CN117487924A

CN117487924A - MEN1 gene mutant, mutant protein, reagent and application

Info

Publication number: CN117487924A
Application number: CN202311849197.1A
Authority: CN
Inventors: 曾桥; 刘亚宁; 徐霞
Original assignee: Hunan Jiahui Biotechnology Co Ltd
Current assignee: Hunan Jiahui Biotechnology Co Ltd
Priority date: 2023-12-29
Filing date: 2023-12-29
Publication date: 2024-02-02
Anticipated expiration: 2043-12-29
Also published as: CN117487924B

Abstract

The invention provides a MEN1 gene mutant, mutant protein, reagent and application; wherein the mutation of the MEN1 gene is compared with the wild type MEN1 gene, and the 78 th base of the wild type MEN1 gene is mutated from G to C. The gene mutant provided by the invention can be used for screening or diagnosing pathogenic gene mutant patients with multiple endocrine adenomatosis type 1, so as to provide prenatal diagnosis, prenatal and postnatal care and therapeutic intervention guidance, and provide a brand-new theoretical basis for treating patients with multiple endocrine adenomatosis type 1.

Description

MEN1 gene mutant, mutant protein, reagent and application

Technical Field

The invention relates to the technical field of medical diagnosis, in particular to a MEN1 gene mutant, mutant protein, a reagent and application.

Background

Multiple endocrine adenomatosis type 1 (Multiple endocrine neoplasia; MIM 131100), also known as multiple endocrine tumor syndrome I, is an autosomal dominant disease characterized by familial parathyroid, islet, and anterior pituitary tumors. Some MEN1 patients may also develop adrenocortical tumors, carcinoids, lipomas and pheochromocytomas. The incidence rate is lower than 1/100000. The clinical manifestations are thyroid abnormality, growth hormone increase, lactation hormone excess, milk coffee, subcutaneous lipoma, hypoglycemia, diarrhea, zollinger-Ellison syndrome, hypercalcemia, increased blood cortisol levels, peptic ulcers, pituitary prolactinoma, mottle-like hypopigmentation spots, adrenal cortical adenoma, islet cell adenoma, sebaceous adenoma, insulinoma, glucagon tumor, prolactinoma, carcinoid, lipoma, collagenoma, meningioma, esophagitis, etc. The apparent rate of the disease at age 50 was 94%.

The pathogenic gene MEN1 (MIM 613733) of the multiple endocrine adenomatosis type 1 is located on chromosome 11q13.1, the total length of the gene is 7.8kb, and the gene comprises 10 exons and 9 introns, and encodes the gin containing 615 amino acids. The menin is mainly a nucleoprotein, plays roles in transcription regulation, genome stability, apoptosis, cell cycle regulation and the like through interaction with other proteins, and the reduction of the level of the menin can lead to anterior pituitary tumor, parathyroid tumor and multiple endocrine adenomatosis type 1. The MEN1 gene is expressed as a tumor suppressor gene in many embryonic and adult tissues. Mutation sites of the MEN1 gene are scattered in the open reading frame of the MEN and the vicinity thereof, and 9 encoded exons can occur. The mutation types are various, no clear mutation hot spot exists, and about hundreds of different MEN1 gene mutations including germ line mutation, somatic mutation and the like are discovered up to the present.

Gene mutation is an important genetic basis for the development of multiple endocrine adenomatosis type 1, and gene diagnosis is an important standard for diagnosing multiple endocrine adenomatosis type 1. The method has the advantages that corresponding detection technologies are established aiming at different mutations in clinic, the detection methods are developed and used for defining the etiology and disease diagnosis, mutation sites are determined, the screening and diagnosis of the type 1 gene mutation of the assisted multiple endocrine adenomatosis are realized, and the method has important significance for drug screening, drug effect evaluation and targeted treatment.

Disclosure of Invention

The invention mainly aims to provide a MEN1 gene mutant, mutant protein, a reagent and application thereof, so as to solve the technical problems of screening and diagnosing multiple endocrine adenomatosis type 1.

In order to achieve the above object, the present invention provides a MEN1 gene mutant in which a base at position 78 of a wild-type MEN1 gene is mutated from G to C, as compared with the wild-type MEN1 gene.

The invention also provides a MEN1 mutant protein, wherein compared with a protein encoded by a wild MEN1 gene, the 26 th amino acid is mutated from glutamic acid to aspartic acid.

The invention also provides application of the MEN1 gene mutant serving as a detection target in preparation of a detection reagent for the type 1 multiple endocrine adenomatosis and/or a detection kit for the type 1 multiple endocrine adenomatosis.

According to embodiments of the present application, the detection reagent and/or the detection kit comprises amplification primers comprising an upstream primer MEN1-1F and a downstream primer MEN1-1R; the upstream primer MEN1-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer MEN1-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

According to embodiments of the present application, the detection reagent and/or the detection kit comprises sequencing primers comprising an upstream primer MEN1-Seq1F and a downstream primer MEN1-Seq1R; the upstream primer MEN1-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer MEN1-Seq1R comprises a nucleotide sequence shown as SEQ ID NO. 4.

The invention also provides application of the MEN1 mutant protein serving as a detection target in preparation of a detection reagent for multiple endocrine adenomatosis type 1 and/or a detection kit for multiple endocrine adenomatosis type 1.

The invention also provides a detection reagent for the type 1 multiple endocrine adenomatosis, which comprises the MEN1 gene mutant or the MEN1 mutant protein.

The invention also provides a detection kit for the type 1 multiple endocrine adenomatosis, which comprises the detection reagent for the type 1 multiple endocrine adenomatosis.

The beneficial effects of the invention at least comprise:

the invention provides a MEN1 gene mutant, which is mutated from G to C at the 78 th base of a wild type MEN1 gene compared with the wild type MEN1 gene. Furthermore, the invention discovers that the MEN1 gene mutant can cause multiple endocrine adenomatosis type 1.

