours;

optionally, the in vitro fertilization medium comprises any one or a combination of the following selected from: reduced glutathione, electrolyte, carbon source or nitrogen source.

Optionally, in step 1):

obtaining a TERT gene coding sequence CDS, inserting the TERT coding sequence CDS into a plasmid vector, and carrying out in vitro transcription on the plasmid to obtain TERT gene mRNA;

alternatively, the TERT coding sequence CDS was inserted into pcdna3.1 plasmid vector using HindIII and EcoRI cleavage sites;

alternatively, mMESSAGE mMACHINE produced by Thermo Fisher corporation is used ^TM The T7 ULTRA kit performs in vitro transcription.

Optionally, in step 6):

contacting the fertilized egg with a cleavage culture medium at 35 ℃ to 38 ℃ and a carbon dioxide content of 4% -7% for 40 to 54 hours to obtain an embryo of 8 cell stage;

and (3) contacting the embryo of the 8 cell stage with a blastula culture medium for 20 to 28 hours at a temperature of 35 ℃ to 38 ℃ and a carbon dioxide content of 4% -7%, so as to obtain the embryo of the blastula stage.

Alternatively, contacting the fertilized egg with a cleavage culture medium at 37 ℃ ± 1 ℃ at a carbon dioxide content of 5% for 48±2 hours to obtain an embryo of 8-cell phase;

the embryo of the 8-cell stage and the blastocyst culture medium are contacted for 24.+ -. 2 hours at 37.+ -. 1 ℃ and a carbon dioxide content of 5%, to obtain an embryo of the blastocyst stage.

Alternatively, the telomere length in the tissue of the animal model is statistically significantly longer compared to a negative control non-human animal; the tissue of the animal model has statistically no significant difference or significantly longer telomere length than the positive control non-human animal;

optionally, the tissue is selected from any one or a combination of the following: peripheral blood, heart, liver or brain;

optionally, the negative control non-human animal, the positive control non-human animal, and the animal model are the same strain;

Alternatively, the negative control non-human animal refers to the offspring produced by implanting the embryo into the non-human surrogate female animal at the blastocyst stage after injecting sterile water into the fertilized egg; the positive control non-human animal refers to offspring produced by implanting embryos into non-human female animals for pregnancy before blastocyst period after injecting sterile water into fertilized eggs;

more optionally, the positive control non-human animal refers to offspring produced by implanting embryos into non-human surrogate females during the cleavage phase after injection of sterile water into the fertilized eggs.

An animal model for recovering telomere length in blastocyst stage transplantation, which is constructed by the construction method.

Use of said animal model for recovering telomere length in blastocyst stage transplantation in telomere research or aging research.

The use of the animal model for recovering telomere length in blastocyst stage transplantation in human clinical assisted reproduction technology operation method optimization related research.

Preferably, the mice are SPF-class mice of each strain (e.g., ICR strain mice).

As one preferred option, sperm is added to a conventional commercial sperm capacitation solution (e.g., TYH sperm capacitation solution, manufacturer: aibei organism, cat# M2050) prior to fertilization for 1 hour to allow sperm to capacitation at a temperature of 37.+ -. 1 ℃, carbon dioxide content of 4% -7%, preferably 37 ℃, carbon dioxide content of 5%.

As a preferred option, cumulus-oocyte complex COCs are introduced into conventional commercial fertilization fluid droplets (e.g., HTF seminal fluid, manufacturer: aibei organism, cat# M1150) prior to fertilization, and placed in an incubator at a temperature of 37.+ -. 1 ℃ and a carbon dioxide content of 4% -7%, preferably at a temperature of 37 ℃ and a carbon dioxide content of 5%.

Preferably, the in vitro fertilization method comprises intracytoplasmic sperm injection (ICSI)/in vitro fertilization technology (InVitroFertilization, IVF).

Preferably, 1-3. Mu.l of sperm suspension is aspirated from the outer edge of the sperm capacitation droplet and injected into the fertilized droplet containing COCs, and the in vitro fertilization dish is placed in an incubator for culture.

As one preferred option, after obtaining the fertilized egg, the fertilized egg is injected with TERT mRNA at a dose of 25 ng/. Mu.L.

Preferably, the TERT CDS is inserted into the pcDNA3.1 plasmid vector via HindIII and EcoRI cleavage sites, using mMESSAGE mMACHINE from Thermo Fisher Corp ^TM The T7 ULTRA kit (cat# AM 1345) was transcribed in vitro to obtain the TERT mRNA.

As a preferred example, fertilized eggs injected with mRNA are cultured in vitro to blastocyst stage under conditions including a conventional commercial blastocyst culture solution (e.g., blastomere culture solution, manufacturer: cook, cat# K-SICM-20, used for fertilized eggs to eight-cell stage embryos), a conventional commercial blastocyst culture solution (e.g., blastocyst culture solution, manufacturer: cook, cat# K-SIBM-20, used for eight-cell stage embryos to blastocysts) at 37.+ -. 1 ℃ and a carbon dioxide content of 4% -7%, preferably at 37 ℃ and a carbon dioxide content of 5%.

Preferably, the in vitro culture to blastocyst stage is about 3-4 days in vitro.

As one embodiment, a method of manipulating the telomere length of a assisted reproduction mouse for recovery of blastocyst stage transplants, comprising the steps of:

(1) Preparation of TERT mRNA: TERT gene coding sequences (CDSs) were downloaded on NCBI website (https:// www.ncbi.nlm.nih.gov /), inserted into pcDNA3 1 plasmid vector via HindIII and EcoRI cleavage sites, using conventional commercial in vitro transcription kits (e.g., mMESSAGE mMACHINE ^TM T7 ULTRA kit, manufacturer: thermo Fisher, cat: AM 1345) in vitro transcription of the plasmid to obtain TERT gene mRNA. The solution was diluted to 25 ng/. Mu.L with nuclease-free water for use.

(2) Sperm preparation: the pasty sperm is picked up into another sperm capacitation liquid droplet, and the sperm capacitation vessel is placed into an incubator for culturing for 1 hour to capacitation the sperm.

(3) Preparation of ovum: cumulus-oocyte complexes (COCs) released in mineral oil were taken. COCs were introduced into 100. Mu.l droplets of fertilized liquid using ophthalmic forceps and placed in an incubator, waiting for sperm capacitation at 37℃and carbon dioxide content of 5%.

(4) In vitro fertilization: 1-3 μl of sperm suspension is aspirated from the outer edge of the sperm capacitation droplet and injected into the fertilized droplet containing COCs. The in vitro fertilization dish is placed into an incubator for culture, the in vitro fertilization time is about 6 hours, and the culture condition is that the temperature is 37 ℃ and the carbon dioxide content is 5%.

(5) TERT mRNA injection: after 6 hours of in vitro fertilization, the fertilized eggs were washed three times with in vitro sperm, the male and female prokaryotes were observed after washing, the unfertilized eggs were removed, and a spare 25 ng/. Mu.L TERT mRNA was injected into the fertilized eggs using a microinjector (brand: eppendorf, model: femtoJet 4 i) at a dose of 2pL.

