CN117511942A - Method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system - Google Patents

Abstract

The invention discloses a method for specifically knocking down plant circRNA based on a CRISPR/RfxCas13d system, which comprises the following steps: s1, designing and synthesizing a target gene sequence coding for RfxCas13d with plant codon preference, and constructing a pCAMBIA1300-RfxCas13d recombinant vector; s2, synthesizing a AtU6-crRNA gene fragment, wherein the AtU6-crRNA gene fragment comprises two BsaI enzyme cutting sites, and constructing a pENTR4:gRNA4-AtU6-crRNA recombinant vector; s3, synthesizing and constructing a pCAMBIA1300-RfxCas13d-BSJ-crRNA vector of a specific targeting plant circRNA BSJ site; s4, transferring the constructed pCAMBIA1300-RfxCas13d-BSJ-crRNA expression vector to plant callus, and obtaining a transgenic plant with specificity knocked down plant circRNA through tissue culture; the invention greatly accelerates the functional research of the plant circRNA, thereby realizing the development of the circRNA functional gain mutant and new germplasm in plant breeding.

Description

Method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system

Technical Field

The invention relates to the technical field of biology, in particular to a method for specifically knocking down plant circRNA based on a CRISPR/RfxCas13d system.

Background

Circular RNAs (circrnas) are new members of the recently added non-coding RNA family, with covalently closed circular structures, as distinguished from most linear RNAs. Research shows that the circRNA has stable structure, rich variety, conserved sequence, specific expression in cells and tissues, many potential functions, plays an important role in regulating gene expression and various biological functions, can be used as a biosensor, a regulator and a potential therapeutic tool, and provides a new strategy and tool for future crop disease resistance breeding.

However, since the circRNA shares an overlapping sequence with its cognate linear mRNA except for the reverse splice site (BSJ), this feature makes it difficult to distinguish the function of the circRNA and its cognate mRNA, it remains a challenge to knock down the level of the circRNA without affecting the expression of its parent gene. Currently, the knockdown of CircRNA by RNA interference (siRNA/shRNA) is a common method in humans and animals. However, in plant circRNA research, the aim of knocking out the circRNA can only be achieved by directly knocking out exons forming circular RNA through the CRISPR-Cas9 system or by suppressing the biogenesis of the circRNA through knocking out reverse complementary sequences in flanking sequences, however, because the sequence of the circRNA is almost completely consistent with that of a parent gene thereof, the CRISPR-Cas9 system generally does not achieve a good result for knocking out only the circRNA without affecting the expression of the parent gene thereof. Thus, there is currently no viable approach to specific knockdown of plant circRNA.

The average length of the RfxCas13d enzyme is 930 amino acids, 20% smaller than other Cas13 enzymes, and 33% smaller than Cas 9. It is able to knock down RNA without changing the genome under the guidance of guide RNA. These properties allow RfxCas13d to be an important mRNA editing tool that can be developed as a practical tool for biological mRNA editing without permanently altering the genomic sequence to affect gene expression. Studies have shown that the knockout efficiency of the rcRNA mediated by the RfxCas13d-BSJ-gRNA in animal cells is 65 percent on average, and the knockout efficiency of the shRNA is 35 percent, which shows that the CRISPR/RfxCas13d can be widely applied to the study of the function of the circRNA.

Therefore, the current urgent need to overcome the difficulty in the prior art, realize the breakthrough of the circRNA editing technology in the plant body, construct a CRISPR/RfxCas13d vector which can be suitable for knocking down the circRNA of the plant, target the sequence on the BSJ locus of the circRNA of the plant, effectively and specifically distinguish the circular RNA from the mRNAs, and specifically knock down the circRNA. The functional research of the plant circRNA is greatly accelerated, and the development of the circRNA functional gain mutant and new germplasm in plant breeding is further realized.

Disclosure of Invention

The invention aims to provide a method for specifically knocking down plant circRNA based on a CRISPR/RfxCas13d system, which is used for solving the problem that the specific editing of target circRNA cannot be realized in a plant body in the prior art, greatly accelerating the functional research of the plant circRNA, and further realizing the development of a circRNA functional gain mutant and a new germplasm in plant breeding.

The invention provides a method for specifically knocking down plant circRNA based on a CRISPR/RfxCas13d system, which comprises the following steps:

s1, designing and synthesizing a target gene sequence coding for RfxCas13d with plant codon preference, and constructing a pCAMBIA1300-RfxCas13d recombinant vector;

s2, synthesizing a AtU6-crRNA gene fragment, wherein the AtU6-crRNA gene fragment comprises two BsaI enzyme cutting sites, and constructing a pENTR4:gRNA4-AtU6-crRNA recombinant vector;

s3, synthesizing and constructing a pCAMBIA1300-RfxCas13d-BSJ-crRNA vector of a specific targeting plant circRNA BSJ site;

s4, transferring the constructed pCAMBIA1300-RfxCas13d-BSJ-crRNA expression vector to plant callus, and obtaining a transgenic plant with specificity knockdown plant circRNA through tissue culture.

Preferably, in step S1, the pCAMBIA1300-RfxCas13d recombinant vector comprises a CaMV 35S promoter, a hygromycin gene, a CaMV poly (A) signal terminator, pVS1 RepA, a pVS1 replication origin, a rice ubiquitination promoter, a SV40 NLS-RfxCas13d-SV40 NLS and a NOS terminator.

Preferably, step S1 comprises the steps of: the target gene sequence encoding RfxCas13d is optimized and synthesized through plant codon preference, and is directly cloned to a linearized pUC57 vector, which is named pUC57: rfxCas13d. Based on CRISPR/spCas9 vector, plasmid pUC57 was purified using BamHI and NcoI: double digestion is carried out on the RfxCas13d and the CRISPR/spCas9 vector, 3003bp RfxCas13d gene fragments and about 12.6kb CRISPR/spCas9 vector frameworks are respectively recovered, the 3003bp RfxCas13d fragments are connected to the CRISPR/spCas9 vector frameworks by using T4 DNA ligase, the plasmid is named pCAMBIA1300-RfxCas13d, the plasmid is stored after sequencing, and the transformed escherichia coli is stored after verification.

Preferably, the base sequence of the SV40 NLS-RfxCas13d-SV40 NLS gene is SEQ ID No.1.

SEQ ID No.1(SV40 NLS-RfxCas13d-SV40 NLS)

atgtctccgaaaaaaaaaaggaaggtcgaggcgagcattgagaaaaagaagagctttgctaaaggtatgggggttaagagtacattggtgtccggttccaaagtgtatatgactacatttgcggaaggcagcgacgcaaggctggagaaaatagttgaaggcgattcaataagatcggtgaatgaaggagaagccttctccgctgaaatggccgacaaaaatgccggttataagattggtaacgctaagttctcgcacccaaagggttatgcagtcgtggcgaacaatccactgtacacaggtcctgtgcagcaggatatgcttggtttgaaggaaacgttggaaaagcggtacttcggtgagtccgctgacggcaatgataatatatgtattcaggtgatacacaacatcctcgatatagaaaaaatcctcgctgagtacattacaaatgccgcctacgcggtcaataacatatccggtttggacaaagacatcataggatttggaaaattctctacagtgtacacgtacgatgaatttaaagacccggagcatcacagagcagctttcaacaacaatgataagctcataaatgcaataaaagcgcaatatgatgaatttgacaactttcttgataacccgaggctgggctattttggtcaggctttcttcagcaaagaagggcgcaactatattataaattacggcaatgagtgctatgatattttggcattgttgtccggactgcggcattgggttgttcataataacgaggaagagagtaggatcagtcgcacatggctgtataaccttgataagaatctcgataatgagtatatttcgactttgaactacttgtatgatcgc