The MEN1 gene mutant provided by the invention enriches the pathogenic mutation spectrum of the type 1 of the multiple endocrine adenomatosis, can screen or diagnose the pathogenic gene mutant patient of the type 1 of the multiple endocrine adenomatosis by detecting whether a subject carries the MEN1 gene mutant, is used for genetic diagnosis of the type 1 of the multiple endocrine adenomatosis, provides prenatal diagnosis, prenatal and prenatal care and therapeutic intervention guidance, provides brand-new theoretical basis for the treatment of the type 1 of the multiple endocrine adenomatosis, and provides a possible drug target for the treatment of the type 1 of the multiple endocrine adenomatosis.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to the structures shown in these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a family genetic map of multiple endocrine adenomatosis type 1, type 1; wherein, Σ represents a normal male individual, ■ represents a male patient, ∈r represents a female patient, ∈r represents a fetus, ↗ represents a forerunner;

FIG. 2 is a graph showing the results of detection of genotypes at the position of the MEN 1:NM-000244.4:exo2:c.78G > C:p.E26D family of families No.1, using Sanger sequencing, wherein layers A and C: heterozygote mutation in family 1; b and D layers: genotype in line 1 is wild type (position of mutation indicated by arrow in sequencing diagram);

FIG. 3 is a family genetic map of multiple endocrine adenomatosis type 1, type 2; wherein O represents a female normal individual, ■ represents a male patient, +.represents a female patient, ↗ represents a forerunner;

FIG. 4 is a graph showing the results of the detection of genotype of the ancestor MEN1: NM-000244.4: exo2: c.78G > C: p.E26D locus of family 2 using the kit; wherein A, C and D layers: heterozygote mutation in family 2; layer B: genotype in line No.2 is wild type (position of mutation indicated by arrow in sequencing).

The achievement of the object, functional features and advantages of the present invention will be further described with reference to the drawings in connection with the embodiments.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, are intended to fall within the scope of the present invention.

In the present invention, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, the terms related to molecular genetics, nucleic acid chemistry and molecular biology and laboratory procedures used herein are all widely used terms and conventional procedures in the corresponding field. Meanwhile, in order to better understand the present invention, definitions and explanations of related terms are provided below.

In the present invention, the term "autosomal dominant inheritance" means that whenever a pathogenic gene is present on one of parents' autosomes and transmitted to children, whether or not another gene of children is normal, it may cause a disease regardless of sex. The patients with family history of genetic diseases need to be checked before pregnancy to avoid the influence of the genetic diseases on the next generation.

In the present invention, the term "heterozygous mutation" means that the mutation exists in only one gene of a pair of alleles.

In the present invention, the term "homozygous mutation" means that the same mutation occurs in all alleles, that is, a double allelic mutation, and each chromosome is mutated.

In the present invention, the term "missense mutation" means that a codon encoding an amino acid is changed into a codon encoding another amino acid after base substitution, thereby changing the kind and sequence of the amino acid of the polypeptide chain.

The term "diagnosis" herein includes prediction of disease risk, diagnosis of the onset or absence of a disease, and also the assessment of disease prognosis.

The term "prenatal diagnosis" herein refers to definitive diagnosis of a high-risk fetus based on genetic counseling, mainly through genetic detection and imaging examination, and achieves the purpose of fetal selection through selective abortion of a diseased fetus, thereby reducing birth defect rate and improving prenatal quality and population quality.

In the present invention, a "primer" refers to a polynucleotide fragment, typically an oligonucleotide, containing at least 5 bases, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more bases, for amplifying a target nucleic acid in a PCR reaction. The primer need not be completely complementary to the target gene to be amplified or its complementary strand, as long as it can specifically amplify the target gene.

Moreover, the technical solutions of the embodiments of the present invention may be combined with each other, but it is necessary to be based on the fact that those skilled in the art can implement the embodiments, and when the technical solutions are contradictory or cannot be implemented, it should be considered that the combination of the technical solutions does not exist, and is not within the scope of protection claimed by the present invention.

In order to enrich the pathogenic mutation spectrum of the type 1 multiple endocrine adenomatosis, the type 1 multiple endocrine adenomatosis is accurately judged, and the method is used for genetic diagnosis of the type 1 multiple endocrine adenomatosis to guide treatment, genetic diagnosis before embryo implantation and prenatal and postnatal care.

The invention provides a MEN1 gene mutant, wherein the MEN1 gene mutant is mutated from G to C at the 78 th base of a wild type MEN1 gene compared with the wild type MEN1 gene.

In the present invention, the c.78G>C represents MEN1GeneIs the first of (2)Mutation of base G at position 78 to C yields a sequence comprising SEQ ID NO.5 (5' -TGCCGACThe nucleotide fragment shown in CTGGGC-3' (the letter in underlined is the base after mutation). Base 78 is specifically located in exon 2. Specifically, the accession number of the wild-type MEN1 gene is NM_000244.4, and the specific nucleotide sequence of the wild-type MEN1 gene is shown as SEQ ID NO. 48. The specific nucleotide sequence of the MEN1 gene mutant is shown as SEQ ID NO. 49.

The c.78G>C results in encoded MEN1 protein and wild type MEN1GeneThe mutation of amino acid 26 from glutamic acid (E) to aspartic acid (D), i.e. missense mutation, is marked as MEN1: NM-000244.4: exon2: c.78G in comparison with the encoded protein>C.E26D wherein the sequence of the mutated core amino acid is shown in SEQ ID NO.6 (LFAADLGRE) (the letter at the underlined position is a mutated amino acid), resulting in a truncated protein, affecting normal MEN1 function, causing multiple endocrine adenomatosis type 1, having pathogenicity. Specifically, the wild-type MEN1 gene encodes a protein with an amino acid sequence of NP-000235.3 as shown in SEQ ID NO. 50. The sequence of the complete amino acid of the protein coded by the MEN1 gene mutant is shown as SEQ ID NO. 51.