(6) Embryo culture and transplantation: pseudopregnant female mice are prepared during in vitro fertilization. A split embryo culture dish was prepared, 100. Mu.l of a conventional commercial split embryo culture solution (e.g., split culture solution, manufacturer: cook, cat. Number: K-SICM-20) was covered with mineral oil and placed in an incubator for equilibration for 6 hours in advance. Transferring fertilized ovum injected with mRNA into a split embryo culture solution, and placing a split embryo culture dish into an incubator for culturing at 37 ℃ under the condition of carbon dioxide content of 5%. After about 24 hours of culturing, the embryo state is observed, the development-blocked embryo is removed, after the embryo with normal development to 2-cell stage is kept for about 24 hours of continuous culturing, a blastocyst culture dish is prepared, 100 mu l of conventional commercial blastocyst culture solution (for example, blastocyst culture solution, manufacturer: cook, cat# K-SIBM-20) is covered with mineral oil, the mixture is put into an incubator in advance for balancing for 6 hours, the embryo development condition is observed, the development-blocked embryo is removed, and the embryo with normal development to 8-cell stage is selected and transferred into the blastocyst culture solution, and then put into the incubator. After culturing for about 24 hours, observing embryo development condition, removing development retardation embryo, selecting embryo from normal development to blastocyst stage, transplanting into uterus of female mice, transplanting 15 blastocysts into each female mouse, and raising single female mouse until delivery to obtain offspring, namely the animal model.

The present invention does not protect the method of obtaining sperm and ovum from mice. Only protecting the modeling method of mice which are obtained by injecting TERT mRNA into fertilized eggs obtained by in vitro fertilization, culturing to blastula, transplanting into the body of a surrogate mother and carrying out development and output telomere recovery.

After the birth of the surrogate female mice, the relative telomere length detection is carried out on the peripheral blood, heart, liver and brain tissues of the mice on the first day after birth, and the result shows that the telomere length of the mice in each tissue is obviously recovered. According to the construction method disclosed by the invention, the telomere length of the blastocyst stage transplanted mice can be successfully recovered.

The technical scheme of the invention has the following advantages:

(1) The animal model for recovering telomere length in blastocyst stage transplantation has the advantages of simple construction method, short modeling period, no need of gene editing, and no obvious influence on parent reproduction rate due to the enhancement of telomere length recovery caused by the telomere extension process under the action of telomerase by injecting TERT mRNA in fertilized ovum stage. Therefore, the invention provides an important animal model construction method for exploring telomere-related phenotypes such as telomere recovery mechanism, aging and the like.

Furthermore, the animal model telomere recovery effect constructed by the invention is stable and reliable, and the telomere length of peripheral blood, liver, brain and heart tissues of the constructed animal model is obviously recovered.

Furthermore, the animal model constructed by the invention can be used for related research of human assisted reproduction operation optimization schemes.

Drawings

FIG. 1 is a schematic diagram of the operation flow of the method for constructing an animal model for recovering telomere length in blastocyst stage transplantation;

FIG. 2 is a graph showing the comparison of telomere length of peripheral blood of postnatal day 1 short telomere mice and control mice provided in examples 2 and 3 of the present invention;

FIG. 3 is a graph showing comparison of telomere length of liver tissue of short telomere mice and control mice on postnatal day 1 provided in examples 2 and 3 of the present invention;

FIG. 4 is a graph showing the comparison of telomere length of brain tissue of short telomere mice on postnatal day 1 and control mice provided in examples 2 and 3 of the present invention;

FIG. 5 is a graph showing the comparison of telomere length of heart tissue of short telomere mice on postnatal day 1 and control mice provided in examples 2 and 3 of the present invention;

FIG. 6 is a graph showing comparison of telomere length of peripheral blood of postnatal day 1 short telomere mice and control mice provided in examples 5 and 6 of the present invention;

FIG. 7 is a graph showing comparison of telomere length of liver tissue of short telomere mice and control mice on postnatal day 1 provided in examples 5 and 6 of the present invention;

FIG. 8 is a graph showing the comparison of telomere length of brain tissue of short telomere mice on postnatal day 1 and control mice provided in examples 5 and 6 of the present invention;

FIG. 9 is a graph showing the comparison of telomere length of heart tissue of short telomere mice on postnatal day 1 and control mice provided in examples 5 and 6 of the present invention;

FIG. 10 is a graph showing the comparison of telomere length of peripheral blood of postnatal day 1 short telomere mice and control mice provided in examples 8 and 9 of the present invention;

FIG. 11 is a graph showing comparison of telomere length of liver tissue of short telomere mice on postnatal day 1 and control mice provided in examples 8 and 9 of the present invention;

FIG. 12 is a graph showing the comparison of telomere length of brain tissue of short telomere mice on postnatal day 1 and control mice provided in examples 8 and 9 of the present invention;

fig. 13 is a graph showing comparison of telomere length of heart tissue of short telomere mice and control mice on postnatal day 1 provided in examples 8 and 9 of the present invention.

Detailed Description

The following examples are provided for a better understanding of the present invention and are not limited to the preferred embodiments described herein, but are not intended to limit the scope of the invention, any product which is the same or similar to the present invention, whether in light of the present teachings or in combination with other prior art features, falls within the scope of the present invention.

The specific experimental procedures or conditions are not noted in the examples and may be followed by the operations or conditions of conventional experimental procedures described in the literature in this field. The reagents or apparatus used were conventional reagent products commercially available without the manufacturer's knowledge.

Animal models refer to non-human animals with simulated manifestations of human diseases established in various medical, scientific, research.

According to some embodiments of the present disclosure, an animal model for blastocyst stage graft recovery telomere length is provided.

Telomeres are a segment of DNA protein complexes at the end of the chromosome of eukaryotic cells. One of the roles of telomeres is to protect the ends of chromosomes from fusion and to maintain genomic stability. Telomeres lose a portion of their length after each cell division cycle due to end replication problems, so that they shorten to a certain limit and lose their protective genomic function, causing the cells to enter a cell cycle arrest state. Thus, severely shortened telomeres are one of the signals of cell aging. Telomere length is an important factor in the health of the population, and is related to the overall mortality and life expectancy of the population. Under the action of telomerase, RNA is used as a template to synthesize and prolong telomeres, and the activity of telomerase is regulated and controlled by the core component TERT.

Telomere recovery refers to: the length of telomeres of whole body multi-tissues (containing peripheral blood, liver, brain, heart, etc.) of offspring animals (such as mice) born by the manipulation of the method disclosed in the present invention is not different from or longer than those of offspring animals transplanted in the cleavage stage (such as mice), and the difference is statistically significant (P-value < 0.05) compared to those of offspring animals transplanted in the blastocyst stage but not injected with TERT mRNA (such as mice).

The research of the invention finds that: the telomere synthesis capacity of telomerase can be enhanced by injecting TERT mRNA in the fertilized egg period, the fertilized egg injected with the TERT mRNA is cultured in vitro to the blastula period, and then transplanted into a mother body to be born, and the telomere length of a newborn offspring animal (such as a mouse) is recovered.