attactaacgaactcaccaacagcttttcgaagaactcggcagccaacgtgaattatatagcggaaaccttggggatta

acccagcagaattcgcagaacagtactttcgcttcagcataatgaaggaacaaaagaacctcggttttaacatcacaaa

actcagagaggttatgctggatagaaaagacatgtcagaaattcggaaaaatcataaagtgttcgattccatcaggacg

aaggtctacacaatgatggatttcgtcatctacagatattatattgaggaggatgcaaaagtcgcagcggccaacaaaa

gcctccctgacaatgaaaagtcgctctctgaaaaggacatctttgtcataaaccttcggggcagttttaacgatgaccaa

aaggacgccttgtactacgatgaagcaaatcgcatctggaggaaacttgagaacataatgcataacataaaggagttt

cgggggaacaagacgagagaatacaaaaagaaggacgcgccaagacttcctagaattctcccagcggggcgcga

cgtctcagcgttctccaagctcatgtacgcgcttaccatgttcctcgatggaaaagagataaatgatcttttgactacgct

cattaacaagttcgacaacattcaatctttcctgaaagtgatgcctctcataggggtcaacgcaaagttcgttgaagaata

cgcctttttcaaggactctgcgaagatagccgatgaactccgcctcataaagagctttgcgcggatgggtgaacctatt

gctgacgcccggagggcaatgtatattgacgcgatcaggattcttggaactaatctctcctacgacgaacttaaggctc

ttgctgataccttttctcttgatgaaaacgggaacaaactcaagaagggaaaacacggtatgcggaatttcatcataaat

aacgttatttcaaacaagagattccattacctgataagatacggagatccagcccatctgcacgaaatcgcgaaaaacg

aggctgttgttaaattcgttttggggagaatcgctgacatacaaaaaaagcaggggcaaaacgggaagaaccagatc

gaccggtactacgaaacctgtatcggtaaggacaaagggaagagtgtgtccgaaaaggttgacgcccttacaaaaat

catcaccggtatgaactatgaccaattcgacaagaaaagaagtgttatagaagatacgggaagagagaatgcggagc

gggaaaaatttaaaaagatcatatcgctctatctgaccgttatctatcatatccttaaaaacatagtcaacatcaacgcac

ggtacgtgataggcttccattgtgtggaacgggacgcccagttgtacaaagagaaaggatacgacataaacctcaag

aagctcgaagagaagggttttagctctgttacgaaactttgtgcgggtatcgatgaaaccgcgcctgacaaacggaaa

gacgttgaaaaggagatggcagaacgcgctaaagagtctatagacagtcttgagtcagcaaatcccaagctctacgc

gaactacataaaatattctgacgaaaaaaaagctgaagaatttaccagacaaataaacagagagaaggctaagactg

cgttgaatgcctatctgcggaacactaaatggaatgtcataattcgggaagaccttctgcggatcgacaataaaacctg

caccctctttagaaataaggctgtccacctggaagttgctcgctatgtgcatgcgtatattaacgacattgctgaggttaa

cagctactttcagctgtatcattacatcatgcagaggattattatgaacgagcgctacgagaagtcctccgggaaggttt

cagagtattttgacgcagtcaacgatgagaaaaagtacaacgatcggctgctgaaactcctgtgtgtcccattcgggta

ttgtataccgcgcttcaagaacctctcaatagaggcgctctttgaccgcaacgaggccgcaaagtttgataaagaaaaa

aagaaagttagtgggaatagtggctcaggaccaaagaagaaaagaaaggttgcagcggcatatccgtacgatgtgc

cggattatgcgtga

Preferably, the amino acid sequence encoded by RfxCas13d is SEQ ID No.2.