In order to avoid false positive results, the invention uses exon sequencing to screen pathogenic gene mutation highly related to multiple endocrine adenomatosis type 1, and verifies through Sanger sequencing, and when c.78G > C exists in MEN1 genes for the first time, the mutation is related to multiple endocrine adenomatosis type 1, so that the multiple endocrine adenomatosis type 1 can be detected by detecting whether c.78G > C exists in MEN1 genes.

The MEN1 gene mutant provided by the invention can distinguish multiple endocrine adenomatosis type 1 patients from normal human groups, is a biomarker for diagnosing multiple endocrine adenomatosis type 1, is beneficial to screening and diagnosing multiple endocrine adenomatosis type 1 gene mutation, and provides a new technical support for drug screening, drug effect evaluation and targeted therapy.

Correspondingly, the invention also provides a MEN1 mutant protein, and compared with a protein encoded by a wild MEN1 gene, the MEN1 mutant protein has the 26 th amino acid mutated from glutamic acid to aspartic acid.

The invention also provides application of the MEN1 gene mutant or the MEN1 mutant protein serving as a detection target in preparation of a detection reagent for multiple endocrine adenomatosis type 1 and/or preparation of a detection kit for multiple endocrine adenomatosis type 1.

For example, the MEN1 gene mutant is used as a detection target to prepare a reagent for detecting the type 1 of the multiple endocrine adenomatosis; the MEN1 gene mutant is used as a detection target to prepare a kit for diagnosing multiple endocrine adenomatosis type 1; the MEN1 gene mutant is used as a detection target to prepare a kit for preventing multiple endocrine adenomatosis type 1; the MEN1 gene mutant is used as a detection target to prepare a kit for adjuvant treatment of multiple endocrine adenomatosis type 1; the MEN1 gene mutant is used as a detection target to prepare a pre-pregnancy and/or pre-parturient genetic disease screening kit; the MEN1 gene mutant is used as a detection target to prepare a diagnosis kit for the prenatal and/or pre-pregnancy genetic diseases.

In some embodiments, the detection reagent and/or detection kit comprises amplification primers for the MEN1 gene mutant, i.e., for detecting multiple endocrine adenomatosis type 1, the amplification primers comprising an upstream primer MEN1-1F and a downstream primer MEN1-1R; the upstream primer MEN1-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer MEN1-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

The nucleotide sequence of SEQ ID NO. 1-2 is specifically as follows:

SEQ ID NO.1：5’- GGGGCACAGTCGTAGAG -3’；

SEQ ID NO.2：5’- GCAAAGAGGAAAATAACACC -3’。

the primer combination can detect whether mutation sites of c.78G > C exist on the MEN1 gene, specifically amplify MEN1 gene mutants, specifically amplify MEN1 gene mutant fragments or wild MEN1 gene fragments containing the mutation sites of c.78G > C specifically, and can distinguish MEN1 gene mutants from wild MEN1 genes after sequencing by sequencing primers; the MEN1 gene mutant and the wild MEN1 gene can be distinguished after sequencing by sequencing primers.

In some embodiments, the detection reagents and/or detection kits comprise sequencing primers for the MEN1 gene mutant, i.e., for detecting type 1 endocrine adenomatosis. Sequencing primers include an upstream primer MEN1-Seq1F and a downstream primer MEN1-Seq1R; the upstream primer MEN1-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer MEN1-Seq1R comprises the nucleotide sequence shown as SEQ ID NO. 4.

The nucleotide sequence of SEQ ID NO. 3-4 is specifically as follows:

SEQ ID NO.3：5’-GAGGGGTCTCACCGACAA-3’；

SEQ ID NO.4：5’-ACTGGGCTCCAACCTGTG-3’；

sequencing the amplification product of the amplification primer 1 by using the sequencing primer 1, and distinguishing MEN1 gene mutants from wild MEN1 genes; according to the invention, the sequencing primer 1 is used for sequencing the fragments amplified by the amplification primer, so that the type 1 endocrine adenomatosis can be rapidly and accurately diagnosed.

The invention also provides a primer combination for detecting the type 1 endocrine adenomatosis, which comprises the amplification primer and/or the sequencing primer.

Sequencing the amplification products of the amplification primers by using the sequencing primers, and distinguishing MEN1 gene mutants from wild MEN1 genes; the sequencing primer is used for sequencing the fragments amplified by the amplification primer, so that the type 1 endocrine adenomatosis can be rapidly and accurately diagnosed.

The invention also provides application of the primer combination in preparation of a type 1 detection reagent for the multiple endocrine adenomatosis.

According to the embodiment of the application, the detection targets of the type 1 endocrine adenomatosis comprise MEN1 gene mutants; compared with the wild-type MEN1 gene, the mutation of the MEN1 gene is that the 1451 th base T in the 34 th exon of the wild-type MEN1 gene is mutated into G. The MEN1 gene mutant is used as a detection target to prepare a reagent for detecting the type 1 of the multiple endocrine adenomatosis; the MEN1 gene mutant is used as a detection target to prepare a kit for diagnosing multiple endocrine adenomatosis type 1; the MEN1 gene mutant is used as a detection target to prepare a kit for preventing multiple endocrine adenomatosis type 1; the MEN1 gene mutant is used as a detection target to prepare a kit for adjuvant treatment of multiple endocrine adenomatosis type 1; the MEN1 gene mutant is used as a detection target to prepare a pre-pregnancy and/or pre-parturient genetic disease screening kit; the MEN1 gene mutant is used as a detection target to prepare a diagnosis kit for the prenatal and/or pre-pregnancy genetic diseases.