According to some embodiments of the present disclosure, there is provided a method of constructing an animal model for blastocyst stage graft recovery telomere length, comprising the steps of: injecting TERT mRNA into fertilized eggs, culturing fertilized eggs in vitro to blasts, implanting blasts into non-human female animals and producing offspring.

In the present invention, TERT mRNA refers to telomerase reverse transcriptase mRNA at an injection dose of 10 ng/. Mu.L to 50 ng/. Mu.L, preferably 25 ng/. Mu.L.

In the present invention, blastula refers to: 70 to 120 hours (e.g., 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 hours) after fertilization, preferably 72±2 hours; embryos in blastocyst stage are required to develop well, with morphology visible as intact inner cell mass and extraembryonic trophoblasts.

In the present invention, "post-fertilized" means from the time of obtaining fertilized eggs (not from the time of contacting sperm and COCs).

In all embodiments, the methods disclosed herein do not involve any step of engineering mouse chromosomal or mitochondrial genetic material, such as, but not limited to: gene mutation, gene editing, gene knockout, mutagenesis.

In some embodiments, the mouse is referred to as a mus. The strain of the mice is not particularly limited in the scheme of the present invention as long as it belongs to the SPF class.

SPF class (Specific Pathogen Free) refers to animals that do not carry a particular pathogen. SPF-class animals can ensure that no specific disease interferes with the test results; for example, in studying the effect of drugs against aging, animals do not carry pathogens that affect animal survival.

As one example, mice useful in constructing a mouse model are selected from any of the following strains: A/He, A/J, A/Snsf, A/WySN, AKR, AKR/A, AKR/J, AKR/N, BALB/C, B6 SJFF 1, B6C3F1, B6D2F1, C3H, C He, C3Hf, C57BR, C57L, C57BL/A, C BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6J, C BL/6ByJ, C57BL/6NJ, C57BL/10ScSn, C57BL/10Cr, C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, CBA/H, CB F1, CD2F1, CFW, DBA/1, DBA/2, FACA, FVB, ICR, KM, NIH, NIH (S), RF, SJL, SWR, TA1, TA2, 129.

In some embodiments, a method of constructing an animal model for blastocyst stage graft recovery telomere length, comprising the steps of:

1) TERT mRNA was obtained and diluted to a concentration of 25ng/μl using nuclease-free water;

2) Obtaining sperm from a male mouse, contacting the sperm with a capacitation medium to obtain capacitation sperm;

3) Obtaining a cumulus-oocyte complex from a female mouse, contacting the cumulus-oocyte complex with an in vitro fertilization medium;

4) Contacting the obtained capacitation sperm in step 2) with the cumulus-oocyte complex obtained in step 3) in vitro to obtain fertilized eggs;

5) Injecting the TERT mRNA obtained in the step 1) into the fertilized eggs obtained in the step 4);

6) Culturing the fertilized egg injected with TERT mRNA in vitro to a blastula stage;

7) Implanting the embryo of the blastula period into a surrogate female mouse;

8) The surrogate female mice produce the telomere length recovery mouse model;

the mice are SPF grade;

the order of steps 2) and 3) may be interchanged or parallel.

In some embodiments, TERT mRNA may be obtained freshly or stored.

In some embodiments, sperm obtained from male mice may be obtained freshly or stored.

In some embodiments, sperm obtained from a male mouse are freshly obtained and the sperm are contacted with a capacitation medium.

In some embodiments, when sperm obtained from a male mouse is frozen, extracellular matrix protein may be added to the thawed or quenched stored sperm sample, and the IVF operator may conveniently wash the thawed sperm, concentrate the sperm by centrifugation, and then re-suspend the sperm in a capacitation medium.

In some embodiments, the male mice are 8 to 20 weeks old (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20). In some specific embodiments, the male mice (e.g., ICR) are 8 to 12 weeks old. The skilled person knows that as the strain changes, the skilled person is able to determine an equivalent week. In the methods disclosed herein, the inventors found that the conservation between mice of each strain was high, and that other strains of mice could be adapted to the same week of age as ICR mice.

In vitro transcription

Telomerase's ability to lengthen telomeres is limited by its core component TERT, while TERT gene expression is strictly regulated by cells. If exogenous TERT mRNA is introduced into the cell, more TERT proteins are translated in the cell, so that the biological function is exerted, and the capacity of the telomerase to prolong the telomere fragments is enhanced. The availability of exogenous TERT mRNA is available in the art, such as, but not limited to, in vitro transcription, which usually occurs in vivo, but if we use conditions such as RNA transcriptases, NTPs, etc., in an in vitro cell-free system, RNA can also be produced by mimicking in vivo transcription processes using DNA as a template, such techniques being capable of controlling the gene transcribed, the process of transcription, and the use of post-transcriptional mRNA, referred to as in vitro transcription. Specific procedures were performed by downloading the TERT gene coding sequence (CDS) on the NCBI website (https:// www.ncbi.nlm.nih.gov /), inserting the TERT CDS into the pcDNA3 1 plasmid vector via HindIII and EcoRI cleavage sites, using conventional commercial in vitro transcription kits (e.g., mMESSAGE mMACHINE) ^TM T7 ULTRA kit, manufacturer: thermo Fisher, cat: AM 1345) in vitro transcription of the plasmid to obtain TERT gene mRNA.

Energy capture

Although freshly obtained sperm is morphologically mature, mobile, it cannot fertilize; sperm must first undergo a process of maturation known as "capacitation" (Austin et al The capacitation of the mammalian spimm. Nature,170:326 (1952); chang et al Fertilizing capacity of spermatozoa deposited into the fallopian tubes. Nature,168:697-8 (1951)).

Principles of capacitating sperm are available in the prior art, such as, but not limited to, subjecting sperm to sterol outflow (Travis et al The role of cholesterol efflux in regulating the fertilization potential of mammalian spimatozoa. The Journal of Clinical Investigation,110:731-36 (2002)); for another example, cholesterol (and other lipids, such as gangliosides) constitute a micro-domain within the mouse sperm plasma membrane (Asano et al Biochemical characterization of membrane fractions in murine sperm: identification of three distinct sub-types of membrane rafts.j Cell physiol.,218:537-48 (2009)). For another example, in vitro fertilization of mice, the cleavage rate after fertilization was significantly increased when the GSH concentration was 300 mmol (the effect of GSH on in vitro fertilization of mouse egg cells for mature in vitro fertilization ", the university of northeast agriculture, 2008).

Methods, reagents, media for capacitating sperm are available in the prior art.

In a specific embodiment, the method, reagent, medium of capacitation is a reagent or medium in CN 1893968A. As an example, the capacitation medium comprises angiotensin II amide. As an alternative, peptides containing the tripeptide motif RGD (Arg-Gly-Asp) or the tetrapeptide RGDS (Arg-Gly-Asp-Ser) may be used as the capacitation medium. RGD can be combined with angiotensin II because RGD inhibits extracellular matrix protein binding, increases the efficiency of added angiotensin II in stimulating motility and thus increases capacitation.

In a specific embodiment, the capacitation medium comprises: sodium, potassium, calcium, magnesium, glucose, beta-cyclodextrin and polyvinyl alcohol. As a preferred example, the capacitation medium comprises: sodium chloride, potassium chloride, calcium chloride dihydrate, glucose, sodium pyruvate, magnesium sulfate heptahydrate, potassium dihydrogen phosphate, sodium bicarbonate, beta-cyclodextrin and polyvinyl alcohol.