SEQ ID No.2

Met Ser Pro Lys Lys Lys Arg Lys Val Glu Ala Ser Ile Glu Lys Lys Lys SerPhe Ala Lys Gly Met Gly Val Lys Ser Thr Leu Val Ser Gly Ser Lys Val Tyr MetThr Thr Phe Ala Glu Gly Ser Asp Ala Arg Leu Glu Lys Ile Val Glu Gly Asp SerIle Arg Ser Val Asn Glu Gly Glu Ala Phe Ser Ala Glu Met Ala Asp Lys Asn AlaGly Tyr Lys Ile Gly Asn Ala Lys Phe Ser His Pro Lys Gly Tyr Ala Val Val AlaAsn Asn Pro Leu Tyr Thr Gly Pro Val Gln Gln Asp Met Leu Gly Leu Lys Glu ThrLeu Glu Lys Arg Tyr Phe Gly Glu Ser Ala Asp Gly Asn Asp Asn Ile Cys Ile GlnVal Ile His Asn Ile Leu Asp Ile Glu Lys Ile Leu Ala Glu Tyr Ile Thr Asn Ala AlaTyr Ala Val Asn Asn Ile Ser Gly Leu Asp Lys Asp Ile Ile Gly Phe Gly Lys PheSer Thr Val Tyr Thr Tyr Asp Glu Phe Lys Asp Pro Glu His His Arg Ala Ala PheAsn Asn Asn Asp Lys Leu Ile Asn Ala Ile Lys Ala Gln Tyr Asp Glu Phe Asp AsnPhe Leu Asp Asn Pro Arg Leu Gly Tyr Phe Gly Gln Ala Phe Phe Ser Lys Glu GlyArg Asn Tyr Ile Ile Asn Tyr Gly Asn Glu Cys Tyr Asp Ile Leu Ala Leu Leu SerGly Leu Arg His Trp Val Val His Asn Asn Glu Glu Glu Ser Arg Ile Ser Arg ThrTrp Leu Tyr Asn Leu Asp Lys Asn Leu Asp Asn Glu Tyr Ile Ser Thr Leu Asn TyrLeu Tyr Asp Arg Ile Thr Asn Glu Leu Thr Asn Ser Phe Ser Lys Asn Ser Ala AlaAsn Val Asn Tyr Ile Ala Glu Thr Leu Gly Ile Asn Pro Ala Glu Phe Ala Glu GlnTyr Phe Arg Phe Ser Ile Met Lys Glu Gln Lys Asn Leu Gly Phe Asn Ile Thr LysLeu Arg Glu Val Met Leu Asp Arg Lys Asp Met Ser Glu Ile Arg Lys Asn His LysVal Phe Asp Ser Ile Arg Thr Lys Val Tyr Thr Met Met Asp Phe Val Ile Tyr ArgTyr Tyr Ile Glu Glu Asp Ala Lys Val Ala Ala Ala Asn Lys Ser Leu Pro Asp AsnGlu Lys Ser Leu Ser Glu Lys Asp Ile Phe Val Ile Asn Leu Arg Gly Ser Phe AsnAsp Asp Gln Lys Asp Ala Leu Tyr Tyr Asp Glu Ala Asn Arg Ile Trp Arg Lys LeuGlu Asn Ile Met His Asn Ile Lys Glu Phe Arg Gly Asn Lys Thr Arg Glu Tyr LysLys Lys Asp Ala Pro Arg Leu Pro Arg Ile Leu Pro Ala Gly Arg Asp Val Ser AlaPhe Ser Lys Leu Met Tyr Ala Leu Thr Met Phe Leu Asp Gly Lys Glu Ile Asn AspLeu Leu Thr Thr Leu Ile Asn Lys Phe Asp Asn Ile Gln Ser Phe Leu Lys Val MetPro Leu Ile Gly Val Asn Ala Lys Phe Val Glu Glu Tyr Ala Phe Phe Lys Asp SerAla Lys Ile Ala Asp Glu Leu Arg Leu Ile Lys Ser Phe Ala Arg Met Gly Glu ProIle Ala Asp Ala Arg Arg Ala Met Tyr Ile Asp Ala Ile Arg Ile Leu Gly Thr AsnLeu Ser Tyr Asp Glu Leu Lys Ala Leu Ala Asp Thr Phe Ser Leu Asp Glu Asn GlyAsn Lys Leu Lys Lys Gly Lys His Gly Met Arg Asn Phe Ile Ile Asn Asn Val IleSer Asn Lys Arg Phe His Tyr Leu Ile Arg Tyr Gly Asp Pro Ala His Leu His GluIle Ala Lys Asn Glu Ala Val Val Lys Phe Val Leu Gly Arg Ile Ala Asp Ile GlnLys Lys Gln Gly Gln Asn Gly Lys Asn Gln Ile Asp Arg Tyr Tyr Glu Thr Cys IleGly Lys Asp Lys Gly Lys Ser Val Ser Glu Lys Val Asp Ala Leu Thr Lys Ile IleThr Gly Met Asn Tyr Asp Gln Phe Asp Lys Lys Arg Ser Val Ile Glu Asp Thr GlyArg Glu Asn Ala Glu Arg Glu Lys Phe Lys Lys Ile Ile Ser Leu Tyr Leu Thr ValIle Tyr His Ile Leu Lys Asn Ile Val Asn Ile Asn Ala Arg Tyr Val Ile Gly Phe HisCys Val Glu Arg Asp Ala Gln Leu Tyr Lys Glu Lys Gly Tyr Asp Ile Asn Leu LysLys Leu Glu Glu Lys Gly Phe Ser Ser Val Thr Lys Leu Cys Ala Gly Ile Asp GluThr Ala Pro Asp Lys Arg Lys Asp Val Glu Lys Glu Met Ala Glu Arg Ala Lys GluSer Ile Asp Ser Leu Glu Ser Ala Asn Pro Lys Leu Tyr Ala Asn Tyr Ile Lys TyrSer Asp Glu Lys Lys Ala Glu Glu Phe Thr Arg Gln Ile Asn Arg Glu Lys Ala LysThr Ala Leu Asn Ala Tyr Leu Arg Asn Thr Lys Trp Asn Val Ile Ile Arg Glu AspLeu Leu Arg Ile Asp Asn Lys Thr Cys Thr Leu Phe Arg Asn Lys Ala Val His LeuGlu Val Ala Arg Tyr Val His Ala Tyr Ile Asn Asp Ile Ala Glu Val Asn Ser TyrPhe Gln Leu Tyr His Tyr Ile Met Gln Arg Ile Ile Met Asn Glu Arg Tyr Glu LysSer Ser Gly Lys Val Ser Glu Tyr Phe Asp Ala Val Asn Asp Glu Lys Lys Tyr AsnAsp Arg Leu Leu Lys Leu Leu Cys Val Pro Phe Gly Tyr Cys Ile Pro Arg Phe LysAsn Leu Ser Ile Glu Ala Leu Phe Asp Arg Asn Glu Ala Ala Lys Phe Asp Lys GluLys Lys Lys Val Ser Gly Asn Ser Gly Ser Gly Pro Lys Lys Lys Arg Lys Val AlaAla Ala Tyr Pro Tyr Asp Val Pro Asp Tyr Ala*

Preferably, in step S2, the pENTR4 gRNA 4-AtU-crRNA recombinant vector comprises AtU of a promoter, a crRNA repeat leader sequence, and a spacer nucleotide sequence containing two BsaI cleavage sites.

Preferably, the base sequence of the AtU6-crRNA gene fragment is SEQ ID No.3.

SEQ ID No.3(AtU6-crRNA)

aagcttcattcggagtttttgtatcttgtttcatagtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaacatcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaagagaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagttgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatatacagctagagtcgaagtagtgattgaacccctaccaactggtcggggtttgaaacagagaccagaattcggtctcatttttttttggatccactagtcctgcagg

Preferably, step S2 includes: and (3) linearizing the pENTR4:gRNA4 vector by using HindIII, recovering a linearization vector skeleton, artificially synthesizing a AtU-crRNA gene fragment containing two BsaI enzyme cutting sites, directly synthesizing the fragment onto the pENTR4:gRNA4 vector by using the HindIII enzyme cutting sites to obtain the pENTR4:gRNA 4-AtU-crRNA vector, sequencing the plasmid, preserving the plasmid, and transforming the escherichia coli after verification is successful and preserving the plasmid.

Preferably, step S3 includes: designing a gRNAs targeting sequence aiming at a BSJ site of the circRNA, synthesizing an RfxCas13d-BSJ-gRNA target sequence primer, and connecting the primer to BsaI linearized pENTR4:gRNA 4-AtU-crRNA carrier in a primer annealing mode; and (3) taking the gRNA4-AtU6-BSJ-crRNA vector constructed in the previous step as a template, designing primers with HindIII and SbfI enzyme cutting sites, amplifying AtU-BSJ-crRNA fragments with HindIII and SbfI enzyme cutting sites, carrying out double enzyme cutting on the pCAMBIA1300-RfxCas13d recombinant vector by using HindIII and SbfI, and finally obtaining the pCAMBIA1300-RfxCas13d-BSJ-crRNA vector by a homologous recombination mode. Further preferably, finally, the plasmid is stored after sequencing by PCR and enzyme digestion verification, and the transformed E.coli is stored after verification. A CRISPR/RfxCas13d knock-down vector is obtained that specifically knocks down the circRNA without affecting the expression of its parent gene.

Preferably, the plants include rice, tomato, arabidopsis thaliana.

In summary, the method of the present invention has the following features and advantages: the RfxCas13d subjected to plant codon optimization does not influence the normal physiological activities of plants; the invention provides a technology for knocking down plant circRNA by using CRISPR/RfxCas13d, which is used for directly shearing and knocking down target circRNA in a plant body through crRNA mediation orientation based on a BSJ locus by using a CRISPR/RfxCas13d editing system, so as to realize accurate targeting; the technology provided by the invention gets rid of the limitation that the parent mRNA is knocked out when the plant circRNA is knocked out by the CRISPR-cas9 technology. The invention overcomes the difficulty of the prior art, realizes the breakthrough of the circRNA editing technology in plants, converts the CRISPR/RfxCas13d system into a practical tool for exerting effect in the plants, can be used for the functional research of the plant circRNA, further realizes the development of the circRNA functional gain mutant and new germplasm in plant breeding, and greatly accelerates the development of biological editing technology in bioengineering and agronomic germplasm innovation.

Compared with the prior art, the invention has the beneficial effects that:

1. the CRISPR Cas13d technology is applied to experimental study of knocking down plant circRNA for the first time;

2. the whole operation implementation process of the method is simple and effective;

3. the invention eliminates the limitation of gene targeting sites, does not reduce the expression of the parent mRNA in the targeting process of the plant circRNA BSJ site, and can obtain higher plant circRNA targeting efficiency;

4. the technology of the invention can be used for functional research of plant circRNA, thereby realizing the development of circRNA functional gain mutant and new germplasm in plant breeding.