The invention also provides a reagent of the MEN1 gene mutant, which comprises the primer combination in the technical scheme; the reagent preferably further comprises one or more of dNTPs, PCR buffer, magnesium ions and Tap polymerase.

The invention also provides application of the reagent in the preparation of any one or more of the kits b 1) to b 5):

b1 A type 1 kit for preventing multiple endocrine adenomatosis; b2 A type 1 kit for diagnosing multiple endocrine adenomatosis; b3 Pre-pregnancy and/or prenatal genetic disease screening kits; b4 A pre-pregnancy and/or pre-partum genetic disease diagnostic kit; b5 Type 1 kit for adjuvant therapy of multiple endocrine adenomatosis.

The invention also provides a kit for diagnosing multiple endocrine adenomatosis type 1, which comprises the reagent according to the technical scheme. The kit of the invention diagnoses whether the individual suffers from multiple endocrine adenomatosis type 1 or not through the genotype of the MEN1 gene mutant in the detection samples of the male individual and/or the female individual; the test sample preferably comprises blood and amniotic fluid. The standard for diagnosing whether an individual suffers from multiple endocrine adenomatosis type 1 by the genotype is specifically as follows:

when the genotype of the c.78G > C locus of the individual is a "c.78G > C heterozygote mutation, then the individual is a patient;

when the genotype of the c.78G > C site of the individual is "c.78G > C homozygous mutation", then the patient is;

when the genotype of the c.78g > C site of the individual is "wild type", the individual is normal;

in order to further illustrate the present invention, the primer combinations, reagents and kits for detecting type 1 endocrine adenomatosis, MEN1 gene mutants and applications provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of the present invention.

The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions such as Sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor LaboratoryPress, 2014), or as recommended by the manufacturer.

Example 1

1. Diagnostic criteria:

reference can be made to the "diagnosis and treatment guidelines for human monogenic genetic diseases" in the 2010 edition and "multiple endocrine adenoma type 1 and type 2" in the 2001 edition.

The clinical diagnosis standard of the multiple endocrine adenoma type 1 is that 2 of the 3 most common endocrine tumors (namely parathyroid tumor, pancreatic endocrine tumor and pituitary adenoma) are possessed, and the multiple endocrine adenoma type 1 can be diagnosed. In addition to satisfying this, at least 1 person in primary relatives with 1 of the above tumors can be diagnosed as familial multiple endocrine adenoma type 1.

In the diagnosis and treatment guide of MEN1, it is pointed out that the screening of MEN1 genes should be carried out for both the first-person and the unencumbered relatives of MEN 1; for the carrier of MEN1 mutant gene found by gene screening, biochemical and image examination should be periodically carried out to screen for the occurrence of tumor.

2. Object of detection

The method takes 1 multiple endocrine adenomatosis type 1 family (called No.1 family for short) as a test object, clinical information of partial members of the No.1 family is shown in a table 1, and a family map is shown in fig. 1.

TABLE 1 clinical information of multiple endocrine adenomatosis type 1 family members

Note that: i and II represent the first generation and the second generation in sequence, and the personnel I of the family 1 adopts 1, 2 and 2 peripheral blood DNA and 2 amniotic fluid DNA for sequencing.

Example 2

Exon sequencing

1. The instrument is shown in table 2.

Table 2 instrumentation

2. Reagent consumable

Human whole exon sequencing kit (Agilent), DNA 1000 kit (Agilent), 96 well plate (Axygen), different model tips (Axygen), 200 μl centrifuge tube (Eppendorf), 1.5mL centrifuge tube (Eppendorf), capillary electrophoresis buffer (Thermo), sequencing standard (Thermo), absolute ethanol (Thermo), bigDye Terminator V3.1.3.1 (Thermo), peripheral blood gDNA extraction kit (TIANGEN), agarose (TIANGEN) and EB dye solution (amerco).

3. Reagent formulation

1) A5 XTBE stock solution of electrophoresis liquid was prepared in accordance with Table 3.

Table 35 XTBE electrophoresis liquid formula

2) 0.5 XTBE working solution was run on ddH ₂ O dilution of the 5 XTBE stock solution in Table 3 was performed 10 times.

3) 10 Xerythrocyte lysate was prepared according to Table 4.

TABLE 4 10 Xerythrocyte lysate formula

4) The 1 x nuclear lysate formulation was formulated according to table 5.

Table 51 XNuclear lysate formula

4. Experimental procedure

After signing the informed consent, collecting 3-5 mL of peripheral blood of the members I, 2 and II in the family 1 and 10-20mL of amniotic fluid II in the family 1 as a study sample.

4.1 sample DNA extraction

1) 3-5 mL of sample is put into a 15mL centrifuge tube, and 2-3 times of volume of 1 Xerythrocyte lysate is added, and the mixture is uniformly mixed, and the mixture is kept stand on ice for 30 minutes until the solution becomes transparent.

2) Centrifuge at 3000rpm for 10 min at 4℃and carefully remove the supernatant. 1mL of 1 Xcell nucleus lysate was added to the pellet, mixed well, and 2mL of 1 Xcell nucleus lysate and 150. Mu.L of 20% SDS were added thereto, and shaken well until a viscous transparent state appeared. Add 10. Mu.L of 20mg/mL proteinase K and shake well. Digestion is performed at 37℃for more than 6 hours or overnight.

3) Adding saturated phenol with equal volume, mixing by light shaking, and centrifuging at 3000rpm for 10 minutes at room temperature.

4) The supernatant was carefully transferred to another centrifuge tube, and an equal volume of a phenol/chloroform mixture (phenol/chloroform volume ratio 1:1) was added and mixed well and centrifuged at 3000rpm for 10 minutes at room temperature.

5) The supernatant was carefully removed and if not clear, extracted once more with an equal volume of chloroform.