In a specific embodiment, commercially available capacitation media such as, but not limited to, TYH sperm capacitation fluid (Aibei organism, cat# M2050) comprising: 119.37mMol/L NaCl,4.78mMol/L KCl,1.19mMol/L KH ₂ PO ₄ ，1.19mMol/LMgSO ₄ ·7H ₂ O,5.56mMol/L glucose, 1.7 1mMol/L CaCl ₂ ·2H ₂ O，25.07mMol/L NaHCO ₃ 0.5mMol/L sodium pyruvate, 0.025g/L gentamycin sulfate, 0.75mMol/L methyl-beta-cyclodextrin, 1g/L polyvinyl alcohol.

In one embodiment, the sperm is contacted with a capacitation medium to obtain a capacitation sperm.

In a specific embodiment, the sperm and capacitation medium are contacted under suitable culture conditions for a period of time (e.g., 0.5 to 2 hours, preferably 0.5 to 1.5 hours, such as, but not limited to, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0±10%, or a range between any two of the foregoing).

In the case of capacitation, the appropriate culture conditions may be recommended by the manufacturer of the capacitation medium, or the method disclosed in CN1893968A may be employed.

As a non-limiting example, suitable culture conditions for capacitation are temperatures (30 to 40, 35 to 38, preferably 37.+ -. 1 ℃); carbon dioxide content (3-10%, 4% -7%, preferably 5%).

Collection of cumulus oocyte complexes

The term "follicle" as used herein refers to an ovarian follicle which is the basic unit of female reproductive biology and consists of a generally spherical aggregate of cells found in the ovary. The follicle contains a single oocyte. The follicles begin to grow and develop regularly, and eventually ovulate, usually as single competent oocytes.

The term "oocyte" as used herein includes oocytes alone or in association with one or more other cells, such as oocytes as part of a cumulus oocyte complex.

The term "cumulus cell" as used herein refers to a cell in a developing ovarian follicle that is in direct proximity or very close proximity to an oocyte. Cumulus cells participate in providing some of the nutrition, energy and/or other requirements necessary for an oocyte to produce a usable embryo at fertilization.

The term "Cumulus Oocyte Complexes (COCs)" as used herein refers to at least one oocyte and at least one cumulus cell physically bound to each other. Typically, the oocytes are surrounded by a layer of closely packed cumulus cells, thereby forming a cumulus oocyte complex.

In the present disclosure, the ovum is provided in the form of a "cumulus oocyte complex".

In some embodiments, to collect pre-ovulatory COCs, dense COCs are collected from large sinus follicles after administration of chorionic gonadotrophin to pre-pubertal female mice (30-50 hours, e.g., 48 hours).

In some embodiments, the female mice are 3 to 12 weeks old (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). In some specific embodiments, the female mouse (e.g., ICR) is 4 to 5 weeks old. The skilled person knows that as the strain changes, the skilled person is able to determine an equivalent week.

In some embodiments, the collection and pretreatment of COCs may also employ methods known in the art, such as those disclosed in CN107208057 a.

IVF

IVF refers to the process of retrieving an oocyte from a female ovary and fertilising with the sperm in a laboratory procedure.

In some embodiments, the aforementioned capacitating sperm is contacted with a cumulus-oocyte complex in vitro to obtain a fertilized egg.

In some embodiments, the capacitating sperm and the cumulus-oocyte complex are contacted in an in vitro fertilization medium under appropriate culture conditions for 4-10 hours (e.g., 4, 5, 6, 7, 8, 9, 10, or a range between any two of the foregoing values, as one example 5.5-6.5 hours) to obtain fertilized eggs. As a non-limiting example, suitable culture conditions are temperature (30 to 40, 35 to 38, preferably 37.+ -. 1 ℃); carbon dioxide content (3-10%, 4% -7%, preferably 5%).

As an example, in vitro fertilization media suitable for use in the methods of the present disclosure are well known in the art, such as, but not limited to, the methods taught in CN 113817668A. The in vitro fertilization medium comprises any one or a combination of the following selected from: reduced glutathione, electrolyte, carbon source and nitrogen source. In an exemplary embodiment, the in vitro fertilization medium comprises any one or a combination of the following selected from: sodium, potassium, magnesium, calcium, glucose, bovine serum albumin, reduced glutathione (preferably reduced glutathione is included in the in vitro fertilization medium when frozen sperm is used).

In a specific embodiment, a commercially available in vitro fertilization medium may also be used, such as, but not limited to, HTF semen (abbe organism, cat# M1150), comprising: 119.37mMol/L NaCl,4.78mMol/L KCl,1.19mMol/L KH ₂ PO ₄ ，1.19mMol/LMgSO ₄ ·7H ₂ O,5.56mMol/L glucose, 1.71mMol/L CaCl ₂ ·2H ₂ O，25.07mMol/L NaHCO ₃ 0.5mMol/L sodium pyruvate, 0.025g/L gentamicin sulfate, 3.98 g/sodium lactate (60% syryp), 0.0002mMol/L phenol red.

Obtaining blastocyst-stage embryos

In some embodiments, the fertilized egg obtained as described above is allowed to develop in vitro to blastocyst stage.

Various criteria for the division of mouse embryo development are known in the art, for example the Theiler standard, which is widely used.

Blastocyst formation is the result of cleavage, and the split spheres form hollow globular embryos, called blastocysts. This period of the embryo is called blastocyst stage. Blastula stage is usually 70 to 120 hours after fertilization (no significant differences between lines). Determination criteria for blastula period: morphology was seen with intact inner cell mass and extra-embryonic trophoblasts.

In some embodiments, fertilized eggs and cleavage culture medium are contacted under appropriate conditions for 40 to 54 hours (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or a range between any two of the foregoing values; preferably 48.+ -. 2 hours) to obtain 8-cell stage embryos. As a non-limiting example, suitable culture conditions are temperature (30 to 40, 35 to 38, preferably 37.+ -. 1 ℃); carbon dioxide content (3-10%, 4% -7%, preferably 5%). As another non-limiting example, suitable culture conditions are those recommended by the manufacturer of the cleavage culture medium.

In some embodiments, the cleavage culture medium comprises any one or a combination of the following selected from: hyaluronic acid, human serum albumin, gentamicin, bicarbonate buffer system.

In some specific embodiments, commercially available cleavage culture media such as, but not limited to, cleavage embryo culture broth (Cook, cat# K-SICM-20) may also be used.

In other specific embodiments, commercially available cleavage culture media may also be used, for example comprising: alanine, alanylglutamine, asparagine, aspartic acid, calcium chloride, ethylenediamine tetraacetic acid, glucose, glutamic acid, glycine, hyaluronic acid, magnesium sulfate, penicillin, potassium chloride, proline, serine, sodium bicarbonate, sodium chloride, sodium dihydrogen phosphate, sodium lactate, sodium pyruvate, taurine, water for injection; pH value: 7.30.+ -. 0.10, osmotic pressure: 261 + -5 mOsm/kg.