Drawings

FIG. 1 is a schematic vector diagram of pCAMBIA1300-RfxCas13 d.

FIG. 2 is a schematic representation of the vector of pENTR4, gRNA4-AtU 6-crRNA.

FIG. 3 shows the expression levels of the circRNA of three circRNA knock-down plants and wild-type plants of rice in the examples of the present invention.

FIG. 4 shows the expression level of female mRNA of the circRNA of three circRNA knock-down plants and wild type plants of rice in the examples of the present invention.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

EXAMPLE 1 construction of pCAMBIA1300-RfxCas13d and pENTR4: gRNA 4-AtU-crRNA recombinant vectors

1. Construction of pCAMBIA1300-RfxCas13d recombinant vector

Searching a target gene sequence of CRISPR VI d type (Cas 13 d) in NCBI functional network, and optimizing plant codon preference of the obtained Cas13d original sequence on the premise of not changing coded amino acid. Artificially synthesizing 3003bp optimized RfxCas13d gene fragment, cloning the fragment onto pUC57, and naming the fragment as pUC57: rfxCas13d, chemically synthesized by the biological engineering (Shanghai) Co., ltd.

Plasmid pUC57 was digested with BamHI and NcoI: double digestion is carried out on the RfxCas13d and the CRISPR/spCas9 vector (laboratory preservation vector), 3003bp RfxCas13d gene fragments and about 12.3kb CRISPR/spCas9 vector frameworks are respectively recovered, the 3003bp RfxCas13d fragments are connected to the CRISPR/spCas9 vector frameworks by using T4 DNA ligase, the plasmid is named pCAMBIA1300-RfxCas13d, the plasmid is preserved after sequencing, and the transformed escherichia coli is preserved after verification.

As shown in fig. 1, the plasmid pCAMBIA1300-RfxCas13d is constructed as follows: the promoter comprises a CaMV 35S promoter, a hygromycin gene, a CaMV poly (A) signal terminator, pVS1 RepA, a pVS1 replication origin, a rice ubiquitination promoter, an SV40 NLS-RfxCas13d-SV40 NLS (shown as SEQ ID No. 1) and an NOS terminator. The amino acid sequence of the RfxCas13d code is shown in SEQ ID No.2.

SEQ ID No.1

atgtctccgaaaaaaaaaaggaaggtcgaggcgagcattgagaaaaagaagagctttgctaaaggtatgggggttaagagtacattggtgtccggttccaaagtgtatatgactacatttgcggaaggcagcgacgcaaggctggagaaaatagttgaaggcgattcaataagatcggtgaatgaaggagaagccttctccgctgaaatggccgacaaaaatgccggttataagattggtaacgctaagttctcgcacccaaagggttatgcagtcgtggcgaacaatccactgtacacaggtcctgtgcagcaggatatgcttggtttgaaggaaacgttggaaaagcggtacttcggtgagtccgctgacggcaatgataatatatgtattcaggtgatacacaacatcctcgatatagaaaaaatcctcgctgagtacattacaaatgccgcctacgcggtcaataacatatccggtttggacaaagacatcataggatttggaaaattctctacagtgtacacgtacgatgaatttaaagacccggagcatcacagagcagctttcaacaacaatgataagctcataaatgcaataaaagcgcaatatgatgaatttgacaactttcttgataacccgaggctgggctattttggtcaggctttcttcagcaaagaagggcgcaactatattataaattacggcaatgagtgctatgatattttggcattgttgtccggactgcggcattgggttgttcataataacgaggaagagagtaggatcagtcgcacatggctgtataaccttgataagaatctcgataatgagtatatttcgactttgaactacttgtatgatcgcattactaacgaactcaccaacagcttttcgaagaactcggcagccaacgtgaattatatagcggaaaccttggggattaacccagcagaattcgcagaacagtactttcgcttcagcataatgaaggaacaaaagaacctcggttttaacatcacaaaactcagagaggttatgctggatagaaaagacatgtcagaaattcggaaaaatcataaagtgttcgattccatcaggacgaaggtctacacaatgatggatttcgtcatctacagatattatattgaggaggatgcaaaagtcgcagcggccaacaaaagcctccctgacaatgaaaagtcgctctctgaaaaggacatctttgtcataaaccttcggggcagttttaacgatgaccaaaaggacgccttgtactacgatgaagcaaatcgcatctggaggaaacttgagaacataatgcataacataaaggagtttcgggggaacaagacgagagaatacaaaaagaaggacgcgccaagacttcctagaattctcccagcggggcgcgacgtctcagcgttctccaagctcatgtacgcgcttaccatgttcctcgatggaaaagagataaatgatcttttgactacgctcattaacaagttcgacaacattcaatctttcctgaaagtgatgcctctcataggggtcaacgcaaagttcgttgaagaatacgcctttttcaaggactctgcgaagatagccgatgaactccgcctcataaagagctttgcgcggatgggtgaacctattgctgacgcccggagggcaatgtatattgacgcgatcaggattcttggaactaatctctcctacgacgaacttaaggctcttgctgataccttttctcttgatgaaaacgggaacaaactcaagaagggaaaacacggtatgcggaatttcatcataaataacgttatttcaaacaagagattccattacctgataagatacggagatccagcccatctgcacgaaatcgcgaaaaacgaggctgttgttaaattcgttttggggagaatcgctgacatacaaaaaaagcaggggcaaaacgggaagaaccagatcgaccggtactacgaaacctgtatcggtaaggacaaagggaagagtgtgtccgaaaaggttgacgcccttacaaaaatcatcaccggtatgaactatgaccaattcgacaagaaaagaagtgttatagaagatacgggaagagagaatgcggagcgggaaaaatttaaaaagatcatatcgctctatctgaccgttatctatcatatccttaaaaacatagtcaacatcaacgcacggtacgtgataggcttccattgtgtggaacgggacgcccagttgtacaaagagaaaggatacgacataaacctcaagaagctcgaagagaagggttttagctctgttacgaaactttgtgcgggtatcgatgaaaccgcgcctgacaaacggaaagacgttgaaaaggagatggcagaacgcgctaaagagtctatagacagtcttgagtcagcaaatcccaagctctacgcgaactacataaaatattctgacgaaaaaaaagctgaagaatttaccagacaaataaacagagagaaggctaagactgcgttgaatgcctatctgcggaacactaaatggaatgtcataattcgggaagaccttctgcggatcgacaataaaacctgcaccctctttagaaataaggctgtccacctggaagttgctcgctatgtgcatgcgtatattaacgacattgctgaggttaacagctactttcagctgtatcattacatcatgcagaggattattatgaacgagcgctacgagaagtcctccgggaaggtttcagagtattttgacgcagtcaacgatgagaaaaagtacaacgatcggctgctgaaactcctgtgtgtcccattcgggtattgtataccgcgcttcaagaacctctcaatagaggcgctctttgaccgcaacgaggccgcaaagtttgataaagaaaaaaagaaagttagtgggaatagtggctcaggaccaaagaagaaaagaaaggttgcagcggcatatccgtacgatgtgccggattatgcgtga