6) Transferring the supernatant into another centrifuge tube, adding diploid absolute ethanol, shaking, and obtaining white flocculent DNA. The DNA was hooked with a flame sterilized glass crochet, washed twice with 70% ethanol, dried at room temperature for 5 minutes, and then dissolved in 200. Mu.L of 1 XTE and drum-dissolved overnight. OD was measured by uv.

7) The TE-dissolved DNA can be preserved for one year at 4deg.C, and if long-term preservation is required, 2 times volume of absolute ethanol is added for preservation at-70deg.C.

4.2 exon sequencing

1) Taking 2 mug DNA, mechanically breaking to ensure that the fragment size is about 200bp, cutting glue, and recovering 150-250 bp fragments;

2) DNA fragment is used for terminal repair and A is added to the 3' -terminal;

3) Connecting sequencing joints, purifying the connection products, performing PCR amplification, and purifying the amplified products;

4) Adding the purified amplification product into an Agilent kit probe for hybridization capture, eluting and recovering the hybridization product, performing PCR amplification, recovering the final product, and performing quality control analysis by agarose gel electrophoresis on a small sample;

5) NextSeq500 sequencer sequencing and data analysis.

4.3 results

Finally obtaining the pathogenic gene mutation MEN1: NM_000244.4: exon2: c.78G > C: p.E26D; the mutation is that the 78 th base G of the 2 nd exon is mutated into C, which leads to the mutation of the 26 th amino acid from glutamic acid (E) to aspartic acid (D), namely missense mutation.

The genotype of the MEN1: NM-000244.4: exo2: c.78G > C: p.E26D locus in patient individuals from family 1 is "c.78G > C heterozygous mutation", and the genotype of this locus in normal individuals from family 1 is "wild-type".

Example 3

Sanger sequencing validation

The line exome sequencing results were further verified for MEN1: NM-000244.4: exo2: c.78G > C: p.E26D sites using Sanger sequencing. Genotype detection was performed on the 4 persons of family 1 (forerunner, forerunner father, forerunner mother, fetus) and the 100 normal persons outside family in example 1, respectively, with the loci MEN1: NM-000244.4: exon2: c.78G > C: p.E26D.

The specific method comprises the following steps:

DNA extraction

Genomic DNA was extracted according to the method of example 2.

2. Candidate primer design, verification and preference

2.1 candidate primer design references the human genome sequence database hg19/build36.3 (https:// www.ncbi.nlm.nih.gov/genome, or http:// genome. Ucsc. Edu/cgi-bin/hgGateway.

2.2 designing 21 pairs of candidate primers for mutation site c.78G > C (see Table 6), and verifying and evaluating the merits of each pair of candidate primers by PCR experiments

TABLE 6 basic conditions and verification of experimental results for c.78G > C site candidate primers

/>

Note that: after electrophoresis, the normal PCR amplification result has only one specific band, and if the primer dimer band and the non-specific product band are all the results of abnormal reaction of the primer; the target primers avoid such primers as much as possible.

2.3 candidate primer PCR verification reaction

PCR was performed according to the reaction system in Table 7 and the reaction system was kept on ice; each pair of primers was provided with 8 reaction test tubes (SEQ ID NOS 1 to 8 in Table 7).

TABLE 7 primer detection PCR reaction System

/>

Reaction conditions: the test reaction tube was placed in a PCR instrument and the following reaction procedure was performed:

the first step: pre-denaturation at 95 ℃ for 5min;

and a second step of: 30 cycles (denaturation at 95℃for 30 sec. Fwdarw. Tm annealing for 30 sec. Fwdarw. 72℃for 60 sec); (PCR amplification parameters were set according to the Tm values of the primers in Table 6).

And a third step of: extending at 72 ℃ for 7min;

fourth step: 4℃until sampling.

2.4 candidate primer PCR results agarose gel electrophoresis detection was performed to evaluate the effectiveness, specificity of the primer reactions:

1) Sealing the two ends of the gel sampler with adhesive tape, placing on a horizontal table, and placing a comb at about 1cm position at one end of the sampler.

2) Weighing 2g of agar powder in a conical flask, adding 100mL of 0.5 XTBE electrophoresis buffer, shaking uniformly, heating on a microwave oven or an electric furnace (adding asbestos gauze), taking out after boiling, shaking uniformly, reheating until the gel is completely melted, taking out and cooling at room temperature.

3) After the gel is cooled to about 50 ℃, pouring the gel into a sealed gel sampler to enable the thickness to be about 5 mm.

4) Gel is solidified and the adhesive tape is removed, and the gel and the sampler are put into an electrophoresis tank together.

5) Adding an electrophoresis buffer solution to enable the liquid level to be 1-2 mm higher than the glue surface, and pulling out the comb upwards; and (3) uniformly mixing the sample and the DNA size standard substance with the sample loading liquid by using a micropipette, and adding the mixture into each sample loading hole, wherein the DNA is sunk into the hole bottom due to the fact that the sucrose in the sample loading liquid has a larger specific gravity.

6) And (5) covering an electrophoresis tank, switching on a power supply, adjusting to a proper voltage, and starting electrophoresis. And judging the approximate position of the sample according to the indication of bromophenol blue in the sample carrying liquid, and determining whether to terminate electrophoresis.

7) Cutting off the power supply, taking out the gel, and putting the gel into an EB water solution with the concentration of 0.5g/mL for dyeing for 10-15 minutes.

8) The gel was observed under a transmissive ultraviolet irradiator at 254nm and the electrophoresis results were recorded either with a camera with a red filter or with a gel scanning system.