In some embodiments, the embryo of the 8-cell stage and the blastocyst culture medium are contacted for 20 to 28 hours (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, or a range between any two of the foregoing values; preferably 24.+ -. 2 hours) under appropriate conditions to obtain an embryo of the blastocyst stage. As a non-limiting example, suitable culture conditions are temperature (30 to 40, 35 to 38, preferably 37.+ -. 1 ℃); carbon dioxide content (3-10%, 4% -7%, preferably 5%). As another non-limiting example, suitable culture conditions are recommended by the blastocyst culture medium manufacturer.

In some embodiments, the blastocyst culture medium comprises any one or a combination of the following selected from: hyaluronic acid, human serum albumin, gentamicin, bicarbonate buffer system.

In some specific embodiments, commercially available blastocyst culture media such as, but not limited to, blastocyst culture (Cook, cat# K-SIBM-20) may also be used.

In some specific embodiments, commercially available blastocyst culture media may also be used, for example, comprising: sodium chloride, potassium chloride, magnesium sulfate, potassium dihydrogen phosphate, magnesium chloride, sodium bicarbonate, sodium pyruvate, L-arginine HCl, L-lysine HCl, L-threonine, L-valine, L-leucine, L-phenylalanine, L-tryptophan, L-cystine 2HCl, L-histidine HCl H20, L-isoleucine, L-methionine, L-tyrosine, L-calcium lactate, D-glucose, alanyl glutamine, L-taurine, glycine, D-calcium pantothenate, gentamycin sulfate, human serum albumin, L-alanine, L-proline, L-serine, L-asparagine H2O, L-aspartic acid, L-glutamic acid, and purified water.

In some embodiments, during the period from fertilized eggs to blasts (e.g., but not limited to 2 cell stage, 4 cell stage, 8 cell stage), embryos are optionally inspected to remove outliers.

Implantation of embryos

In some embodiments, blastocyst-stage embryos are transplanted into the uterus of a surrogate mouse and allowed to incubate until short telomere mice are produced.

In some embodiments, blastocyst-stage embryos are transplanted into the uterus of a surrogate mouse at a ratio of 15 blastocysts per embryo.

In some embodiments, the surrogate mice are 6 to 10 weeks of age, preferably 8 weeks of age. In some specific embodiments, the surrogate mice (e.g., ICR) are 8 weeks old. The skilled person knows that as the strain changes, the skilled person is able to determine an equivalent week.

Telomere recovery mouse model

In some embodiments, a telomere recovery mouse model is provided, produced by the foregoing method.

In some embodiments, the telomere recovery mouse model has a statistically significantly longer or no difference in telomere length in tissue compared to positive control mice, and the telomere recovery mouse model has a statistically significantly longer telomere length in tissue compared to negative control mice.

In some embodiments, longer means that the telomere length is extended by at least 10% relative to a control without administration of the methods of the present disclosure, and may be mentioned but is not limited to 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a range between any two of the foregoing values.

In other embodiments, longer means that there is a statistically significant difference in the extent of elongation of telomere length relative to a control without administration of the methods of the present disclosure, with p set to, for example, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, or even lower. For example, based on a measurement of two individuals (or populations), a statistically significant difference between the two individuals (or populations) is considered when the resulting p-value is less than a particular p-value level. Specifically, there was a statistically significant difference in telomere length in the telomere recovery mouse model and the telomere length in the control mouse at a particular p-value level.

In some embodiments, telomere length is determined by methods well known in the art, such as, but not limited to, telomere end restriction fragment analysis (terminal restriction fragment, TRF), quantitative PCR (qPCR), quantitative fluorescence in situ hybridization (quantitative fluorescence in situ hybridization, Q-FISH), flow fluorescence in situ hybridization (Flow cytometry and Flow fluorescence in situ hybridization, flow FISH), single strand telomere length analysis (single telomere length analysis, stem), telomere length analysis based on whole genome sequencing; quantitative PCR is preferred.

In some embodiments, the telomeres are from any tissue selected from the group consisting of: peripheral blood, heart, liver, brain.

In some embodiments, the control mouse and the telomere recovery mouse are the same strain.

In some embodiments, the method of producing a positive control mouse differs from the method of constructing a mouse model of the present disclosure only in that: injecting enzyme-free water into fertilized eggs instead of TERT mRNA, and implanting embryos into surrogate female mice prior to blastocyst stage (e.g., cleavage stage). The method for producing negative control mice differs only in that: the fertilized eggs were injected with enzyme-free water instead of TERT mRNA.

Use of the same

According to some embodiments, there is provided the use of the telomere recovery mouse operating regimen of the present disclosure in telomere studies or aging studies.

According to other embodiments, there is provided the use of the telomere recovery mouse protocols of the present disclosure in clinical assisted reproductive technology optimization strategy-related studies.

It should be understood that the numbering of the preceding steps is not intended to limit the particular order of arrangement, but is merely used to distinguish between the different steps.

"optionally" means that the term followed by a feature or step may or may not be present.

It will be appreciated that when numerical ranges are referred to herein, for example, "a to B" is a concise manner of writing, and that integers and fractions within a range are deemed to have been explicitly disclosed herein, although each point value within that range is not given.

Example 1 construction method of telomere recovery mouse model

The operation flow of the animal model construction method for recovering telomere length in blastocyst stage transplantation provided in this embodiment is shown in fig. 1:

1. material preparation

TERT gene coding sequences (CDS) (ENSMUSG 00000021611: ENSMUST00000022104.9, specific sequence shown in SEQ ID NO. 5)) were downloaded on NCBI website (https:// www.ncbi.nlm.nih.gov /), TERT CDS was inserted into pcDNA3 1 plasmid vector through HindIII and EcoRI cleavage sites, and the reaction system was cleaved: 5 μL buffer (rCutSmart) ^TM Buffer, manufacturer: NEB, cargo number: b6004 1. Mu.L of HindIII enzyme (HindIII-HF, manufacturer: NEB, cargo number: r3104), 1 μl of EcoRI enzyme (EcoRI-HF, manufacturer: NEB, cargo number: r3101), 3ug plasmid template (pcDNA 3.1), ddH ₂ O was added in an amount of 50. Mu.L, and the reaction was carried out at 37℃for 3 hours. The product is subjected to the next step of connection reaction, and the reaction system is as follows: 50ng of the reaction product of the cleavage system, 137ng TERT CDSDNA,2. Mu.L buffer (T4 DNA Ligase Reaction Buffer, manufacturer: NEB, cat# B0202S), 1. Mu.LT 4 Ligase (T4 DNA Ligase, manufacturer: NEB, cat# M0202), ddH ₂ O makes up 20. Mu.L. Using conventional commercial in vitro transcription kits (e.g., mMESSAGE mMACHINE ^TM T7 ULTRA reagentCassette, manufacturer: thermo Fisher, cat: AM 1345) in vitro transcription of the plasmid obtained by the ligation reaction described above to obtain TERT gene mRNA. The solution was diluted to 25 ng/. Mu.L with nuclease-free water for use.