SEQ ID No.2

Met Ser Pro Lys Lys Lys Arg Lys Val Glu Ala Ser Ile Glu Lys Lys Lys SerPhe Ala Lys Gly Met Gly Val Lys Ser Thr Leu Val Ser Gly Ser Lys Val Tyr MetThr Thr Phe Ala Glu Gly Ser Asp Ala Arg Leu Glu Lys Ile Val Glu Gly Asp SerIle Arg Ser Val Asn Glu Gly Glu Ala Phe Ser Ala Glu Met Ala Asp Lys Asn AlaGly Tyr Lys Ile Gly Asn Ala Lys Phe Ser His Pro Lys Gly Tyr Ala Val Val AlaAsn Asn Pro Leu Tyr Thr Gly Pro Val Gln Gln Asp Met Leu Gly Leu Lys Glu ThrLeu Glu Lys Arg Tyr Phe Gly Glu Ser Ala Asp Gly Asn Asp Asn Ile Cys Ile GlnVal Ile His Asn Ile Leu Asp Ile Glu Lys Ile Leu Ala Glu Tyr Ile Thr Asn Ala AlaTyr Ala Val Asn Asn Ile Ser Gly Leu Asp Lys Asp Ile Ile Gly Phe Gly Lys PheSer Thr Val Tyr Thr Tyr Asp Glu Phe Lys Asp Pro Glu His His Arg Ala Ala PheAsn Asn Asn Asp Lys Leu Ile Asn Ala Ile Lys Ala Gln Tyr Asp Glu Phe Asp AsnPhe Leu Asp Asn Pro Arg Leu Gly Tyr Phe Gly Gln Ala Phe Phe Ser Lys Glu GlyArg Asn Tyr Ile Ile Asn Tyr Gly Asn Glu Cys Tyr Asp Ile Leu Ala Leu Leu SerGly Leu Arg His Trp Val Val His Asn Asn Glu Glu Glu Ser Arg Ile Ser Arg ThrTrp Leu Tyr Asn Leu Asp Lys Asn Leu Asp Asn Glu Tyr Ile Ser Thr Leu Asn TyrLeu Tyr Asp Arg Ile Thr Asn Glu Leu Thr Asn Ser Phe Ser Lys Asn Ser Ala AlaAsn Val Asn Tyr Ile Ala Glu Thr Leu Gly Ile Asn Pro Ala Glu Phe Ala Glu Gln

Tyr Phe Arg Phe Ser Ile Met Lys Glu Gln Lys Asn Leu Gly Phe Asn Ile Thr Lys

Leu Arg Glu Val Met Leu Asp Arg Lys Asp Met Ser Glu Ile Arg Lys Asn His Lys

Val Phe Asp Ser Ile Arg Thr Lys Val Tyr Thr Met Met Asp Phe Val Ile Tyr Arg

Tyr Tyr Ile Glu Glu Asp Ala Lys Val Ala Ala Ala Asn Lys Ser Leu Pro Asp Asn

Glu Lys Ser Leu Ser Glu Lys Asp Ile Phe Val Ile Asn Leu Arg Gly Ser Phe Asn

Asp Asp Gln Lys Asp Ala Leu Tyr Tyr Asp Glu Ala Asn Arg Ile Trp Arg Lys Leu

Glu Asn Ile Met His Asn Ile Lys Glu Phe Arg Gly Asn Lys Thr Arg Glu Tyr Lys

Lys Lys Asp Ala Pro Arg Leu Pro Arg Ile Leu Pro Ala Gly Arg Asp Val Ser Ala

Phe Ser Lys Leu Met Tyr Ala Leu Thr Met Phe Leu Asp Gly Lys Glu Ile Asn Asp

Leu Leu Thr Thr Leu Ile Asn Lys Phe Asp Asn Ile Gln Ser Phe Leu Lys Val Met

Pro Leu Ile Gly Val Asn Ala Lys Phe Val Glu Glu Tyr Ala Phe Phe Lys Asp Ser

Ala Lys Ile Ala Asp Glu Leu Arg Leu Ile Lys Ser Phe Ala Arg Met Gly Glu Pro

Ile Ala Asp Ala Arg Arg Ala Met Tyr Ile Asp Ala Ile Arg Ile Leu Gly Thr Asn

Leu Ser Tyr Asp Glu Leu Lys Ala Leu Ala Asp Thr Phe Ser Leu Asp Glu Asn Gly

Asn Lys Leu Lys Lys Gly Lys His Gly Met Arg Asn Phe Ile Ile Asn Asn Val Ile

Ser Asn Lys Arg Phe His Tyr Leu Ile Arg Tyr Gly Asp Pro Ala His Leu His Glu

Ile Ala Lys Asn Glu Ala Val Val Lys Phe Val Leu Gly Arg Ile Ala Asp Ile Gln

Lys Lys Gln Gly Gln Asn Gly Lys Asn Gln Ile Asp Arg Tyr Tyr Glu Thr Cys Ile

Gly Lys Asp Lys Gly Lys Ser Val Ser Glu Lys Val Asp Ala Leu Thr Lys Ile Ile

Thr Gly Met Asn Tyr Asp Gln Phe Asp Lys Lys Arg Ser Val Ile Glu Asp Thr Gly

Arg Glu Asn Ala Glu Arg Glu Lys Phe Lys Lys Ile Ile Ser Leu Tyr Leu Thr Val

Ile Tyr His Ile Leu Lys Asn Ile Val Asn Ile Asn Ala Arg Tyr Val Ile Gly Phe His

Cys Val Glu Arg Asp Ala Gln Leu Tyr Lys Glu Lys Gly Tyr Asp Ile Asn Leu Lys

Lys Leu Glu Glu Lys Gly Phe Ser Ser Val Thr Lys Leu Cys Ala Gly Ile Asp Glu

Thr Ala Pro Asp Lys Arg Lys Asp Val Glu Lys Glu Met Ala Glu Arg Ala Lys Glu

Ser Ile Asp Ser Leu Glu Ser Ala Asn Pro Lys Leu Tyr Ala Asn Tyr Ile Lys Tyr

Ser Asp Glu Lys Lys Ala Glu Glu Phe Thr Arg Gln Ile Asn Arg Glu Lys Ala Lys

Thr Ala Leu Asn Ala Tyr Leu Arg Asn Thr Lys Trp Asn Val Ile Ile Arg Glu Asp

Leu Leu Arg Ile Asp Asn Lys Thr Cys Thr Leu Phe Arg Asn Lys Ala Val His LeuGlu Val Ala Arg Tyr Val His Ala Tyr Ile Asn Asp Ile Ala Glu Val Asn Ser TyrPhe Gln Leu Tyr His Tyr Ile Met Gln Arg Ile Ile Met Asn Glu Arg Tyr Glu LysSer Ser Gly Lys Val Ser Glu Tyr Phe Asp Ala Val Asn Asp Glu Lys Lys Tyr AsnAsp Arg Leu Leu Lys Leu Leu Cys Val Pro Phe Gly Tyr Cys Ile Pro Arg Phe LysAsn Leu Ser Ile Glu Ala Leu Phe Asp Arg Asn Glu Ala Ala Lys Phe Asp Lys GluLys Lys Lys Val Ser Gly Asn Ser Gly Ser Gly Pro Lys Lys Lys Arg Lys Val AlaAla Ala Tyr Pro Tyr Asp Val Pro Asp Tyr Ala*

2. Construction of pENTR4 gRNA4-AtU6-crRNA recombinant vector

A380 bp AtU-crRNA (shown as SEQ ID No. 3) gene fragment is artificially synthesized and cloned onto a pENTR4:gRNA4 vector, named pENTR4:gRNA 4-AtU-crRNA, and chemically synthesized by the division of biological engineering (Shanghai). The specific construction method is as follows: and (3) using a HindIII linearized pENTR4:gRNA4 vector, recovering a linearized vector skeleton of about 2.2kb, artificially synthesizing a 380bp AtU-crRNA gene fragment containing two BsaI enzyme cutting sites, directly synthesizing the fragment onto the pENTR4:gRNA4 vector through the HindIII enzyme cutting sites to obtain the pENTR4:gRNA 4-AtU-crRNA vector, sequencing the plasmid, preserving the plasmid, and transforming the E.coli after verification success.