2.5 evaluation of results:

1) If the tube No.7 only has a bright band and no band, judging that the pair of primers and a reaction system are good in effectiveness and strong in specificity;

2) If no target band appears in the tube 7, judging that the pair of primers and the reaction system are invalid;

3) If the No.7 tube has a primer dimer band outside the target band and also has a primer dimer band in the No.2, 3, 4, 5 and 6 partial tubes, judging that the effectiveness of the pair of primers and the reaction system is poor;

4) If the No.7 tube has a nonspecific band outside the target band and also has a nonspecific band in the No.5 and 6 partial tubes, judging that the specificity of the pair of primers and the reaction system is poor;

5) If primer dimer and non-specific band outside the target band appear in the tube No.7, and primer dimer and non-specific band also appear in the tube No.2, 3, 4, 5, 6, the effectiveness and specificity of the pair of primers and the reaction system are judged to be poor.

2.6 based on the results of the statistics after the validation test of Table 7, SEQ ID NO.1 and SEQ ID NO.2 of Table 6 were selected as amplification primers for the MEN1: NM-000244.4: exo2: c.78G > C: p.E26D site.

MEN1-1F：5’-GGGGCACAGTCGTAGAG-3’（SEQ ID NO.1）

MEN1-1R：5’-GCAAAGAGGAAAATAACACC-3’（SEQ ID NO.2）

3. PCR amplification of mutation sites in family 1 personnel and 100 off-family personnel

PCR was performed according to the reaction system in Table 8 and the reaction system was kept on ice.

TABLE 8 mutation point PCR reaction system

Reaction conditions: the reaction system was placed in a PCR instrument and the following reaction procedure was performed for c.78g > C site:

the first step: pre-denaturation at 95 ℃ for 5min;

and a second step of: 30 cycles (denaturation at 95℃for 30 sec. Fwdarw. Annealing at 52℃for 30 sec. Fwdarw. 72℃for 60 sec);

and a third step of: extending at 72 ℃ for 7min;

fourth step: 4℃until sampling.

4. Agarose gel electrophoresis detection

Refer to step 2.4 above.

5. Purifying a PCR product by an enzymolysis method: to 5. Mu.L of the PCR product, 0.5. Mu.L of exonuclease I (Exo I), 1. Mu.L of alkaline phosphatase (AIP) was added, and the mixture was digested at 37℃for 15min and inactivated at 85℃for 15min.

6. BigDye reaction

The BigDye reaction system is shown in Table 9.

TABLE 9 BigDye reaction System

Sequencing PCR cycling conditions:

the first step: pre-denaturation at 96℃for 1min;

and a second step of: 33 cycles (denaturation at 96℃for 30 sec. Fwdarw. Annealing at 55℃for 15 sec. Fwdarw. 60℃for 4 min);

and a third step of: 4℃until sampling.

7. And (3) purifying a BigDye reaction product:

1) mu.L of 125mM EDTA (pH 8.0) was added to each tube, and 1. Mu.L of 3mol/L NaAc (pH 5.2) was added to the bottom of the tube;

2) Adding 70 μL 70% alcohol, shaking and mixing for 4 times, and standing at room temperature for 15min;

3) 3000g, centrifuging at 4 ℃ for 30min; immediately inverting the 96-well plate, and centrifuging 185g for 1min;

4) Standing at room temperature for 5min, volatilizing residual alcohol at room temperature, adding 10 μl Hi-Di formamide to dissolve DNA, denaturing at 96 deg.C for 4min, rapidly placing on ice for 4min, and sequencing on machine.

8. Sequencing

And (3) carrying out DNA sequencing on the purified BigDye reaction product, wherein sequencing primers are designed on the basis of SEQ ID NO.1 and SEQ ID NO.2, and nest primers (the second set of primers are designed within the range of the product sequence obtained by amplifying the first set of primers) are used as sequencing primers, and the primer sequences are shown as follows.

The sequencing primer sequences for the MEN1: NM-000244.4: exon2: c.78G > C: p.E26D sites are shown below:

MEN1-Seq1F：5’-GAGGGGTCTCACCGACAA-3’（SEQ ID NO.3）

MEN1-Seq1R：5’-ACTGGGCTCCAACCTGTG-3’（SEQ ID NO.4）；

9. analysis of results

The sequencing results for MEN1: NM-000244.4: exon2: c.78G > C: p.E26D sites are shown in FIG. 2. From FIG. 2, it can be seen that 2 patients in line 1 were heterozygous for the MEN1: NM-000244.4: exo2: c.78G > C: p.E26D locus genotype "c.78G > C"; 2 normal individuals in line 1 and 100 normal controls without blood relationship were "wild type" in MEN1: NM-000244.4: exon2: c.78G > C: p.E26D locus genotype.