Male mice (ICR line, 8-12 weeks old) were fed with single cages one week before semen collection. Sperm collection 30 minutes ago:

-in sperm capacitation vessel: two 100. Mu.l droplets of conventional commercial sperm capacitation (e.g., TYH sperm capacitation, manufacturer: aibei organism, cat# M2050) were made, coated with mineral oil;

-on an in vitro fertilization dish: preparation of 100. Mu.l of conventional commercial in vitro semen (e.g. HTF semen, manufacturer: abbe, cat. Number: M1150) microdroplets coated with mineral oil, all placed at 37℃in 5% CO ₂ The balance was maintained in the incubator.

2. Sperm collection and sperm cell processing

8-12 Zhou Lingxiong mice are killed by cervical dislocation, the abdominal cavity is cut off, the epididymal tail is taken and placed on sterilized filter paper, the impurities such as blood, fat and the like are removed, and the surface of the epididymal tail is sucked.

Placing epididymal tail into sperm capacitation liquid microdroplet in sperm capacitation vessel, extruding out paste sperm. Picking the pasty sperm into another sperm capacitation droplet. The sperm capacitation vessel was placed in an incubator for 1 hour to capacitation the sperm at 37℃and a carbon dioxide content of 5%.

3. Preparation of ovum

4-5 week old female mice (same strain) were superovulated and injected intraperitoneally with gestational horse serum gonadotropin (PMSG), the injection amount: 5 IU/serving. 48 hours after PMSG injection, human Chorionic Gonadotrophin (HCG) was injected, injection amount: 5 IU/serving. 15 hours after HCG injection, the female mice are killed by cervical dislocation, the abdominal cavity is cut off, and the oviduct is taken and put into the mineral oil of an in vitro fertilization dish. The enlarged part of the oviduct is scratched, and both sides of the enlarged part are extruded, so that cumulus-oocyte complexes (COCs) are completely released in mineral oil. COCs were introduced into 100. Mu.l droplets of fertilized liquid using ophthalmic forceps and placed in an incubator, waiting for sperm capacitation at 37℃and carbon dioxide content of 5%.

4. In vitro fertilization

1-3 μl of sperm suspension is aspirated from the outer edge of the sperm capacitation droplet and injected into the fertilized droplet containing COCs. The in vitro fertilization dish is placed into an incubator for culture, the in vitro fertilization time is about 6 hours, and the culture condition is that the temperature is 37 ℃ and the carbon dioxide content is 5%.

5. Injection of TERT mRNA

TERT mRNA was injected into fertilized eggs under a microscope at a dose of 25 ng/. Mu.L using a prokaryotic injection instrument. The TERT mRNA injection tool used a microinjection apparatus (brand: eppendorf, model: femtoJet 4 i), and the injected amount of TERT mRNA solution was 2pL per fertilized egg.

6. Embryo culture and transplantation

Pseudopregnant female mice are prepared during in vitro fertilization.

A split embryo culture dish was prepared, 100. Mu.l of a conventional commercial split embryo culture solution (e.g., split culture solution, manufacturer: cook, cat. Number: K-SICM-20) was covered with mineral oil and placed in an incubator for equilibration for 6 hours in advance.

After in vitro fertilization for 6 hours, the fertilized eggs are washed three times by in vitro sperm, female and male prokaryotes are observed after washing, unfertilized eggs are removed, the fertilized eggs are transferred into a split embryo culture solution, and the split embryo culture dish is placed into an incubator for culture under the culture condition that the temperature is 37 ℃ and the carbon dioxide content is 5%. After culturing for about 24 hours, embryo status was observed and development-retarded embryos were removed.

After keeping normal development until 2-cell stage embryo culture for about 24 hours, making blastocyst culture dish, 100 μl of conventional commercial blastocyst culture solution (such as blastocyst culture solution, manufacturer: cook, cat#: K-SIBM-20), coating mineral oil, placing into incubator in advance for balancing for 6 hours, observing embryo development condition, removing development retardation embryo, selecting normal development until 8-cell stage embryo, transferring into blastocyst culture solution, and placing into incubator.

After about 24 hours of culture, embryo development is observed, development-blocked embryos are removed, normal development-to-blastocyst stage embryos are selected and transplanted into uterus of female mice (ICR strain, 8 weeks old), 15 blastocysts are transplanted into each female mouse, and single cage single mice are bred until delivery, so that offspring mice are obtained.

Example 2 arrangement of the Positive control group

The experiment is divided into:

group A: the modeling method of example 1 was employed.

Group B: the difference from group A is that nuclease-free water is injected into fertilized eggs instead of TERT mRNA, when fertilized eggs develop to 2 cell stage (the method is the same), single-sided oviducts of the surrogate female mice are transplanted, 15 embryos of 2 cell stage are transplanted into each female mouse, and single cages are fed to the mice obtained after delivery.

Example 3 arrangement of negative control group

Group A: the modeling method of example 1 was employed.

Group C: the difference from group A is that nuclease-free water is injected into fertilized eggs instead of TERT mRNA, single-sided oviducts of surrogate female mice are transplanted when the fertilized eggs develop to blastula stage (the same method is the same), each female mouse is transplanted with 15 embryos of 2-cell stage, and single-cage single mice are bred to the mice obtained by delivery.

Example 4 construction method of telomere recovery mouse model

This embodiment differs from embodiment 1 in that:

1. in the preparation of the material: TERT gene mRNA is diluted to 10 ng/. Mu.L for standby by using nuclease-free water;

2. sperm collection and sperm collection processes: culturing the sperm capacitation vessel in an incubator for 0.5 hour to capacitation the sperm, wherein the culture condition is that the temperature is 35 ℃ and the carbon dioxide content is 4%;

4. In vitro fertilization: 1-3 μl of sperm suspension is aspirated from the outer edge of the sperm capacitation droplet and injected into the fertilized droplet containing COCs. Placing the in-vitro fertilization dish into an incubator for culture, wherein the in-vitro fertilization time is about 4 hours, and the culture condition is that the temperature is 35 ℃ and the carbon dioxide content is 4%;

5. injection of TERT mRNA:

TERT mRNA was injected into fertilized eggs under a microscope at a dose of 10 ng/. Mu.L using a prokaryotic injection instrument, with an injection amount of TERT mRNA solution of 1pL per fertilized egg.

6. Embryo culture and transplantation: transferring fertilized eggs into a blastomere embryo culture solution, placing a blastomere embryo culture dish into an incubator for culture under the conditions that the temperature is 35 ℃ and the carbon dioxide content is 4%, selecting embryos which normally develop to 8 cell stage after about 40 hours of culture, transferring the embryos into the blastomere culture solution, and placing the blastomere embryo into the incubator for continuous culture for 20 hours to obtain the blastomere embryo.

Example 5 arrangement of the Positive control group

The experiment is divided into:

group A: the modeling method of example 4 was employed.

Example 6 setting of negative control group

Group A: the modeling method of example 4 was employed.