As shown in FIG. 2, the construction of plasmid pENTR4: gRNA4-AtU6-crRNA is as follows: atU6 promoter, crRNA repeat leader sequence, spacer nucleotide sequence containing two BsaI cleavage sites.

SEQ ID No.3

aagcttcattcggagtttttgtatcttgtttcatagtttgtcccaggattagaatgattaggcatcgaaccttcaagaatttgattgaataaaacatcttcattcttaagatatgaagataatcttcaaaaggcccctgggaatctgaaagaagagaagcaggcccatttatatgggaaagaacaatagtatttcttatataggcccatttaagttgaaaacaatcttcaaaagtcccacatcgcttagataagaaaacgaagctgagtttatatacagctagagtcgaagtagtgattgaacccctaccaactggtcggggtttgaaacagagaccagaattcggtctcatttttttttggatccactagtcctgcagg

EXAMPLE 2 construction of Rice pCAMBIA1300-RfxCas13d-BSJ-crRNA vector

The technical method for knocking down plant circRNA by actually applying crRNA mediated CRISPR/RfxCas13d editing technology based on BSJ locus in plants in the embodiment specifically adopts experimental plants as model plant rice, but the experimental plants are not limited to rice species, and other plant species can be selected for optimization, such as tomatoes, arabidopsis and the like.

Taking rice 3 circrnas (chr03_30006457_30006842, chr08_27737960_27738788, chr07_176529_176845) as an example, designing 30bp (15 bp each) gRNAs targeting sequence for the BSJ site of the circrnas as shown in SEQ ID No.4-6, synthesizing an RfxCas13d-BSJ-gRNA target sequence primer by the division of biological engineering (Shanghai) Co., ltd, diluting the two oligonucleotide primers to 50 mu M respectively as shown in SEQ ID No.7-12, and annealing according to the reaction system of Table 1; the linearized vector pENTR4 is gRNA 4-AtU-crRNA, bsaI is digested and reacted for 1h at 37 ℃, and the reaction system is shown in Table 2; the double-stranded oligonucleotide product was ligated to the linearized vector pENTR4 gRNA4-AtU6-crRNA, the ligation reaction system being shown in Table 3; the gRNA4-AtU6-BSJ-crRNA vector constructed in the above steps is used as a template, primers with HindIII and SbfI enzyme cutting sites are designed, atU-BSJ-crRNA fragments with HindIII and SbfI enzyme cutting sites are amplified, hindIII and SbfI are used for carrying out double enzyme cutting on the pCAMBIA1300-RfxCas13d recombinant vector, a connection reaction system is shown in Table 4, and finally the pCAMBIA1300-RfxCas13d-BSJ-crRNA vector is obtained through a homologous recombination mode, and the connection reaction system is shown in Table 5. Finally, through PCR and enzyme digestion verification, the plasmid is stored after sequencing, and the transformed escherichia coli is stored after verification is successful. Finally, the pCAMBIA1300-RfxCas13d-BSJ-crRNA vector of the specific targeting rice circRNA BSJ site is obtained.

TABLE 1 annealing ligation System for oligonucleotide primers

The annealing procedure is as follows: 95 ℃ for 2min; -0.1 ℃/8s, down to 25 ℃, about 90min.

TABLE 2 cleavage of pENTR4 gRNA4-AtU6-crRNA System

After the reaction at 37℃was completed, the reaction was inactivated at 80℃for 2min.

Table 3T4 enzyme ligation System

After reaction for 1h at 22 ℃, the ligation product was directly transformed into E.coli strain, and the strain P was confirmed by sequencing.

TABLE 4 enzyme digestion system

Reagent(s)	Volume mu L
		pCAMBIA1300-RfxCas13d	1μg
HindIII	1
		SbfI	1
10x buffer T	4
		Sterile deionized water	Up to 50
Total volume of	50

After 1h reaction at 37 ℃, running the gel and recovering the DNA fragment of linearized pCAMBIA1300-RfxCas13 d.

TABLE 5 homologous recombinase ligation System

After 1h reaction at 50 ℃, the product is directly transformed into an escherichia coli strain, and sequencing verifies that the correct strain is preserved.

The sequence listing according to this example is shown in table 6 below.

Table 6 sequence listing

/>

/>

/>

Example 3 specific knock-down of Rice circRNA Using Rice pCAMBIA1300-RfxCas13d-BSJ-crRNA

1. Transgenic Rice plant harvesting

The rice japonica rice variety Nippon is used as a test material, the constructed pCAMBIA1300-RfxCas13d-BSJ-crRNA expression vector is transferred into rice callus through agrobacterium mediation, and a transgenic rice plant is obtained through tissue culture.

2. Real-time fluorescent quantitative PCR detection of expression of circRNA and its corresponding female parent mRNA the seedling stage wild rice and transgenic rice plant grown for about 1 month are sampled, RNA is extracted, and the expression of circRNA and its corresponding female parent mRNA is detected by real-time fluorescent quantitative PCR. The sequence of the circRNA detection primer is shown as SEQ ID No.13-18, the sequence of the corresponding parent mRNA detection primer is shown as SEQ ID No.19-24, and the sequence of the corresponding parent mRNA is shown as SEQ ID No. 25-27.

As shown in fig. 3, the expression level of 3 girrnas in rice was significantly reduced compared to the control, while the expression level of the corresponding maternal mRNA was not knocked down (fig. 4), indicating that the expression of girrnas in rice could be specifically knocked down by CRISPR/RfxCas13d vector system.

Table 7 sequence listing

SEQ ID No.25 (1 maternal mRNA sequence: > Os03t 0732100-01)