Example 4

Multiple endocrine adenomatosis 1 type diagnostic kit and application

1. The kit comprises the following components:

kit 1: 1) Amplification primers: SEQ ID NO.1 and SEQ ID NO.2 as in example 3; 2) PCR buffer (10 XPCR buffer, from KCl 500mmol/L, tris-HCl (pH 8.3) 100mmol/L and MgCl ₂ 15 mmol/L); 3)TaqEnzyme (20U); 4) dNTPs (4 mM each of the four dNTPs); 5) c.78G>C-positive reference DNA, the reference is a double-stranded DNA, c.78G>The specific sequence of the C mutation site positive reference is shown in SEQ ID NO.7, and the specific sequence is as follows: 5' -ggggcacag tcgtagagagggggcggggcggccattggggctcctcattggggtgcttggggcgcaccccatcgggtaccgggcgtcccggaattgtgggggacaaaaaggctctgcagtctcggct gaggggtctcaccgacaa aagaggggaagccggtgagcagaggctgaagagggtggggaagcaggggagctgtgcgtgtgtcggggcgggtggaaccttagcggaccctgggaggaggctccccggccgaacctgcccgaccctccctcccccggcttgccttgcagGCCGCCGCCCACCGCCCGCCGCCATGGGGCTGAAGGCCGCCCAGAAGACGCTGTTCCCGCTGCGCTCCATCGACGACGTGGTGCGCCTGTTTGCTGCCGACTGGGCCGAGAGGAGCCGGACCTGGTGCTCCTTTCCTTGGTGCTGGGCTTCGTGGAGCATTTTCTGGCTGTCAACCGCGTCATCCCTACCAACGTTCCCGAGCTCACCTTCCAGCCCAGCCCCGCCCCCGACCCGCCTGGCGGCCTCACCTACTTTCCCGTGGCCGACCTGTCTATCATCGCCGCCCTCTATGCCCGCTTCACCGCCCAGATCCGAGGCGCCGTCGACCTGTCCCTCTATCCTCGAGAAGGGGGTGTCTCCAGCCGTGAGCTGGTGAAGAAGGTCTCCGATGTCATATGGAACAGCCTCAGCCGCTCCTACTTCAAGGATCGGGCCCACATCCAGTCCCTCTTCAGCTTCAT CACAGGTTGGAG CCCAGT AGgtgggaatcttatccatgacccacttcttcaaaaccctccatggtttacagaacccttttaagaactgtaagccttgtgaggttcggcaggtgttattttcctctttgc-3', PCR amplification of the upstream and downstream only underlined basesPrimer position. The letters in the boxes are mutation sites. Underlined, bolded and obliquely labeled bases are used as upstream and downstream sequencing primer positions. Lower case letters are sequences of intronic regions. Capital letters are sequences of exon regions. 6) Sequencing primer: as shown in SEQ ID NO.3 and SEQ ID NO. 4.

2. The using method comprises the following steps:

screening and detecting 522 individuals in 116 families including parathyroid tumor, islet tumor and anterior pituitary tumor, endocrine glycometabolism abnormality and the like, and finding again 11 24 patients in the family according to the present invention (see table 10); the application of the gene mutation detection kit is now described by taking a family No.2 as an example. The clinical information of family 2 is shown in table 11, and the family 2 map is shown in fig. 3.

TABLE 10 list of multiple endocrine adenomatosis type 1 screening conditions

: is a new variant, not inherited from its parent.

TABLE 11 clinical information of multiple endocrine adenomatosis type 1, family members

Note that: i and II sequentially represent a first generation and a second generation.

The peripheral blood DNA of family personnel I1, I2, II 1 and II 2 of the family personnel II are used for detection of the kit 1; the method comprises the following steps:

1) Genomic DNA extraction: extracting a sample genomic DNA according to the procedure of example 2;

2) Firstly, adopting PCR amplification primer in the kit,TaqPerforming PCR amplification reaction on enzyme, buffer solution, dNTPs, sample genome DNA and the like, wherein the PCR amplification reaction is specifically performed in the step 3 of the example 3;

3) Purifying the PCR amplified product, specifically as in step 5 of example 3;

4) Performing a BigDye reaction on the purified PCR product by using the sequencing primer in the kit, wherein the specific method is as in step 6 of example 3;

5) Purifying the BiyDye reaction product, and specifically performing the step 7 as in the example 3;

6) The biydiye reaction product was sequenced and the sequenced sequence compared to the normal sequence as specified in example 3, step 8.

The detection result of the kit on the family personnel No.2 is shown in fig. 4, wherein the position pointed by the arrow of the layer C shows that the genotype of the first-evidence MEN 1:NM_000244.4:exo2:c.78G > C:p.E26D locus is the heterozygous mutation of 'c.78G > C'; the male parent and sister of the first witness of the layers A and D also detect the heterozygote mutation of 'c.78G > C'; the mother of the B-layer forerunner has no mutation; the detection result confirms that the first-evidence person, father and sister of the first-evidence person are patients with multiple endocrine adenomatosis type 1, and the mother genotype of the first-evidence person is wild type and normal individual. The probability of the first-born and first-born sister later to generate offspring of the type 1 patients with the multiple endocrine adenomatosis is 1/2, and considering that the disease can influence fertility, the patients are recommended to visit a reproductive center of a hospital if the need of fertility exists.

Example 5

Gene mutation ranking and interpretation (pathogenicity of mutation)

Mutation interpretation is based on our current knowledge of the multiple endocrine adenomatosis type 1 and pathogenic gene MEN1 (https:// www.omim.org/entry/131100), and the clinical phenotypic association of the test subjects. Mutations follow the HGVS guidelines for mutation nomenclature (http:// www.hgvs.org /), and are named according to GenBank accession numbers (https:// www.ncbi.nlm.nih.gov/GenBank /). The rules for interpretation of genetic variation data refer to guidelines associated with the american society of medical genetics and genomics (American College of Medical Genetics and Genomics, ACMG): richards, S,et al., Standards and guidelines for the interpretation of sequence variants:a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med, advance online publication 5 March 2015doi 10.1038/gim.2015.30; chinese classification standards and guidelines for genetic variation: wang Qiuju, shen Yiping, ling KV, et al, classification standards and guidelines for genetic variation: life sciences, 2017, 47:668-688.

the genetic variation classification in the "genetic variation classification criteria and guidelines" is to perform five-level classification on variations based on typical data types (such as crowd data, calculation data, functional data, co-segregation data), which are respectively: "pathogenic (P)", "potentially pathogenic (likely pathogenic, LP)", "ambiguous (variant of uncertain significance, VUS)", "potentially benign (LB)", and "benign (B)"; the five-level classification was determined based on the composite score after interpretation analysis of each side/sub-item of variation (table 12).