Example 7 construction method of telomere recovery mouse model

This embodiment differs from embodiment 1 in that:

1. in the preparation of the material: TERT gene mRNA is diluted to 50 ng/. Mu.L for standby by using nuclease-free water;

2. sperm collection and sperm collection processes: culturing the sperm capacitation vessel in an incubator for 1.5 hours to capacitation the sperm, wherein the culture condition is that the temperature is 38 ℃ and the carbon dioxide content is 7%;

4. in vitro fertilization: 1-3 μl of sperm suspension is aspirated from the outer edge of the sperm capacitation droplet and injected into the fertilized droplet containing COCs. Placing the in-vitro fertilization dish into an incubator for culture, wherein the in-vitro fertilization time is about 10 hours, and the culture condition is that the temperature is 38 ℃ and the carbon dioxide content is 7%;

5. injection of TERT mRNA:

TERT mRNA was injected into fertilized eggs under a microscope at a dose of 50 ng/. Mu.L using a prokaryotic injection instrument, with an injection amount of TERT mRNA solution of 3pL per fertilized egg.

6. Embryo culture and transplantation: transferring fertilized eggs into a blastomere embryo culture solution, placing a blastomere embryo culture dish into an incubator for culture under the conditions that the temperature is 38 ℃ and the carbon dioxide content is 7%, selecting embryos which normally develop to 8 cell stage after about 54 hours of culture, transferring the embryos into the blastomere culture solution, and placing the blastomere embryo into the incubator for continuous culture for 28 hours to obtain the blastomere embryo.

Example 8 arrangement of the Positive control group

The experiment is divided into:

group A: the modeling method of example 5 was used.

Example 9 setting of the negative control group

Group A: the modeling method of example 5 was used.

Experimental example 1 test of telomere Length

1. Two groups of partial mice, a (telomere reverting mice) and B (positive control mice) in example 2 were sacrificed on the same day of delivery, peripheral blood, liver, brain and heart tissues were obtained by dissection, DNA was extracted, and the Relative Telomere Length (RTL) of each tissue was detected using qPCR method.

The detection method is to amplify the DNA template by using two pairs of primers respectively:

Tel-F primer sequence:

5’cggtttgtttgggtttgggtttgggtttgggtttgggtt3’(300nM)(SEQ ID No.1)；

Tel-R primer sequence:

5’ggcttgccttacccttacccttacccttacccttaccct3’(300nM)(SEQ ID No.2)；

reaction conditions: 95 ℃ for 10min;30 cycles: after 15s at 95℃the mixture was kept at 56℃for 1min. The single reaction system is as follows: 5 mu l ChamQSYBR qPCR MasterMix (manufacturer: vazyme, cat# Q331-02), F, R primer (concentration as described above), 20ng DNA template, ddH ₂ O makes up 10. Mu.l.

36B4-F primer sequences:

5’gttgggagttggactatggac3’(300nM)(SEQ ID No.3)；

36B4-R primer sequence:

5’tgaactgattggacacacaca3’(500nM)(SEQ ID No.4)；

reaction conditions: 95 ℃ for 10min;35 cycles: after 15s at 95℃and 20s at 52℃and 30s at 72 ℃. The single reaction system is as follows: 5 mu l ChamQSYBR qPCR MasterMix, F, R primer (concentrations as described above), 20ng DNA template, ddH2O make up 10. Mu.l.

3. According to CT values of two reactions of a sample, calculating RTL of the sample, wherein the calculating method comprises the following steps:

wherein:

RTL represents relative telomere length;

CT _Tel the representation is: the number of cycles that have been experienced when amplified to a set threshold in a telomere amplification reaction;

CT _36B4 The representation is: the number of cycles that the 36B4 gene amplification reaction undergoes when it is amplified to a set threshold.

4. Statistical analysis was done by specialized statistical analysis software (rv 4.0.2):

(1) Data normalization: standard transformations were performed on different sets of relative telomere lengths with one set of averages to ensure comparability between the data.

(2) Comparison of mouse telomere lengths between groups student t-test was used. The P-value for the statistical significance level was set to 0.05, and all statistical tests were double-sided.

5. The results show that in the mice of the first day after birth, the telomere length of the 4 different tissues of peripheral blood, liver, brain and heart of the mice of the group A is not significantly different from or significantly longer than that of the mice of the group B. The results demonstrate that the shortening of telomeres by blastocyst stage transplants was successfully restored following the procedure of example 1 (FIGS. 2-5).

6. The small knot:

the invention discloses the superiority of the constructed telomere recovery mouse model:

(1) The method for modeling the telomere recovery mouse model constructed by the method is simple, the modeling period is short, gene editing is not needed, and the telomere length recovery is caused by enhancing the telomere extension process under the action of telomerase through injecting TERT mRNA in the fertilized egg period. Therefore, the invention provides an important mouse model construction method for exploring telomere-related phenotypes such as telomere recovery mechanism, aging and the like.

(2) The telomere recovery effect of the present disclosure is stable and reliable, and the telomere length of peripheral blood, liver, brain and heart tissues of the constructed model mice is remarkably recovered (fig. 2 to 5).

(3) The blastocyst stage transplanted mouse telomere recovery method based on the present disclosure can be used for related research of human assisted reproductive operation optimization schemes.

Experimental example 2 test of telomere Length

1. The day after delivery, the peripheral blood, liver, brain, heart, DNA was extracted from two groups of mice, a (telomere reverting mice) and C (negative control mice) in example 3, and RTL was detected using qPCR method. The detection method is the same as that of experiment example 1.

RTL calculation method was the same as in test example 1.

3. The statistical analysis method was the same as in test example 1.

4. The results show that in mice on the first day after birth, the peripheral blood, liver, brain, heart telomere length was significantly longer in group a mice than in group C mice. The results demonstrate that the telomere recovery effect created in example 1, indeed derived from injected TERT RNA, successfully recovered telomere length in blastula-transplanted mice (fig. 2-5).

Experimental example 3 test of telomere Length

1. The day after delivery, the peripheral blood, liver, brain, and heart of mice in groups A (telomere-recovered mice), B (positive control mice), and C (negative control mice) of examples 5 and 6 were extracted, and the RTL was measured by qPCR method. The detection method is the same as that of experiment example 1.

RTL calculation method was the same as in test example 1.

3. The statistical analysis method was the same as in test example 1.

4. The results showed that there were no significant differences in the peripheral blood, liver, brain, heart telomere length from group B, C in mice of group a on the first day after birth. The results demonstrate that the procedure according to example 4 partially restored telomere shortening due to blastocyst stage transplants, but was less effective than example 1 (FIGS. 6-9).

Experimental example 4 test of telomere Length

1. The day after delivery, the peripheral blood, liver, brain, and heart of mice in groups A (telomere-recovered mice), B (positive control mice), and C (negative control mice) of examples 8 and 9 were extracted, and the RTL was measured by qPCR method. The detection method is the same as that of experiment example 1.

RTL calculation method was the same as in test example 1.

3. The statistical analysis method was the same as in test example 1.

4. The results show that in the mice of the first day after birth, the peripheral blood, liver, brain and heart telomere lengths of the mice of the group A are not significantly different from those of the mice of the group B, and the peripheral blood, brain and heart telomere lengths of the mice of the group A are significantly longer than those of the mice of the group C. The results demonstrate that the procedure according to example 7 successfully restored telomere shortening as a result of blastocyst stage transplants, but with slightly less effect than example 1 (FIGS. 10-13).