atgggaatagcggcgccaccgtgtcagccagggcagaccaccacgttcgtcataagccaacccaccagcagcaagagctccccggcggcgatcgtcgtccggccgccggccacggcgagttcttcttctatgtcccactcccagggtttccaccagcccagcagcggcgccgtcttcggcttctcctccgatggcttcgacggccgccccggctccggccaagaccaccagcagcacgagcagcagcagcagcagcacgtggcgcagcagagccgccgcgacaagctgagggtgcaaggcttcgacccggcggcggcggcggcggggcacgggttgctccccatcgagggcgacgagcatggcgcggagcccggcgccatgtacgaccacgcggaggcggcggcggccggggcgtcgaacatgctctccgagatgttcaacttcccgtcgcagccgccgacgggcccctccgccaccgagctgctcgccagccagatgaacgccaactaccggttcgggttccggcaggcggcgggtttggccggcggcgaaggcggttggttcggcggcggcggcgcggccggccggactgggttggtgctcggtggggccagcttgggttcgttaggtgagacgtcgtcgccgaagcagcaagcgagcggcatggcgggcctcgccgctgacccggccgcggcgatgcacctgttcctgatgaacccgcagcagcagcagcagcagcagtcacggtcgtcgacgtcgccgccgccgtcggacgcgcagtcggcaatccaccagcaccacgaagcgttccaggcgttcggcggcgccggtgcagcagcgttcggcggcggcgcggcggccggcgtggtggaaggccaggggctctccctctcgctgtcgccgtcgctgcagcagctggagatggcgaagcaggcggaggagctgcgcgtccgcgacggcgtgctctacttcaaccggcaacagcagcagcagcaggcggcggcggcggcggcgtcggtgcagcagcagctcccgatggcattgcacgggcaggtcggcgtgctggggcagcagctgcacggcggcgggtacggcggcccggcgggcgtcgccggcgtcctccgcaactccaagtacacccgcgcggcgcaggagctcctcgaggagttctgcagcgtcggccgcggccagatcaagggcggcggcggccgcggctccgcccccaataaccctaactccagcaaggccgccgcctccagctccggcgccgcccagtccccctcgtcggcgtccaaagaaccccctcaactctcccccgccgaccgcttcgagcaccagcgcaagaaggccaagctcatctccatgctcgacgaggtggacaggaggtacaaccactactgcgaccagatgcagatggtggtgaacttcttcgactcggtgatggggttcggggcggcgacgccgtacacggcgctggcgcagaaggccatgtcgaggcacttccggtgcctcaaggacgcgatcgcggcgcagctgagggggacgtgcgaggcgctgggggagaaggacgccggcacggggtcggggctgaccaagggggagacgccgcggctgcgggccatcgaccagagcctccggcagcagcgcgccttccaccacatggggatcatggagcaggaggcgtggcgcccccagcgcggcctccccgagcgctccgtcaacatcctccgctcctggctcttcgaacacttcctccacccgtacccgagcgatgcagataagcacctgttggcgaggcagaccgggctgtccaggaaccaggtctcgaattggttcatcaacgcccgtgtccggctatggaagcccatgatcgaggagatgtaccagcaagaatgcaaggagctcgagggctcctccggcgccggcgacgacccctccggcgccgacgacacgcactcgccgacgaccaccgccgccgcgcatcatcagcacaggcacggccagctaatggtagagcacggcggcgcgtccagcggcggcggcgccgccatgtcgtcgcacaagcacgagcccggcgtcgtcgcggggccctcctcgtcgtcggcggcggcggtggcggacgccgccttcgtcggcatcgacccggtggagctcctcggcggcgacggcgcggcggccgacgacctgtacgggcggttcgacccggccggcgccgtcagggtgcggtacgggccggcgggcgccgccgccggcgccgccgcggcggcggccggcgacgtgtcgctgacgctgggcctgcagcacgccggcgccggcaacgccgggcccgacggcagcggccgcttctccttgcgagactacagtggttgctga

SEQ ID No.26 (2 maternal mRNA sequence: > Os08t 0554400-01)

atggcagccgcctcgtctgcacactacttcggtctcggcgagccgcagatgcagcagcagcagcagcagcctcccctgcagaacaacgcggctgctccggtcgcggccacgccgccgcccaagaagaagaggaatcagcccgggaatccaaatcctgatgcggaggtggtggcgctgtcgccgcacacgctgctggcgacgaacaggttcgtgtgcgaggtgtgcaacaaggggttccagagggagcagaacctgcagctgcaccggcgagggcacaacctgccatggaagctgaagcagaagaaccccaaggagacgcggcggcgggtgtacctgtgcccggagccgtcctgcgtccaccacgacccgtcgcgagccctcggcgacctcaccggcatcaagaagcactactcccgcaagcacggcgagaagaagtggaagtgcgacaagtgcaacaagcgctacgccgtccagtccgactggaaggctcactccaagacctgcggcacccgcgagtaccgctgcgactgcggcaccctcttctccaggagggacagcttcatcacccaccgcgccttctgcgacgcgctggcgcaggagagcggcaggattatgccacccatgggcgccgccctgtacgccgccgccggcgccggcatggccatcggcggcctcaccggcatggccgcctcccaccagctccaaccgttccaggaccactcctccgccatcaccaccgccgccaacgccgccgcgcagttcgaccacctcatggccacgtcgtccgccgcggccggctcccctgcgttccgcgccgcgcagccgacgtcgtcgtcctcctcgccgttctacctcggcggcggcggcgacgacggacaggcccacacctcgctgctccacggcaagccggcgttccacggcctaatgcagctgccggagcagcaggggagcaatggcggcggcctccttaacctgagctacttctccggcgggaacggcggccaccaccaccaccaccaggagggacgactcgtcttcccggatcagttcaacggcgtcgccgccgggaacggcgcccgcgccggcagcggcgagcacggcaacagcggtaacaacgccgactcggggagcatcttctccgggaacatgatgggcggcggcggcggcttctcgtccttgtacagctcgtccgaccagaccgtcccgccgccgcagatgtcggcgacggcgcttctccagaaggccgcacagatgggcgcgacgacgagcagcggcggcgccggcagcgtgaactcgctactcagaggtctcggaagcggcggcggcggcggcgctctgaacggtaagcccgccggagcagccgggttcatcatgtccggggagagctcgtcgaggagcactgcttctcagacggcggagaacgagagccagctccgggagctgatgatgaacacgctctcggcgaccgggggcggcaccggcgccggaacggtgttcgtcggcggcggcttccccggcgtggacgacggcaagctgagcacgagggacttcctcggcgtgagcggcggcgcgccggggcttcaactgcggcacggcggcgccgccgggatgggcatggccggctcactggaccaagagatgaagtaa

SEQ ID No.27 (3 maternal mRNA sequence: > Os07t 0482566-01)