TABLE 12 determination criteria for pathogenicity of variation

Before a five-level assessment, the sides/sub-items of the mutation/variation need to be analyzed/interpreted. Among these, the pathogenic mutation criteria can be classified as: for a given mutation/mutation, first, the criteria in Table 13 need to be selected based on observed evidence, it is determined which side/sub-items of the mutation/mutation can meet in Table 13, each is evaluated as being PVS1/PS 1-4/PM 1-6/PM 1-5/BA 1/BS 1-4/BP 1-6, and finally, the sub-items of the mutation/mutation can be combined according to the scoring rules of Table 12, and then a classification is selected from the five-level system according to the combined criteria of Table 12, e.g., if the side/sub-items of the mutation/mutation meet in Table 13 after analysis of the side/sub-items of the mutation/mutation by the criteria [ i.e., P1 ] "(i.e., the comprehensive criteria of the" comprehensive "P1, P1" is satisfied by the comprehensive criteria of "in Table 12)".

TABLE 13 variant interpretation criteria and variant pathogenicity criterion

/>

Analysis/interpretation of the sides/sub-items of mutations/variations needs to be based on the corresponding bioinformatic analysis tools (see table 15) and a number of available data (libraries) (see table 16), including data obtained from existing cases, as well as data that has been published, such as public databases (e.g., clinVar or site-specific databases) and laboratory owned databases. The degree judgment evaluation criteria used in the analysis of mutation/mutation using various data (libraries) are shown in table 14.

Table 14 degree judgment evaluation criteria

/>

Table 15 biological information analysis tool

Table 16 crowd database, disease-specific database and sequence database

According to the above criteria or guidelines, the c.78G > C mutation of the MEN1 gene of the present invention is assessed as "pathogenic", and the judgment criteria and specific evidence are shown in Table 17 below:

TABLE 17 pathogenic interpretation of c.78G > C mutations of MEN1 gene

AD: refers to autosomal dominant inheritance.

The evidence of variation ratings of MEN1: NM-000244.4: exon2: c.78G > C: p.E26D is as follows:

1. PS 2: through family personnel detection such as parents of a forerunner, the variation is analyzed and verified in 1 family to be a new variation (see table 10), namely the variation is a new variation confirmed by the relationship;

2. PS4: combining literature and this case, this variation was detected in multiple patients (27) (see tables 1, 10 and 11);

3. PM1: the mutation is located in the hot spot mutation region, in the key domain of MEN1 protein (Nucleoside diphosphate kinase A active site);

4. PM2: the MEN1 gene c.78G > C variation was not found in the reference human thousand genome (1000G), the human exon database (ExAC) and the human genome mutation frequency database (gnomAD);

5. PP1: in this series of cases, the mutation and disease are co-separated in family members;

6. PP3: various computer software predicts that this variation will have deleterious effects on the gene or gene product;

7. PP4: in this series of cases, the disease associated with the variation is highly consistent with the symptoms and family history of the patient.

Thus, the comprehensive evidence of this mutation/variation (ps2+ps4+pm1+pm2+pp1+pp3+pp4) meets the "pathogenicity (P)" criterion (ii) in table 12, where the MEN1 gene c.78g > C variation is comprehensively determined to be "pathogenicity".

Example 6

Follow-up and diagnostic kit detection performance analysis

All family members were followed and re-sequenced analysis was performed on all individuals using the MEN1 gene targeted capture chip method (see table 18).

TABLE 18 results of Performance analysis for 78G > C site detection

Note that: the table contains follow-up data for family 1.

As can be seen from Table 10, positive patients (26 cases) were found when the 12 families were examined. The positive site detection results are verified by a MEN1 gene targeting capture chip method. Based on the follow-up and verification results, 26 true positive cases, 33 true negative cases, 0 false negative and 0 false positive cases were found in total at this time. The sensitivity of detection of the 78G > C mutation site marker is 100.00%, 95% CI is 99.03% -100%, the specificity is 100%, and 95% CI is 99.03% -100%. The results show that the kit has good detection performance in clinical application.

As can be seen from the above examples, the MEN1 of the present inventionGeneThe mutant can be used as a biomarker for diagnosing multiple endocrine adenomatosis type 1, and provides a possible drug target for treating multiple endocrine adenomatosis type 1.

Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.

Claims

1. A MEN1 gene mutant, characterized in that the MEN1 gene mutant is mutated from G to C at base 78 of the wild type MEN1 gene compared to the wild type MEN1 gene.

2. A MEN1 mutant protein, wherein the MEN1 mutant protein has a mutation from glutamic acid to aspartic acid at amino acid position 26 compared to the protein encoded by the wild-type MEN1 gene.

3. The use of the MEN1 gene mutant according to claim 1 as a detection target in preparing a detection reagent of type 1 of multiple endocrine adenomatosis and/or a detection kit of type 1 of multiple endocrine adenomatosis.

4. The use according to claim 3, wherein the detection reagent and/or the detection kit comprises amplification primers comprising an upstream primer MEN1-1F and a downstream primer MEN1-1R; the upstream primer MEN1-1F comprises a nucleotide sequence shown as SEQ ID NO.1, and the downstream primer MEN1-1R comprises a nucleotide sequence shown as SEQ ID NO. 2.

5. The use according to claim 3, wherein the detection reagent and/or the detection kit comprises sequencing primers comprising an upstream primer MEN1-Seq1F and a downstream primer MEN1-Seq1R; the upstream primer MEN1-Seq1F comprises a nucleotide sequence shown as SEQ ID NO. 3; the downstream primer MEN1-Seq1R comprises a nucleotide sequence shown as SEQ ID NO. 4.

6. The use of the MEN1 mutant protein of claim 2 as a detection target in preparing a detection reagent for multiple endocrine adenomatosis type 1 and/or a detection kit for multiple endocrine adenomatosis type 1.

7. A reagent for detecting type 1 endocrine adenomatosis, comprising the MEN1 gene mutant according to claim 1 or the MEN1 mutant protein according to claim 2.

8. A kit for detecting type 1 multiple endocrine adenomatosis, wherein the kit comprises the reagent for detecting type 1 multiple endocrine adenomatosis according to claim 7.