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

Claims

Use of tert mRNA in the preparation of a product for restoring telomere length in an animal or human.
2. The use according to claim 1, wherein the restoration of telomere length in animals or humans comprises restoration of telomere length in new offspring of blastocysts transplanted animals or humans;

and/or, the concentration of TERT mRNA is 10 ng/. Mu.L to 50 ng/. Mu.L; preferably, 25 ng/. Mu.L;

and/or, injecting TERT mRNA during fertilized egg periods;

and/or the product is a medicament.
3. The method for constructing the animal model for recovering the telomere length by blastocyst stage transplantation is characterized by comprising the following steps of:

obtaining fertilized eggs of non-human animals through in vitro fertilization, then injecting TERT mRNA solution into the fertilized eggs, culturing the fertilized eggs in vitro to a blastula stage, and implanting the obtained blastula stage embryos into non-human female animals and producing offspring.
4. The construction method according to claim 3, wherein,

the concentration of the TERT mRNA solution is 10-50 ng/. Mu.L; preferably, the concentration of the TERT mRNA solution is 25 ng/. Mu.L;

and/or, the TERT mRNA injection tool employs a microinjection apparatus;

and/or, the TERT mRNA solution is injected in an amount of 1-3pL per fertilized egg; preferably, the TERT mRNA solution is injected in an amount of 2pL per fertilized egg;

and/or, the blastula period refers to: 70 to 120 hours after fertilization; preferably 72±2 hours.
5. The construction method according to claim 3 or 4, comprising the steps of:

1) TERT mRNA was obtained and diluted to the desired concentration using nuclease-free water;

2) Obtaining sperm from a non-human male animal, contacting the sperm with a capacitation medium to obtain capacitation sperm;

3) Obtaining a cumulus-oocyte complex from a non-human female animal;

4) Contacting the obtained sperm in step 2) with a cumulus-oocyte complex in vitro to obtain fertilized eggs;

5) Microinjection of TERT mRNA from step 1) into fertilized eggs obtained in step 4);

6) Allowing the fertilized egg obtained in the step 5) to develop in vitro to a blastula stage;

7) Implanting the blastocyst-stage embryo into a non-human surrogate female and producing offspring;

Optionally, the non-human animal is SPF grade;

the order of steps 2) and 3) may be interchanged or parallel.
6. The method of construction according to any one of claims 3 to 5, wherein the non-human animal is a rodent;

optionally, the non-human animal is a mouse (Mus musculus);

alternatively, the mouse is selected from any one of the following strains: ICR, A/He, A/J, A/SnSf, A/WySN, AKR, AKR/A, AKR/J, AKR/N, BALB/C, B6SJLF1, B6C3F1, B6D2F1, C3H, C F1, C3Hf, C57BR, C57L, C57BL/A, C BL/An, C57BL/Grfa, C57BL/KaLwN, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10ScSn, C57BL/10Cr, C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, CBA/H, CB F1, CD2F1, CFW, DBA/1, DBA/2, FACA, FVB, KM, NIH, NIH (S), RF, SJL, SWR, TA, CBA/H, CB F1 or 129;

alternatively, male mice are 8 to 20 weeks old; preferably, 8 to 12 weeks of age;

alternatively, the female mouse is a adolescent female mouse, which is 3 to 12 weeks old; preferably, 4 to 5 weeks of age;

alternatively, female surrogate mice are 6 to 10 weeks old; preferably, 8 weeks of age.
7. The method of construction according to any one of claims 3 to 6, wherein in step 2):

Contacting the sperm and capacitation medium at 35 ℃ to 38 ℃ for 0.5 to 1.5 hours at a carbon dioxide content of 4% -7%; optionally, contacting the sperm and capacitation medium at 37 ℃ ± 1 ℃ with a carbon dioxide content of 5% for 1 hour; optionally, the capacitation medium comprises any one or combination of the following selected from: sodium, potassium, calcium, magnesium, glucose, beta-cyclodextrin or polyvinyl alcohol;

and/or, in step 4):

contacting said capacitating sperm and said cumulus-oocyte complex in an in vitro fertilization medium at a temperature of 35 ℃ to 38 ℃ and a carbon dioxide content of 4% -7% for 4-10 hours; optionally, contacting in an in vitro fertilization medium for 5.5-6.5 hours; optionally, contacting said capacitating sperm and said cumulus-oocyte complex in an in vitro fertilization medium at 37 ℃ ± 1 ℃ with a carbon dioxide content of 5% for 5.5-6.5 hours; optionally, the in vitro fertilization medium comprises any one or a combination of the following selected from: reduced glutathione, electrolyte, carbon source or nitrogen source;

and/or, in step 1):

obtaining a TERT gene coding sequence CDS, inserting the TERT coding sequence CDS into a plasmid vector, and carrying out in vitro transcription on the plasmid to obtain TERT gene mRNA; alternatively, the TERT coding sequence CDS was inserted into pcdna3.1 plasmid vector using HindIII and EcoRI cleavage sites; alternatively, mMESSAGE mMACHINE is used ^TM Performing in vitro transcription by using a T7ULTRA kit;

and/or, in step 6):

contacting the fertilized egg with a cleavage culture medium at 35 ℃ to 38 ℃ and a carbon dioxide content of 4% -7% for 40 to 54 hours to obtain an embryo of 8 cell stage; alternatively, contacting the fertilized egg with a cleavage culture medium at 37 ℃ ± 1 ℃ at a carbon dioxide content of 5% for 48±2 hours to obtain an embryo of 8-cell phase;

contacting the embryo of 8 cell stage with blastula culture medium at 35 ℃ to 38 ℃ and carbon dioxide content of 4% -7% for 20 to 28 hours to obtain embryo of blastula stage; alternatively, the embryo of 8 cell stage and the blastocyst culture medium are contacted for 24.+ -. 2 hours at 37.+ -. 1 ℃ and carbon dioxide content of 5% to obtain embryo of blastocyst stage.
8. The construction method according to any one of claims 3 to 7, wherein,

the telomere length in the tissue of the animal model is statistically significantly longer than that of a negative control non-human animal; the tissue of the animal model has statistically no significant difference or significantly longer telomere length than the positive control non-human animal;

optionally, the tissue is selected from any one or a combination of the following: peripheral blood, heart, liver or brain;

Optionally, the negative control non-human animal, the positive control non-human animal, and the animal model are the same strain;

alternatively, the negative control non-human animal refers to the offspring produced by implanting the embryo into the non-human surrogate female animal at the blastocyst stage after injecting sterile water into the fertilized egg; the positive control non-human animal refers to offspring produced by implanting embryos into non-human female animals for pregnancy before blastocyst period after injecting sterile water into fertilized eggs;

more optionally, the positive control non-human animal refers to offspring produced by implanting embryos into non-human surrogate females during the cleavage phase after injection of sterile water into the fertilized eggs.
9. An animal model of blastocyst stage graft recovery telomere length constructed by the construction method of any one of claims 3-8.
10. Use of an animal model of blastocyst stage transplant recovery telomere length according to claim 9 in telomere studies or aging studies or in related studies of human clinical assisted reproductive technology procedures optimization.