cggcgtttctcttctctgcctccacaccgcgccccattcccatgtgaaggagctcgtctgcttctcttgctccacaccttgaccacgagccattccaccgcattctctaattaagctgggagggagaaggacaccggcgggtgcccatcgtcgagcacctggtgtgcactcgcgctcggctccgcatctgctccgcttcaccactgcctcgacagcgaccggtcgatctcctccgacaacccaaagcaaggcaagcctagcggaaaggccagagtcagtatcttcgtccaatcgctagtcgctagatggccgatatagccgctaacgaagctgaccaacaggctgctggacctgcaagcgatcccgtacggccacaagtggatccccagctgctgatggctgctcgccgcggcgacagcgatctgctcaaggagctgctggggctcaacatggatccacttgtgacatcagagggagtcgtcgtcgtcgtggacgtcgtcccgcctccccggcgtactcctcctgctgcggctgcggctgctggtgatgttgatcgaaccggtcacctcctcactcccggcggcggcgccaccgccacttgatggggtgacagccgagggggctccctgctgcacgtggtcgcggagtgcggggacagccacaagttccgcgactgcaccaggctgatctactacagggagaagcacctcctggacgcgcccaacggcaatggtgacacgcccctgcactgcgccgcggccgccgggaacgccgagatgatctccttcctcatccacctcgcggccgccggcgacgacggaaatacggaggcggagaaggcggagaaggaggtggcgtacctgagaatgcacaacaaccgtggggagaccgcgttgcaccatgcggtccgtgcagctgctgctgctgccgacaacgaggacgataagcagctggccctggactgcatcgaccagctgatggccgccgatccacagctggccgccatccaacacccgaatgagaaggctgcttccccattgtacctggccatctcactgggtgaaattggcattgcaaagcatctgttcgacaaaactgaaggcgagctgtcctactccggaccagatggacggaacgtctggcatgcagctgtttcttttcctcaagcgctagatatggttttggaatggttcaacgataagcaattgatggcggccgacatgcggcaacaagaaggtggggatcaccggcatgtggcagctgatgatgaactcctcgcgcggctcagtagccagagggacaatgacaacgggagcacacctcttcacttggccgcatcaattaacgggttaccgtcggcactatatattcccatatgttctccgcgagttttggcgccgttgcggcggccaaagccggtggagctgctgctgaaagccaacgaattcgcggcgtaccagccggacaaccaagggatgtacccaatacacgccgccgcgtcggctggcagcctggagaccgtgaagatcctgcttgagaaacacccagactgcgccactctgcgagatgcgagaggaagaactttcctccacgctgctgttgagaagaagaggtttggagtggttaagtatgtatgccactggaagaggaaggaaaggtttgcattgatcctgaatgcacaggacaataacggggacaccgcgctatccatgctggagatcttggagtcttccgacgccttatttggtgtcataaggaacgcttggacgtaccgaattaaataagaagggcatgagacctattgatgtttcatggagcatgatgcctctaaaatgttattatgcatgggatctaagagtccacatacgaacattgctattgaaattgggagctccatatggtgaaagtcagagccacatcttcaacaaaaaacgacacgccatcatcgtcgaccccaaatttaaaggaggcgaggaaaagatgttggagaatgtaacagctgcaacgcaagtcttggcccttttctccgtcctcatcacaaccgtgacatttgcgtcggttttcacgttgcccggaggctaccggtctgccggcgatggtggcagtgccgccggcacgccgttgcttgctgggcgtgggtgctacgctttcgatgcgtttatcctctctgacgctctagcattcgtttgctatttcatggctacgtccgtcctgctctatgccggggtgcctgcttataaactcgaggtccgcctccgccacattaattttgcatatagcctgatgatgaattctggaagaagcttggcggccgctgtagctttgggactctacgtggtgctgcttccaccggttggccgcaccattgcgatcgcgatcgctgccgcgatggtcatgcttgcacttctgctcagcaaggcatcagaaggcatcgagtctctcttcggcattgctattgcaagaaaccggaagctgtcaattcgagactctgtggtaggcttcactatatatgtgggggaacgctattggtccttcatcctaatcttcggcctcccagcaattcgtaagtgggcaagggcagggtaagatattaagcacgtacatggacgaccttaattcacattcggacatcatcacgtacggccggaacagttaatgcatgtgtgtgtcgttgtttttatgatcatttgtattactatacctgtctcacaatctcccatatatataattatcgcatacgtcgtccaattgtaataatgtaataaactaacctcatgtacgtcgttgcctgttgttcattattcagcttattaaaataaacaaggggcaactatgtgtcgtgcgttcttgccagcccctatatattttttca

In summary, the invention is a technical method for successfully knocking down plant circRNA by using a CRISPR-Cas13d system aiming at BSJ site specificity. It has obvious difference from the traditional method for knocking down the plant circRNA: the traditional method for knocking down the plant circRNA is to directly knock down the exons or flanking introns forming the circRNA by using a CRISPR-Cas9 system, but the method can also knock down or reduce the expression of the parent mRNA, and has non-specificity; the invention eliminates the limitation of the gene targeting site, does not reduce the expression of the parent mRNA in the targeting process of the plant circRNA BSJ site, and can obtain higher plant circRNA targeting efficiency.

Although embodiments of the present invention have been disclosed above, it is not limited to the details and embodiments shown and described, it is fully applicable to the various fields of adaptation of the present invention and further modifications will be readily apparent to those of ordinary skill in the art, and thus the present invention is not limited to the specific details and illustrations shown and described herein without departing from the general concepts defined in the claims and their equivalents.

Claims (10)

1. A method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system, comprising the steps of:

s1, designing and synthesizing a target gene sequence coding for RfxCas13d with plant codon preference, and constructing a pCAMBIA1300-RfxCas13d recombinant vector;

s2, synthesizing a AtU6-crRNA gene fragment, wherein the AtU6-crRNA gene fragment comprises two BsaI enzyme cutting sites, and constructing a pENTR4:gRNA4-AtU6-crRNA recombinant vector;

s3, synthesizing and constructing a pCAMBIA1300-RfxCas13d-BSJ-crRNA vector of a specific targeting plant circRNA BSJ site;

s4, transferring the constructed pCAMBIA1300-RfxCas13d-BSJ-crRNA expression vector to plant callus, and obtaining a transgenic plant with specificity knockdown plant circRNA through tissue culture.

2. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 1, wherein in step S1, the pCAMBIA1300-RfxCas13d recombinant vector comprises CaMV 35S promoter, hygromycin gene, caMV poly (a) signal terminator, pVS1 RepA, pVS1 replication origin, rice ubiquitination promoter, SV40 NLS-RfxCas13d-SV40 NLS and NOS terminator.

3. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 2, wherein step S1 comprises the steps of: the target gene sequence encoding RfxCas13d is optimized and synthesized through plant codon preference, and is directly cloned to a linearized pUC57 vector, which is named pUC57: rfxCas13d. Based on CRISPR/spCas9 vector, plasmid pUC57 was purified using BamHI and NcoI: double digestion is carried out on the RfxCas13d and the CRISPR/spCas9 vector, 3003bp RfxCas13d gene fragments and about 12.6kb CRISPR/spCas9 vector frameworks are respectively recovered, the 3003bp RfxCas13d fragments are connected to the CRISPR/spCas9 vector frameworks by using T4 DNA ligase, the plasmid is named pCAMBIA1300-RfxCas13d, the plasmid is stored after sequencing, and the transformed escherichia coli is stored after verification.

4. The method for specifically knocking down plant circRNA based on a CRISPR/RfxCas13d system according to claim 2, wherein the nucleotide sequence of the SV40 NLS-RfxCas13d-SV40 NLS gene is SEQ ID No.1.

5. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 2, wherein the amino acid sequence encoded by RfxCas13d is SEQ id No.2.

6. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 1, wherein in step S2, pENTR4: gRNA 4-AtU-crRNA recombinant vector comprises AtU6 promoter, crRNA repeated leader sequence, spacer nucleotide sequence containing two BsaI cleavage sites.

7. The method for specifically knocking down plant circRNA based on the CRISPR/RfxCas13d system according to claim 6, wherein the base sequence of AtU-crRNA gene fragment is SEQ ID No.3.

8. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 6, wherein step S2 comprises: and (3) linearizing the pENTR4:gRNA4 vector by using HindIII, recovering a linearization vector skeleton, artificially synthesizing a AtU-crRNA gene fragment containing two BsaI enzyme cutting sites, directly synthesizing the fragment onto the pENTR4:gRNA4 vector by using the HindIII enzyme cutting sites to obtain the pENTR4:gRNA 4-AtU-crRNA vector, sequencing the plasmid, preserving the plasmid, and transforming the escherichia coli after verification is successful and preserving the plasmid.

9. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 1, wherein step S3 comprises: designing a gRNAs targeting sequence aiming at a BSJ site of the circRNA, synthesizing an RfxCas13d-BSJ-gRNA target sequence primer, and connecting the primer to BsaI linearized pENTR4:gRNA 4-AtU-crRNA carrier in a primer annealing mode; and (3) taking the gRNA4-AtU6-BSJ-crRNA vector constructed in the previous step as a template, designing primers with HindIII and SbfI enzyme cutting sites, amplifying AtU-BSJ-crRNA fragments with HindIII and SbfI enzyme cutting sites, carrying out double enzyme cutting on the pCAMBIA1300-RfxCas13d recombinant vector by using HindIII and SbfI, and finally obtaining the pCAMBIA1300-RfxCas13d-BSJ-crRNA vector by a homologous recombination mode.

10. The method for specifically knocking down plant circRNA based on CRISPR/RfxCas13d system according to claim 1, wherein said plant comprises rice, tomato, arabidopsis.